Modificación de vectores de expresión de Baculovirus para producir secretado proteínas vegetales en células de los insectos

JoVE Journal
Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Aquí, presentamos los protocolos para la utilización de la célula y baculovirus proteína expresión sistema insecto para producir grandes cantidades de proteínas vegetales segregada para la cristalización de proteínas. Un vector de expresión de baculovirus se ha modificado con GP67 o insectos hemolin péptido señal para la expresión de la secreción de la proteína de planta en células de los insectos.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Chakraborty, S., Trihemasava, K., Xu, G. Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells. J. Vis. Exp. (138), e58283, doi:10.3791/58283 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Ha sido un reto para los científicos expresar proteínas recombinantes de eucariotas secretores para estudios estructurales y bioquímicos. El sistema de expresión celular de insecto baculovirus-mediada es uno de los sistemas utilizados para expresar proteínas secretoras eucarióticas recombinantes con algunas modificaciones poste-de translación. Las proteínas secretoras que deba canalizarse a través de las vías secretoras de glycosylation de la proteína, formación de enlaces disulfuro y otras modificaciones poste-de translación. Para mejorar la expresión de células de insectos existentes de proteínas secretoras de vegetales, un vector de expresión de baculovirus se modifica por la adición de un GP67 o una secuencia de péptido señal hemolin entre el promotor y la clonación de múltiples sitios. Este sistema de nuevo diseño vector modificado había producido con éxito un alto rendimiento de proteínas de receptor soluble recombinante planta secretada de Arabidopsis thaliana. Dos de las proteínas de la planta expresada, los dominios extracelulares de los receptores de membrana plasmática de Arabidopsis TDR y PRK3, se cristalizaron para estudios cristalográficos de rayos x. El sistema vector modificado es una herramienta mejorada que potencialmente puede ser utilizada para la expresión de proteínas recombinantes secretores en el reino animal también.

Introduction

Es imprescindible para un laboratorio de investigación ser capaces de producir grandes cantidades de proteínas recombinantes homogéneas para caracterizaciones bioquímicas y biofísicas, especialmente para estudios cristalográficos de rayos x. Existen muchos sistemas de expresión heteróloga bien establecido como Escherichia coli, levaduras, células de los insectos, células de mamíferos, células de la planta, etc. entre ellos, el sistema de expresión celular de insecto baculovirus-mediada es uno de los más usan técnicas para producir grandes cantidades de proteínas eucarióticas recombinantes gran tamaño estructural plegadas para la cristalización de proteínas1.

Los vectores de expresión del sistema de expresión de baculovirus se han diseñado para contener una fuerte polyhedrin o promotor de P10 para producir un alto rendimiento de proteínas recombinantes intracelular2,3. Para hacer un baculovirus recombinante, se clona el gen de interés en un insecto vector que contiene el locus polyhedrin (polh) del genoma de nucleopolyhedroviral múltiple de Autographa californica . La construcción resultante luego se ordena y se verifica su marco correcto de lectura abierta (ORF). La construcción correcta es entonces introducida en la célula de insecto huésped a través del proceso de transfección. El gen de interés se inserta en el genoma viral por recombinación homóloga. Este evento resulta en la producción del genoma viral recombinante, que luego se replica en producir recombinantes reverdeció de partículas de virus1.

Las células de los insectos que comúnmente se utilizan en el sistema de expresión son Sf9 y cinco celdas (Hi5). Las células SF9 son un aislamiento clonal de Sf21, derivado de las células ováricas pupas de Spodoptera frugiperda, y células de Hi5 un aislamiento clonal derivado de la parental Trichoplusia ni ovárico de la célula línea TN-3684,5. Transfecciones Co, amplificación virus y ensayos de placa se llevan a cabo en las células Sf9, mientras que las células Hi5 típicamente se seleccionan para producir mayores cantidades de proteínas recombinantes6. Cabe destacar que las células de Hi5 no son adecuadas para la generación y amplificación de progenie del virus debido a su tendencia a producir virus mutantes. Tradicionalmente, un rango de temperatura de 25-30 ° C se considera buena para el cultivo de células de los insectos. Sin embargo, se ha reportado que 27-28 ° C es la temperatura óptima para el insecto célula crecimiento e infección7,8.

La introducción de una secuencia de señal fuerte precede el gene es necesario para la alta expresión de las proteínas secretadas. La secuencia de la señal guía eficientemente la proteína recombinante traducida en el retículo endoplásmico para la secreción de proteínas y modificaciones postraduccionales necesarias para el plegamiento correcto y estabilización3. Secuencias de péptidos de señal, tales como el baculovirus envuelven proteína GP64/67, abeja melitina y otros, han sido elegidas para facilitar la expresión de proteínas recombinantes secretores en los sistemas de expresión de baculovirus-mediada3. La introducción del péptido señal de GP67 ha demostrado para mejorar el rendimiento de la expresión de una proteína recombinante secretada, en comparación con usando el péptido señal intrínseca del objetivo gen9. Hemolin es una proteína de la hemolinfa de la polilla de seda gigante Hyalophora cecropia, inducida por bacterias infección10. Debido al relativamente alto nivel de expresión inducida, puede utilizarse la secuencia del péptido de señal del gen para mediar en la expresión de la secreción de proteínas recombinantes en el sistema de células de insecto baculovirus.

La a. thaliana Tracheary elementos diferenciación inhibidor Factor Receptor (TDR) y el polen del Receptor quinasa 3 (PRK3), ambos pertenecen a la Leucine-rich Repeat Receptor-como Kinase (LRR-RLK) familia de proteínas11,12 . Para estudiar la estructura y la función de esta familia de receptores proteínas vegetales, así como para facilitar la caracterización bioquímica y estructural de otras proteínas vegetales secretada, se ha modificado el sistema de expresión de baculovirus-insecto célula a mejorar el rendimiento de producción y calidad de proteína. Los dominios extracelulares de TDR y PRK3 se han expresado con éxito mediante dos vectores de expresión modificada en el sistema de expresión de células de insecto baculovirus. Tanto los dominios extracelulares de proteínas TDR y PRK3 han se ha cristalizado. Este artículo divulga la expresión y purificación de grandes cantidades de proteínas recombinantes secretadas planta con vectores de expresión de baculovirus modificados dos incorporando un GP67 o una secuencia de señal hemolin entre el promotor y múltiples sitios.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Nota: Se utiliza un sistema de células de insecto/baculovirus con vectores de expresión modificada de expresión de la proteína secretora de la planta y la cristalización.

1. modificación de un Vector de expresión de Baculovirus con el péptido de señal GP67 para la expresión de la secreción de la proteína de planta

  1. Sintetizar un fragmento de ADN que contiene una 5' BglII corte sitio13, la secuencia de señal GP67 secreción y un sitio de clonación múltiple con NotI, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI y XhoI (figura 1A).
    Nota: Puesto que BglII y BamHI digestión DNA dio lugar a los mismos fines de adhesivo, el vector linearizado puede ligar al fragmento de ADN digerido mientras la BglII y BamHI sitios en la secuencia de ligadura recocido se mutó a una secuencia que no es divisible por BglII o BamHI14.
  2. Resumen 4 μg del ADN con BglII y XhoI y 4 μg de un vector de expresión ADN con BamHI y XhoI14. Mezclar 10 unidades de cada enzima de restricción con el ADN en un 1 x de tampón de reacción concentración (acetato de potasio de 50 mM, 20 mM Tris acetato, acetato de magnesio de 10 m m y 100 μg/mL de BSA, pH 7.9 a 25 ° C) e incubar la mezcla a 37 ° C durante 4 horas.
    1. Purificar el fragmento de ADN suprimido y el vector linearizado ADN por un kit de la extracción del gel de ADN15.
  3. Mezcla 100 ng lineal del vector de la DNA con 400 ng de ADN digerido del fragmento en una mezcla de reacción de la ligadura de 10 μl que contiene 1 x buffer de reacción T4 ADN ligasa (50 mM Tris HCl, 10 mM MgCl2, ATP de 1 mM y 10 mM DTT, pH 7.5 a 25 ° C) y 5 unidades de la DNA de T4 ligasa. Incubar la mezcla de reacción a 16 ° C por 16 h.
  4. Transformar 5 μl de la mezcla de ligadura en 100 μl de células competentes DH5α siguiendo un protocolo de transformación estándar y seleccione las colonias resultantes en una ampicilina-LB agar placa16. Recoger 5-10 colonias y crecimiento de cada colonia en 2 mL de medio LB con ampicilina de μg/mL 100 a 220 rpm y 37 ° C en un incubador de agitación por 16 h.
  5. Extraer cada ADN plásmido con una DNA miniprep kit17 y confirmar los clones por la secuencia de la DNA con una cartilla de AGTATTTTACTGTTTTCGTAACAG.
  6. Amplificar por PCR el gen de a. thaliana TDR fragmento codificación residuos 30-642 de un gen sintético de TDR construir (hacia delante la cartilla: CATG GCGGCCGC CTCAAGTTTTCACCTCAACTCTTGTC, primer revés: GC GGATCC CTA GTG GTG ATG GTG GTG GTG ACCGTCTATATCTGCATTTCCGGC). Amplificar el ADN de 30 ciclos en un tampón de reacción de polimerasa de la DNA que contiene una mezcla de dNTP de 0,5 mM, cebadores de μm 0,2, 0,1 μg de plantilla de ADN, 0,4 mM MgCl2y 1 unidad de reacción de polimerasa de la DNA.
    1. Para los pasos del ciclo de PCR, establecer la desnaturalización inicial a 95 ° C por 30 s y luego de 30 ciclos de desnaturalización a 95 ° C por 30 s, recocido a 55 ° C para 30 s y extensión a 72 ° C por 1 min, con una extensión final a 72 ° C durante 5 minutos.
  7. Digerir el fragmento de la polimerización en cadena y el vector modificado con enzimas de restricción endonucleasa NotI y BamHI. Ligar el fragmento del gen con el vector linearizado. Mezcla 100 ng lineal del vector de la DNA con 400 ng de ADN digerido del fragmento en una mezcla de reacción de la ligadura de 10 μl con T4 ADN ligasa reacción tampón y 5 unidades de ligase de la DNA de T4. Incubar la mezcla de reacción a 16 ° C por 16 h.
  8. Transformar 5 μl de la mezcla de ligadura en 100 μl de células competentes DH5α siguiendo un protocolo de transformación estándar y seleccione las colonias resultantes en una ampicilina-LB agar placa16. Para confirmar los clones correcta secuencia de la DNA.

2. modificación de un Vector de expresión de Baculovirus con el péptido de señal Hemolin insectos para la expresión de la secreción de la proteína de planta

  1. Sintetizar un fragmento de ADN que contiene una 5' BglII corte sitio13, la secuencia de la señal de secreción de insectos hemolin y un sitio de clonación múltiple con NotI, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI y XhoI (figura 1B).
  2. Resumen 4 μg del ADN con BglII y XhoI y 4 μg de un vector de expresión ADN con BamHI y XhoI14. Mezclar 10 unidades de cada enzima de restricción con el ADN en un 1 x de tampón de reacción concentración (acetato de potasio de 50 mM, 20 mM Tris acetato, acetato de magnesio de 10 m m y 100 μg/mL de BSA, pH 7.9 a 25 ° C) e incubar la mezcla a 37 ° C durante 4 horas.
    1. Purificar el fragmento de ADN suprimido y el vector linearizado ADN por un kit de la extracción del gel de ADN15.
  3. Mezcla 100 ng lineal del vector de la DNA con 400 ng de ADN digerido del fragmento en una mezcla de reacción de la ligadura de 10 μl que contiene 1 x buffer de reacción T4 ADN ligasa (50 mM Tris HCl, 10 mM MgCl2, ATP de 1 mM y 10 mM DTT, pH 7.5 a 25 ° C) y 5 unidades de la DNA de T4 ligasa. Incubar la mezcla de reacción a 16 ° C por 16 h.
  4. Transformar 5 μl de la mezcla de ligadura en 100 μl de células competentes DH5α y seleccione las colonias en una placa de agar LB ampicilina. Recoger 5-10 colonias y crecimiento de cada colonia en un medio LB de 2 mL conteniendo 100 μg/mL de ampicilina a 37 ° C en un incubador de agitación por 16 h y 220 rpm.
  5. Extraer ADN de plásmido con una DNA miniprep kit17 y confirmar los clones por la secuencia de la DNA con una cartilla de AGTATTTTACTGTTTTCGTAACAG.
  6. Amplificar por PCR a. thaliana polen del Receptor quinasa 3 (PRK3) fragmento genético codificación de residuos 20-237 de una construcción de genes sintética PRK3 (hacia delante la cartilla: CATG GCGGCCGC CTACAAAACGTTAGTGAATCGGAACC, primer revés: CGC GGATCC CTA GTG GTG ATG GTG GTG GTG TGAAGGTTTCTCATCGCATTCTATATTC). Amplificar el ADN de 30 ciclos en un tampón de reacción de polimerasa de la DNA que contiene una mezcla de dNTP de 0,5 mM, cebadores de μm 0,2, 0,1 μg de plantilla de ADN, 0,4 mM MgCl2y 1 unidad de reacción de polimerasa de la DNA.
    1. Para los pasos del ciclo de PCR, establecer la desnaturalización inicial a 95 ° C por 30 s y luego de 30 ciclos de desnaturalización a 95 ° C por 30 s, recocido a 55 ° C para 30 s y extensión a 72 ° C por 30 s cada ciclo y la extensión final a 72 ° C durante 5 minutos.
  7. Digerir el fragmento de la polimerización en cadena y el vector modificado con enzimas de restricción endonucleasa NotI y BamHI. Ligar el fragmento del gen con el vector linearizado. Mezcla 100 ng lineal del vector de la DNA con 400 ng de ADN digerido del fragmento en una mezcla de reacción de la ligadura de 10 μl con T4 ADN ligasa reacción tampón y 5 unidades de ligase de la DNA de T4. Incubar la mezcla de reacción a 16 ° C por 16 h.
  8. Transformar 5 μl de la mezcla de ligadura en 100 μl de células competentes DH5α siguiendo un protocolo de transformación estándar y seleccione las colonias resultantes en una ampicilina-LB agar placa16. Para confirmar los clones correcta secuencia de la DNA.

3. producción y amplificación de Baculovirus construye albergando el casete de expresión de proteínas recombinantes

  1. Uso 100 ng de plásmido construir transformar 40 μl de células competentes DH10Bac siguiendo el protocolo del sistema de expresión de baculovirus1. Incubar las placas a 37 ° C durante 48 h de transformación.
  2. Recoger dos colonias blancas de cada placa de transformación, inocular cada colonia en 2 mL de medio LB con kanamicina 50 de μg/mL, 7 gentamicina μg/mL y 10 μg/mL tetraciclina. Seguir el protocolo de los baculovirus expression sistema1 para extraer y verificar la bacmid de ADN. Alícuota cada DNA en dos tubos con 20 μl cada una y almacenar los tubos a-20 ° C.
    Nota: Los pasos siguientes requieren una operación aséptica.
  3. Crecer una monocapa de células Sf9 en los antibióticos de penicilina-estreptomicina de medios de cultivo con 10% suero bovino fetal (FBS) y 100 μg/mL (o 100 I.U./mL) a 27 ° C a 80% de confluencia en una placa de 6 pozos. Estimar el porcentaje de confluencia basado en el porcentaje de área cubierta en la placa de cultivo de tejidos.
  4. Preparar las siguientes soluciones en dos tubos de centrífuga de 1,5 mL estéril.
    1. Tubo 1: Para cada transfección, diluir 20 μl de ADN bacmid en 100 μl de medio sin suplemento de cultivo de celular Sf9 sin antibióticos. Mezclar suavemente la dilución por sacudiendo el lado del tubo.
    2. Tubo 2: Para cada transfección, diluir 8 μl de reactivo de transfección de lípidos en 100 μl de medio sin suplemento de cultivo de celular Sf9 sin antibióticos. Homogeneizar la dilución transfiriendo hacia arriba y hacia abajo para x 6.
  5. Combinar las dos soluciones, mezclar suavemente transfiriendo lentamente hacia arriba y hacia abajo para x 3 e incubar por 20-40 min a temperatura ambiente.
  6. Lave cada pocillo de la monocapa Sf9 células x 2 con 3 mL de medio sin suplemento de cultivo de celular Sf9 sin antibióticos. Para cada transfección, agregar 0,8 mL de medio sin suplemento de cultivo de celular Sf9 sin antibióticos a cada tubo que contiene la mezcla de lípidos-DNA. Mezclar suavemente el contenido de los tubos mediante pipeteo lentamente hacia arriba y hacia abajo para x 3. Aspire los medios de lavado de las placas y las muestras con la mezcla de la transfección del recubrimiento.
  7. Después de la adición de la mezcla de transfección, Incube la placa transfected de 5 horas a 27 ° C. Sustituir los medios de comunicación de la transfección con el completo Sf9 medio de cultivo celular que contenga 10% FBS y 100 μg/mL (o 100 I.U./mL) antibióticos de penicilina-estreptomicina. Incube la placa transfected a 27 ° C por 4 d.
  8. Cosecha y amplificar el baculovirus recombinante.
    1. Recoger el sobrenadante de la placa infectada en un tubo cónico de 15 mL estéril después de 4 d de incubación. Girar el sobrenadante a 1010 x g durante 5 min eliminar los restos celulares. Descarte el precipitado y decantar el sobrenadante a un tubo limpio y almacenar a 4 ° C hasta por 1 año.
      Nota: Este es el virus de P0. Puede ser alícuotas y almacenados a-80 ° C durante un tiempo.
    2. Para amplificar cada virus recombinante, crecer una monocapa de células Sf9 en una placa de 150 mm a 80% de confluencia. Aspire los medios de comunicación de la placa, añadir 2 mL del virus P0 el adherente de las células a la placa e Incube la placa durante 1 hora en un incubador de 27 ° C. Roca de la placa cada 15 minutos para mezclar el medio con las células.
      1. Añadir 25 mL de medios de la gracia completa que contiene 10% FBS y 100 μg/mL (o 100 I.U./mL) antibióticos de penicilina-estreptomicina. Incube la placa para 3 d en un incubador de 27 ° C para obtener el virus paso de P1.
    3. Recoger el sobrenadante de la placa infectada en un tubo cónico estéril de 50 mL y centrifugado a 1010 x g durante 5 min eliminar los restos celulares. Decantar el sobrenadante a un tubo limpio y almacenar a 4 ° C hasta por 1 año.
      Nota: El virus P1 puede alícuotas y almacenados a-80 ° C durante un tiempo.
    4. Para amplificar el virus desde P1 a P2 paso, crecer una monocapa de células Sf9 en una placa de 150 mm a 90% de confluencia, aspirar los medios de comunicación de la placa, agregar 2 mL del virus P1 a la placa e incubar durante 1 h en un incubador de 27 ° C.
    5. Repita los pasos 3.8.2 y 3.8.3 para obtener los pasajes P2 y P3 de los virus. No guarde el virus P3 por más de 2 meses.

4. proteína expresión, purificación y NiNTA, cristalización

  1. 1 L de Hi5 células de los insectos en los antibióticos de penicilina-estreptomicina de medios de cultivo con 100 μg/mL (o 100 I.U./mL) a una densidad de 2 x 106 a 100 rpm en un agitador incubador de 27 ° C de la cultura. Desactivación de las células a 570 x g durante 5 min, decantar el sobrenadante, resuspender las células en 20 mL de los virus recién producidos de P3 y mantenerlo a temperatura ambiente por 1 h. Agite suavemente la botella de vuelta para resuspender las células 1 x cada 15 min.
  2. Transferir las células a 1 L de medio de cultivo con 100 μg/mL (o 100 I.U./mL) antibióticos de penicilina-estreptomicina, cultura de las células a 100 rpm en una coctelera de la incubadora de 27 ° C por 72 h. vuelta hacia abajo de las células a 1.010 x g durante 5 min y recoger el sobrenadante.
  3. Tiras indicadoras de pH de uso para ajustar el pH del sobrenadante a 8.0 mediante la adición de 0.1 M HCl o 0,1 M NaOH y añadir el tampón de unión a una concentración final, conteniendo 20 mM de tampón Tris pH 8.0, 100 mM NaCl y el imidazol de 5 mM. Añadir una cierta cantidad de resina NiNTA (10-40 mL) basada en el rendimiento estimado de la proteína recombinante expresada su etiquetado.
    1. Mezcle la solución en una agitación magnética con velocidad baja a 4 ° C por 1 h. lavar la resina y eluir la proteína encuadernada siguiendo el estándar de protocolo de purificación de NiNTA18.
  4. Conforme la proteína purificada a intercambio iónico y cromatografía de filtración, así como otros métodos de purificación de proteínas, para obtener una muestra homogénea del gel.
    Nota: Para el ectodominio TDR, 20 mM Tris, pH 8, 100 mM NaCl fueron utilizados como búfer de filtración de gel. Para PRK3 ectodominio, bis-20 mM de Tris, pH 6, 100 mM NaCl fueron utilizados como el búfer de filtración recomendado: gel.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Como se muestra en la figura 1, se utilizaron dos vectores de expresión de baculovirus modificados pFastBac1 para expresar las proteínas secretadas con la GP67 o la secuencia de señal hemolin para reemplazar la secuencia de la señal intrínseca de la gene de la blanco. GP67 viral y los genes de insectos hemolin han demostrado tener niveles de expresión de alta secreción en las células. Se espera que las proteínas de fusión con cualquiera de estas dos secuencias de señal han mejorado notablemente los niveles de expresión de la secreción. Idénticos que múltiples sitios de clonación (MCS) fueron manipulados en estos dos vectores modificados. Un sitio NotI fue colocado deliberadamente en más 5' lado de los MCS, porque NotI tiene una secuencia de ocho nucleótidos en lugar de la secuencia más común de seis nucleótidos presente en muchos otros sitios de restricción. Como tal, un sitio de NotI es menos presente en los genes blanco que más otros sitios de la restricción, hacer la digestión de restricción y clonación de la mayoría de los genes objetivo más factible en comparación con otros sitios de restricción. Clonación del gene de la blanco entre el NotI y un sitio de restricción aguas abajo presenta sólo tres residuos del aminoácido, GGR, anterior al gene de la blanco.

El pBac1-GP67 y pBac1-Hem se han utilizado con éxito para expresar los dominios extracelulares de los receptores de a. thaliana TDR y PRK3, respectivamente (figura 2). Después de que las proteínas recombinantes se purificaron por NiNTA utilizando una etiqueta de 6 histidina c-terminal ingeniería, la producción de proteína promedio era constante alrededor de 20 mg/L de células Hi5. La pureza de cada proteína está cerca o superior al 50%, examinado con SDS-PAGE y la tinción de Coomassie.

Las proteínas recombinantes de los dominios extracelulares de TDR y PRK3 más se purificaron por cromatografía por exclusión de tamaño (figura 2). La proteína purificada fue concentrada a 5 mg/mL y luego sometido a una investigación de la cristalización. Las condiciones, que rindieron cristales preliminares de cada proteína, se optimizaron hasta cristales de proteínas con un tamaño mayor que 20 μm se observaron (figura 3). Las estructuras cristalinas de dos proteínas han sido reportados11,12.

Figure 1
Figura 1: mapas de los vectores modificados pFastBac1. Las secuencias de ADN se muestra en estos paneles fueron insertadas abajo del polyhedrin promotor del vector pFastBac1, que poseen la secuencia del péptido de señal y los múltiples sitios de clonación (MCS) de genes diana. Ambos vectores contienen el mismo MCS. (A) este panel muestra una secuencia de los clonación sitios aguas abajo del promotor polyhedrin en el vector de pBac1-GP67. El traducido secuencia de aminoácidos de péptidos de señal GP67 se colorea en rojo. Cada sitio de la restricción única en el MCS es subrayado, con el nombre del sitio marcado anteriormente. (B) este panel muestra una secuencia de las clonación sitios aguas abajo del promotor polyhedrin en el vector de pBac1-Hem. La secuencia de aminoácidos de péptidos de señal hemolin traducido es coloreada en rojo. Cada sitio de la restricción única en el MCS es subrayado, con el nombre del sitio marcado anteriormente. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: expresión de la proteína con los vectores de pFastBac1 modificados en el sistema baculovirus-insecto celular. (A) el ectodominio de TDR se expresa en células de los insectos Hi5, purificado por cromatografía por exclusión de tamaño y afinidad níquel (S) y resueltos en gel de SDS-PAGE. La resina de níquel se lavó una vez con un tampón que contiene imidazol (lavado 1) de 5 mM y una segunda vez con imidazol 20 mM (lavado 2). (B) se trata de un análisis de SDS-PAGE que muestra la expresión y purificación de la afinidad de níquel (NiNTA), así como la cromatografía por exclusión de tamaño del ectodominio de PRK3. Marcadores de peso molecular (MW) con los tamaños correspondientes están etiquetados. Las flechas rojas en cada panel denotan las expresiones y los tamaños esperados de la recombinante TDR y PRK3 ectodominio proteínas. Las naturalezas de varias bandas de las proteínas expresadas son probablemente debido a la glicosilación heterogéneo. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3: Cristales de proteínas de los dominios extracelulares de Arabidopsis thaliana TDR y PRK3. (A) este panel muestra los cristales de la proteína de los dominios extracelulares de a. thaliana TDR. (B) este panel muestra los cristales de la proteína de los dominios extracelulares de PRK3 de a. thaliana . Una barra de escala se muestra debajo de cada imagen. Haga clic aquí para ver una versión más grande de esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Dada la diversidad de tamaño y estabilidad de los miles de proteínas presentes en los sistemas biológicos, a menudo es empírica para la investigación de un laboratorio para decidir qué sistema de expresión heteróloga debe elegirse para la expresión de una proteína específica. El sistema de expresión de e. coli es a menudo la primera opción para la expresión de la proteína debido al corto ciclo de vida de las bacterias, bajo costos de los medios de cultivo y la relativa facilidad para escalar19. Para la expresión de proteínas eucariotas grandes con tamaños de más de 60 kDa, sin embargo, con la e. coli sistema resulta a menudo en proteínas insolubles en el cuerpo de inclusión o agregación20. Para la expresión de las proteínas difícil y para otras proteínas secretadas, el sistema de expresión de baculovirus-insecto celular puede ser más ventajoso que la E. coli. Especialmente cuando expresando secretadas proteínas eucarióticas, este sistema de expresión de células de insecto baculovirus modificados podría ser una opción preferida.

Muchas proteínas eucarióticas secretadas, incluyendo proteínas vegetales secretan, necesitan complejo glicosilación, disulfuro formación y otras modificaciones poste-de translación durante el plegamiento y la secreción de proteína21. Sistemas de e. coli no tienen la maquinaria celular para procesar las modificaciones complejo necesarias para muchas proteínas eucarióticas22. La levadura tiene un sistema relativamente más avanzado de glicosilación de e. coli23. Sin embargo, para la expresión de las proteínas secretadas de plantas y especies de eucariotas superiores, el sistema de células de insecto baculovirus presenta una ventaja significativa. Glicosilación afecta a plegamiento de la proteína y estabilidad24, muchas de las proteínas recombinantes secretadas expresado en los sistemas de e. coli y levaduras tienen un rendimiento bajo y tienden a agregado, presumiblemente debido al plegamiento de la proteína correcta. El sistema de baculovirus-insecto se ha modificado para mejorar el glycosylation de la proteína, que lo hace un sistema ideal para la expresión de proteínas eucariotas secretan25. En este estudio, el GP67 y la hemolin señal de péptidos se han utilizado con éxito para guiar la expresión de la secreción de dos proteínas del receptor de la planta de cristalización de proteínas. Con estos estudios en mente, la elección de cualquier péptido señal es un paso crítico y necesita estudios comparativos más sistemáticos con un conjunto de genes de la blanco de diferentes organismos.

La idea de utilizar péptidos señal GP67 y hemolin para mejorar la expresión de la secreción de la proteína fue impulsada por los rendimientos de alta expresión de ambos genes. Sin embargo, si la secreción de proteína y la maquinaria de modificación postraduccional de la hostia de expresión están sobrecargados con las proteínas recombinantes expresadas, las proteínas recombinantes secretadas no tenga modificaciones adecuadas, especialmente la glicosilación. Ambos vectores modificados se han utilizado para expresar con éxito numerosos vegetales proteínas secretoras11,12,26, muchos de los cuales tienden a agregado, que es probablemente debido a la glicosilación incorrecta o inadecuada. Por lo tanto, para la expresión de esas proteínas difícil, ambas secuencias de péptidos de señal fuerte y débil tienen que ser probados y la calidad de las proteínas recombinantes expresadas debe compararse. Tenga en cuenta que una secuencia del péptido de señal débil reducirá el rendimiento global de la proteína; sin embargo, puede dar el mecanismo de secreción de la hostia de expresión suficiente capacidad para procesar la secreción de proteínas y modificaciones.

Además de la expresión de proteínas heterólogas secretadas en células de los insectos, las células de mamífero y sistemas de expresión celular de la planta se han utilizado con éxito en la sobreexpresión de mamífero recombinantes y proteínas vegetales, respectivamente27, 28,29. En comparación con los sistemas heterólogos, la expresión endógena cerca estado de los mamíferos o de las proteínas secretada de planta tendrá los mecanismos de modificación casi nativo en las células hospedadoras para producir proteínas bien dobladas. La salvedad de utilizar el sistema de expresión casi nativo es que las proteínas recombinantes expresadas pueden interferir con la función fisiológica de las células, que pueden tener efectos potencialmente adversos en el rendimiento final de la expresión de las proteínas.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Este trabajo fue apoyado por los nuevos fondos de inicio de la Facultad de la Universidad Estatal de Carolina del norte para Guozhou Xu.

Materials

Name Company Catalog Number Comments
Incubator shaker VWR Model Excella E25 27 oC
Incubator VWR Model 2005 27 oC
Centrifuge BECKMAN Model J-6 with a swing bucket rotor
Herculase II Fusion DNA Polymerase Agilent 600677-51 For PCR amplification of DNA
Thermal Cycler BIO-RAD Model C1000 Touch For PCR amplification of DNA
Incubator shaker New Brunswick Scientific Model I 24 For growing baceria culture
Customer DNA synthesis GENSCRIPT
BamHI (HF) New England Biolabs R3136S Restriction Endonuclease
BglII New England Biolabs R0144S Restriction Endonuclease
NotI (HF) New England Biolabs R3189S Restriction Endonuclease
XhoI New England Biolabs R0146S Restriction Endonuclease
T4 DNA ligase New England Biolabs M0202T DNA ligation
QIAquick Gel Extraction Kit Qiagen 28704 DNA purification from Agorase gel
QIAprep Spin Miniprep Kit Qiagen 27104 Plasmid DNA purification from bacteria culture
Agarose Thermo Fisher Scientific 15510-019 For DNA gel electropherosis
MAX Efficiency DH5α competen cell Invitrogen 18-258-012 For transformation of DNA ligation mixture
Lennox L LB Broth Research Product International Corp. L24066-5000.0 For making bacteria culture
Ampicillin sodium salt Thermo Fisher Scientific 11593-019 Antibiotics
Kanamycin Sulfate Thermo Fisher Scientific 15160-054 Antibiotics
Tetracycline Thermo Fisher Scientific 64-75-5 Antibiotics
Gentamicin Thermo Fisher Scientific 15710-064 Antibiotics
MAX Efficiency DH10Bac competent cells Thermo Fisher Scientific 10361-012 For making bacmid DNA
S.O.C. Medium Thermo Fisher Scientific 15544-034 For DNA transformation
CellFECTIN II Reagent Thermo Fisher Scientific 10362-101 Insect cell transfection reagent
Bac-to-Bac Expression System Thermo Fisher Scientific 10359-016 Baculovirus-insect cells expression kit
Bluo-gal Thermo Fisher Scientific 15519-028 For isolation of recominant Bacmid DNA
IPTG Thermo Fisher Scientific 15529-019 For isolation of recominant Bacmid DNA
pFastBac1 Thermo Fisher Scientific 10360014 Baculorirus expression vector
Sf9 cells Thermo Fisher Scientific 11496015 Sf9 monolayer cells
Hi5 cells Thermo Fisher Scientific B85502 High Five insect cells
Grace’s insect medium, unsupplemented Thermo Fisher Scientific 11595030 Sf9 cell transfection minimum medium
Grace’s insect medium, supplemented Thermo Fisher Scientific 11605102 Sf9 monolayer cell culture complete medium
Sf-900 II SFM Thermo Fisher Scientific 10902104 Sf9 suspension cell culture medium without FBS
Express Five SFM Thermo Fisher Scientific 10486025 Hi5 cell culture medium
Penicillin-Streptomycin Thermo Fisher Scientific 15140122 100 ml (10,000 I.U./ml)
L-Glutamine (200 mM) Thermo Fisher Scientific 25030081 100 ml
FBS Certified Thermo Fisher Scientific 16000-044 500 ml
6-well plates Thermo Fisher Scientific 08-772-1B Flat-bottom
150 mm plates Thermo Fisher Scientific 353025 100/case
1.5 ml Microcentrifuge Tubes USA Scientific 1415-2500 500 tubes/bag
15 ml conical screw cap centrifuge tubes USA Scientific 1475-0511 25 tubes/bag
50 ml conical screw cap centrifuge tubes USA Scientific 1500-1211 25 tubes/bag
Ni-NTA Superflow Qiagen 30430 NiNTA resin
pH-indicator strips EMD Millipore Corporation 1.09535.0001 pH 0 - 14

DOWNLOAD MATERIALS LIST

References

  1. Contreras-Gomez, A., Sanchez-Miron, A., Garcia-Camacho, F., Molina-Grima, E., Chisti, Y. Protein production using the baculovirus-insect cell expression system. Biotechnology Progress. 30, 1-18 (2014).
  2. Khan, S., Ng, M. L., Tan, Y. J. Expression of the severe acute respiratory syndrome coronavirus 3a protein and the assembly of coronavirus-like particles in the baculovirus expression system. Methods in Molecular Biology. 379, 35-50 (2007).
  3. Possee, R. D., King, L. A. Baculovirus Transfer Vectors. Methods in Molecular Biology. 1350, 51-71 (2016).
  4. Vaughn, J. L., Goodwin, R. H., Tompkins, G. J., McCawley, P. The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae). In Vitro. 13, 213-217 (1977).
  5. Hink, W. F. Established insect cell line from the cabbage looper, Trichoplusia ni. Nature. 226, 466-467 (1970).
  6. Davis, T. R., et al. Comparative recombinant protein production of eight insect cell lines. In Vitro Cellular & Development Biology - Animal. 29A, 388-390 (1993).
  7. Wickham, T. J., Nemerow, G. R. Optimization of growth methods and recombinant protein production in BTI-Tn-5B1-4 insect cells using the baculovirus expression system. Biotechnology Progress. 9, 25-30 (1993).
  8. Davis, T. R., Trotter, K. M., Granados, R. R., Wood, H. A. Baculovirus expression of alkaline phosphatase as a reporter gene for evaluation of production, glycosylation and secretion. Nature Biotechnology. 10, 1148-1150 (1992).
  9. Murphy, C. I., et al. Enhanced expression, secretion, and large-scale purification of recombinant HIV-1 gp120 in insect cell using the baculovirus egt and p67 signal peptides. Protein Expression and Purification. 4, 349-357 (1993).
  10. Sun, S. C., Lindstrom, I., Boman, H. G., Faye, I., Schmidt, O. Hemolin: an insect-immune protein belonging to the immunoglobulin superfamily. Science. 250, 1729-1732 (1990).
  11. Li, Z., Chakraborty, S., Xu, G. Differential CLE peptide perception by plant receptors implicated from structural and functional analyses of TDIF-TDR interactions. PLoS One. 12, e0175317 (2017).
  12. Chakraborty, S., Pan, H., Tang, Q., Woolard, C., Xu, G. The Extracellular Domain of Pollen Receptor Kinase 3 is structurally similar to the SERK family of co-receptors. Scientific Reports. 8, 2796 (2018).
  13. Khorana, H. G. Total synthesis of a gene. Science. 203, 614-625 (1979).
  14. Bahl, C. P., Marians, K. J., Wu, R. A general method for inserting specific DNA sequences into cloning vehicles. Gene. 1, 81-92 (1976).
  15. Xu, W., Zhang, Y. Isolation and Characterization of Vaccine-Derived Polioviruses, Relevance for the Global Polio Eradication Initiative. Methods in Molecular Biology. 1387, 213-226 (2016).
  16. Hanahan, D. Studies on transformation of Escherichia coli with plasmids. Journal of Molecular Biology. 166, 557-580 (1983).
  17. Zhang, S., Cahalan, M. D. Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit. Journal of Visualized Experiments. (6), 247 (2007).
  18. Reddy, B. G., et al. Expression and purification of the alpha subunit of the epithelial sodium channel, ENaC. Protein Expression and Purification. 117, 67-75 (2016).
  19. Harris, T. J., Emtage, J. S. Expression of heterologous genes in E. coli. Microbiological Sciences. 3, 28-31 (1986).
  20. Kaur, J., Kumar, A., Kaur, J. Strategies for optimization of heterologous protein expression in E. coli: Roadblocks and reinforcements. International Journal of BIological Macromolecules. 106, 803-822 (2018).
  21. Guo, Y., Yang, F., Tang, X. An Overview of Protein Secretion in Yeast and Animal Cells. Methods in Molecular Biology. 1662, 1-17 (2017).
  22. Blight, M. A., Chervaux, C., Holland, I. B. Protein secretion pathway in Escherichia coli. Current Opinion in Biotechnology. 5, 468-474 (1994).
  23. Idiris, A., Tohda, H., Kumagai, H., Takegawa, K. Engineering of protein secretion in yeast: strategies and impact on protein production. Applied Microbiology and Biotechnology. 86, 403-417 (2010).
  24. Wormald, M. R., Dwek, R. A. Glycoproteins: glycan presentation and protein-fold stability. Structure. 7, R155-R160 (1999).
  25. Geisler, C., Mabashi-Asazuma, H., Jarvis, D. L. An Overview and History of Glyco-Engineering in Insect Expression Systems. Methods in Molecular Biology. 1321, 131-152 (2015).
  26. Li, Z., Chakraborty, S., Xu, G. X-ray crystallographic studies of the extracellular domain of the first plant ATP receptor, DORN1, and the orthologous protein from Camelina sativa. Acta Crystallographica Section F: Structural BIology and Crystallization Communications. 72, 782-787 (2016).
  27. Aricescu, A. R., Owens, R. J. Expression of recombinant glycoproteins in mammalian cells: towards an integrative approach to structural biology. Current Opinion in Structural Biology. 23, 345-356 (2013).
  28. Reuter, L. J., Bailey, M. J., Joensuu, J. J., Ritala, A. Scale-up of hydrophobin-assisted recombinant protein production in tobacco BY-2 suspension cells. Plant Biotechnology Journal. 12, 402-410 (2014).
  29. Dohi, K., et al. Inducible virus-mediated expression of a foreign protein in suspension-cultured plant cells. Archives of Virology. 151, 1075-1084 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics