Modificar vetores de expressão de Baculovirus para produzir secretado proteínas vegetais em células de inseto

JoVE Journal
Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Aqui, apresentamos os protocolos para utilizando o inseto sistema expressão da proteína celular e baculovirus para produzir grandes quantidades de proteínas vegetais secretada por cristalização de proteínas. Um vetor de expressão de baculovirus foi modificado com GP67 ou inseto hemolin peptídeo sinal planta secreção na expressão de proteínas nas células de inseto.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Chakraborty, S., Trihemasava, K., Xu, G. Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells. J. Vis. Exp. (138), e58283, doi:10.3791/58283 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Tem sido um desafio para cientistas de expressar proteínas recombinantes de eucariotas secretoras para estudos bioquímicos e estruturais. O sistema de expressão de células de inseto mediada por baculovirus é um dos sistemas utilizados para expressar proteínas recombinantes de secretoras eucarióticas, com algumas modificações borne-translational. As proteínas secretoras precisam ser roteadas através de vias secretoras para proteína glycosylation, formação de ligações de bissulfeto e outras modificações borne-translational. Para melhorar a expressão célula inseto existentes de proteínas vegetais secretora, um vetor de expressão de baculovirus é modificado pela adição de qualquer um GP67 ou uma sequência de peptídeo sinal hemolin entre o promotor e a clonagem de vários sites. Este sistema de vetor modificado recentemente projetado com sucesso produzido um alto rendimento de proteínas do receptor solúvel recombinante secretada planta de Arabidopsis thaliana. Duas das proteínas expressas da planta, os domínios extracelulares de receptores de membrana plasmática de Arabidopsis TDR e PRK3, foram cristalizada para estudos cristalográficos de raio-x. O sistema do vetor modificado é uma ferramenta melhorada que potencialmente pode ser usada para a expressão de proteínas recombinantes de secretoras no reino animal também.

Introduction

É imperativo para um laboratório de pesquisa ser capaz de produzir grandes quantidades de proteínas recombinantes homogêneas para Caracterização bioquímica e biofísica, especialmente para estudos cristalográficos de raio-x. Existem muitos sistemas de expressão heteróloga bem estabelecidas, tais como Escherichia coli, levedura, células de inseto, células de mamíferos, células vegetais, etc. , entre eles, o sistema de expressão de células de inseto mediada por baculovirus é um dos mais comumente usado técnicas para produzir grandes quantidades de estruturalmente dobrado de grande porte eukaryotic proteínas recombinantes para cristalização de proteínas1.

Os vetores de expressão do sistema de expressão de baculovirus são projetados para conter uma forte polyhedrin ou promotor P10 para produzir um alto rendimento de proteínas recombinantes intracelular2,3. Para tornar um baculovirus recombinante, o gene de interesse foi clonado em um inseto vetor contendo o locus polyhedrin (polh) do genoma de multi-nucleopolyhedroviral Autographa californica . A construção resultante é então sequenciada e seu quadro correto de leitura aberta (ORF) é verificado. A construção correta é então introduzida célula hospedeira de insetos através do processo do transfection. O gene de interesse é inserido no genoma viral por recombinação homóloga. Este evento resulta na produção do genoma viral recombinante, que é então replicada para produzir recombinante brotou de partículas do vírus1.

As células de insetos que são mais comumente usadas no sistema de expressão são Sf9 e alta cinco células (Hi5). Sf9 células são uma clonal isolada de Sf21, derivado das células dos ovários pupal de Spodoptera frugiperda, e Hi5 células são uma clonal isolada derivada o parental Trichoplusia ni ovário célula linha TN-3684,5. Co transfections, amplificação de vírus e ensaios de placa são realizados em células de Sf9, enquanto células Hi5 são normalmente Selecionadodas para produzir maiores quantidades de proteínas recombinantes6. É interessante notar que as células do Hi5 não são adequadas para a geração e amplificação de progênies de vírus por causa de sua tendência a produzir vírus mutantes. Tradicionalmente, uma faixa de temperatura de 25-30 ° C é considerada bom para o cultivo de células de inseto. No entanto, foi relatado que o 27-28 ° C é a temperatura ideal para o inseto celular crescimento e infecção7,8.

A introdução de uma sequência de forte sinal precede o gene é necessária para a alta expressão das proteínas secretadas. A sequência de sinal guiariam eficientemente a proteína recombinante traduzida no retículo endoplasmático por secreção de proteína e modificações borne-translational necessárias para dobramento adequado e de estabilização3. Sequências de peptídeo sinal, tais como os baculovirus envelop proteína GP64/67, Melitina abelha e outros, foram escolhidas para facilitar a expressão de proteínas recombinantes secretoras no expressão mediada por baculovirus sistemas3. A introdução do peptídeo sinal de GP67 foi mostrada para melhorar o rendimento de expressão de uma proteína recombinante secretado, em comparação com usando o peptídeo sinal intrínseco do gene alvo9. Hemolin é uma proteína de hemolinfa da mariposa gigante de seda Hyalophora cecropia, induzida após infecção de bactérias10. Devido o nível relativamente elevado de expressão induzida, a sequência do peptídeo sinal do gene pode ser usada para mediar a expressão de secreção de proteínas recombinantes em sistema de célula de baculovirus-inseto.

O . thaliana Tracheary elemento de diferenciação Inhibitory Factor Receptor (TDR) e pólen Receptor quinase 3 (PRK3), ambos pertencem à família de repetição como Receptor quinase (LRR-RLK) planta rica em leucina de proteínas11,12 . Para estudar a estrutura e a função desta família de receptores proteínas vegetais, bem como para facilitar a caracterização estrutural e bioquímica de outras proteínas de planta secretada, foi modificado o sistema de expressão de células de baculovirus-inseto para Melhore o rendimento de produção e qualidade de proteína. Os domínios extracelulares de TDR e PRK3 com êxito foram expressas usando dois vetores de expressão modificados no sistema de expressão de célula de baculovirus-inseto. Cristalizaram-se ambos os domínios extracelulares de proteínas TDR e PRK3. Este artigo relata a expressão e purificação de grandes quantidades de proteínas recombinantes planta secretada com baculovirus modificados dois vetores da expressão, incorporando um GP67 ou uma sequência de sinal de hemolin entre o promotor e clonagem múltiplos sites.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Nota: É utilizado um sistema de célula/baculovirus inseto com vetores de expressão modificada para expressão de proteínas secretoras de planta e cristalização.

1. modificação de um vetor de expressão de Baculovirus com o peptídeo sinal GP67 para expressão de secreção de proteínas vegetais

  1. Sintetiza um fragmento de DNA contendo uma 5' BglII corte local13, a sequência de sinal de secreção de GP67 e um site multi-clonagem com NotI, BamHI, EcoRI, StuI sobre, SalI, SpeI, XbaI, PstI e XhoI (figura 1A).
    Nota: Desde que ambos BglII e BamHI digerido DNA resultou no mesmas adesivas, extremidades, o vetor tornado linear pode ligar para o fragmento de DNA digerido enquanto o BglII e BamHI sites na sequência da ligadura recozido serão ser uma mutação para uma sequência que não é cleavable por BglII ou BamHI14.
  2. Digest 4 µ g de DNA com BglII e XhoI e 4 µ g de um vetor de expressão DNA com BamHI e XhoI14. 10 unidades de cada enzima de restrição se misturam com o DNA em uma concentração de tampão de reação (acetato de potássio de 50 mM, 20 mM Tris-Acetato, acetato de magnésio de 10 mM e 100 µ g/mL BSA, pH 7.9 a 25 ° C) de 1x e incubar a mistura a 37 ° C por 4 h.
    1. Purifica o fragmento de DNA extirpado e o vetor tornado linear do DNA por um DNA gel de extração kit15.
  3. Mix 100 ng de DNA vetor tornado linear com 400 ng de DNA digerido fragmentar-se em uma mistura de reação de ligadura de 10 µ l contendo 1 x amortecedor da reação T4 DNA ligase (50 mM Tris-HCl, 10 mM MgCl2, ATP de 1 mM e 10 mM DTT, pH 7,5 a 25 ° C) e 5 unidades de ADN T4 ligase. Incube a mistura de reação a 16 ° C, durante 16 h.
  4. Transformar a 5 µ l da mistura de ligadura em 100 µ l de células competentes DH5α, seguindo um protocolo padrão de transformação e selecione as colônias resultantes em um de placa de ágar de ampicilina-LB16. Pegar de 5 a 10 colônias e crescer cada colônia em 2 mL de meio LB contendo 100 ampicilina µ g/mL a 220 rpm e 37 ° C numa incubadora tremendo para 16 h.
  5. Extrair cada plasmídeo com um DNA miniprep kit17 e confirmar os clones de sequenciação de ADN com uma cartilha AGTATTTTACTGTTTTCGTAACAG.
  6. PCR-amplificação do gene TDR a. thaliana fragmento codificação resíduos 30-642 de um gene sintético de TDR construir (encaminhar cartilha: CATG GCGGCCGC CTCAAGTTTTCACCTCAACTCTTGTC, primer reverso: GC GGATCC CTA GTG GTG ATG GTG GTG GTG ACCGTCTATATCTGCATTTCCGGC). Amplifica o DNA para 30 ciclos em um buffer de reação de polimerase de DNA contendo uma mistura de dNTP 0,5 mM, as primeiras demão de 0,2 µM, 0,1 µ g do modelo de DNA, 0,4 mM MgCl2e 1 unidade de reação da polimerase da ADN.
    1. Para as etapas do ciclo PCR, defina a desnaturação inicial a 95 ° C por 30 s e depois de 30 ciclos de desnaturação a 95 ° C por 30 s, recozendo a 55 ° C por 30 s e extensão a 72 ° C por 1 min, com uma extensão final a 72 ° C por 5 min.
  7. Digeri tanto o fragmento PCR e o vetor modificado com NotI e BamHI enzimas endonucleases de restrição. Ligam o fragmento de gene com o vetor tornado linear. Mix 100 ng de DNA vetor tornado linear com 400 ng de DNA digerido fragmentar-se em uma mistura de reação de ligadura de 10 µ l contendo tampão de reação T4 DNA ligase e 5 unidades de T4 DNA ligase. Incube a mistura de reação a 16 ° C, durante 16 h.
  8. Transformar a 5 µ l da mistura de ligadura em 100 µ l de células competentes DH5α, seguindo um protocolo padrão de transformação e selecione as colônias resultantes em um de placa de ágar de ampicilina-LB16. Confirme os corretos clones de sequenciação de ADN.

2. modificação de um vetor de expressão de Baculovirus com o peptídeo sinal Hemolin inseto planta secreção na expressão de proteínas

  1. Sintetiza um fragmento de DNA contendo uma 5' BglII corte local13, a sequência de sinal de secreção de insetos hemolin e um site multi-clonagem com NotI, BamHI, EcoRI, StuI sobre, SalI, SpeI, XbaI, PstI e XhoI (figura 1B).
  2. Digest 4 µ g de DNA com BglII e XhoI e 4 µ g de um vetor de expressão DNA com BamHI e XhoI14. 10 unidades de cada enzima de restrição se misturam com o DNA em uma concentração de tampão de reação (acetato de potássio de 50 mM, 20 mM Tris-Acetato, acetato de magnésio de 10 mM e 100 µ g/mL BSA, pH 7.9 a 25 ° C) de 1x e incubar a mistura a 37 ° C por 4 h.
    1. Purifica o fragmento de DNA extirpado e o vetor tornado linear do DNA por um DNA gel de extração kit15.
  3. Mix 100 ng de DNA vetor tornado linear com 400 ng de DNA digerido fragmentar-se em uma mistura de reação de ligadura de 10 µ l contendo 1 x amortecedor da reação T4 DNA ligase (50 mM Tris-HCl, 10 mM MgCl2, ATP de 1 mM e 10 mM DTT, pH 7,5 a 25 ° C) e 5 unidades de ADN T4 ligase. Incube a mistura de reação a 16 ° C, durante 16 h.
  4. Transformar a 5 µ l da mistura de ligadura em 100 µ l de células competentes DH5α e selecione as colônias em uma placa de ágar de ampicilina-LB. Pegar de 5 a 10 colônias e crescer cada colônia em um meio LB de 2 mL contendo 100 µ g/mL de ampicilina a 220 rpm e 37 ° C numa incubadora tremendo para 16 h.
  5. Extrair o DNA do plasmídeo com um DNA miniprep kit17 e confirmar os clones de sequenciação de ADN com uma cartilha AGTATTTTACTGTTTTCGTAACAG.
  6. PCR-amplificar a. thaliana pólen Receptor quinase 3 (PRK3) gene fragmento codificação resíduos 20-237 de uma construção de gene PRK3 sintética (encaminhar cartilha: CATG GCGGCCGC CTACAAAACGTTAGTGAATCGGAACC, primer reverso: CGC GGATCC CTA GTG GTG ATG GTG GTG GTG TGAAGGTTTCTCATCGCATTCTATATTC). Amplifica o DNA para 30 ciclos em um buffer de reação de polimerase de DNA contendo uma mistura de dNTP 0,5 mM, as primeiras demão de 0,2 µM, 0,1 µ g do modelo de DNA, 0,4 mM MgCl2e 1 unidade de reação da polimerase da ADN.
    1. Para as etapas do ciclo PCR, defina a desnaturação inicial a 95 ° C por 30 s e depois de 30 ciclos de desnaturação a 95 ° C por 30 s, recozendo a 55 ° C por 30 s e extensão a 72 ° C por 30 s dentro de cada ciclo e a extensão final a 72 ° C por 5 min.
  7. Digeri tanto o fragmento PCR e o vetor modificado com NotI e BamHI enzimas endonucleases de restrição. Ligam o fragmento de gene com o vetor tornado linear. Mix 100 ng de DNA vetor tornado linear com 400 ng de DNA digerido fragmentar-se em uma mistura de reação de ligadura de 10 µ l contendo tampão de reação T4 DNA ligase e 5 unidades de T4 DNA ligase. Incube a mistura de reação a 16 ° C, durante 16 h.
  8. Transformar a 5 µ l da mistura de ligadura em 100 µ l de células competentes DH5α, seguindo um protocolo padrão de transformação e selecione as colônias resultantes em um de placa de ágar de ampicilina-LB16. Confirme os corretos clones de sequenciação de ADN.

3. produção e amplificação de Baculovirus constrói abrigando o Cassette de expressão de proteínas recombinantes

  1. Uso 100 ng do plasmídeo de construção para transformar 40 µ l de células competentes DH10Bac, seguindo o protocolo do baculovirus expressão sistema1. Incube as placas de transformação a 37 ° C por 48 h.
  2. Pegue duas colónias brancas de cada prato de transformação, inocular cada colônia em 2 mL de meio LB contendo 50 µ g/mL canamicina, gentamicina 7 de µ g/mL e 10 tetraciclina µ g/mL. Siga o protocolo do baculovirus expressão sistema1 para extrair e verificar a bacmid DNA. Alíquota cada DNA em dois tubos com 20 µ l cada e armazenar os tubos a-20 ° C.
    Nota: As etapas a seguir exigem uma operação asséptica.
  3. Cresce uma monocamada de células Sf9 em meios de cultura com 10% de soro fetal bovino (FBS) e 100 µ g/mL (ou 100 teórica) antibióticos penicilina-estreptomicina a 27 ° C a confluência de 80% em uma placa de 6. Estime a porcentagem de confluência com base na porcentagem de área coberta na placa de cultura de tecidos.
  4. Prepare as seguintes soluções em dois tubos de centrífuga de 1,5 mL estéril.
    1. Tubo 1: Para cada transfeccao, dilua 20 µ l de bacmid DNA em 100 µ l de unsupplemented meio de cultura celular Sf9 sem antibióticos. Misture delicadamente a diluição por agredir o lado do tubo.
    2. Tubo 2: Para cada transfeccao, dilua 8 µ l de reagente de Transfeccao de lipídios em 100 µ l de unsupplemented meio de cultura celular Sf9 sem antibióticos. Homogeneiza a diluição pipetando para cima e para baixo para x 6.
  5. Combinar as duas soluções, misture-os delicadamente pipetando lentamente acima e para baixo para x 3 e incube-os por 20-40 min à temperatura ambiente.
  6. Lavagem de cada poço da monocamada Sf9 células 2x com 3 mL de meio de cultura de células Sf9 unsupplemented sem antibióticos. Para cada transfeccao, adicione 0,8 mL de meio de cultura de células Sf9 unsupplemented sem antibióticos a cada tubo contendo a mistura de lipídios-DNA. Misture o conteúdo dos tubos suavemente pipetando lentamente acima e para baixo para x 3. Aspirar a mídia de lavagem das placas e as amostras com a mistura de Transfeccao de sobreposição.
  7. Após a adição da mistura de transfeccao, incubar a placa transfectada para 5h a 27 ° C. Substitua os meios de comunicação de transfeccao completa Sf9 célula meio de cultura contendo 10% FBS e 100 µ g/mL (ou 100 teórica) antibióticos penicilina-estreptomicina. Incube a placa transfectada a 27 ° C, durante 4 d.
  8. Colheita e amplificar o baculovirus recombinante.
    1. Recolha o sobrenadante da placa infectado em um tubo cônico de 15 mL estéril após 4D de incubação. Gire o sobrenadante a 1010 x g por 5 min remover os detritos de células. Descartar a pelota e decante o sobrenadante para um tubo limpo e armazená-lo em 4 ° C por até 1 ano.
      Nota: Este é o vírus de P0. Pode ser aliquotadas e armazenado a-80 ° C por um longo período de tempo.
    2. Para amplificar cada vírus recombinantes, cresce uma monocamada de células Sf9 em uma placa de 150 mm a confluência de 80%. Aspire a mídia do prato, adicione 2 mL do vírus P0 para o aderente de células para a placa e incubar a placa por 1h em uma incubadora de 27 ° C. Agitar a placa cada 15 min para misturar o meio com as células.
      1. Adicionar 25 mL de mídia da Grace completo contendo 10% FBS e 100 µ g/mL (ou 100 teórica) antibióticos penicilina-estreptomicina. Incube a placa para 3-d em uma incubadora de 27 ° C para obter o vírus de passagem P1.
    3. Recolha o sobrenadante da placa em um tubo cônico estéril de 50 mL e girar a 1010 x g por 5 min remover os detritos de células infectada. Decante o sobrenadante para um tubo limpo e armazená-lo em 4 ° C por até 1 ano.
      Nota: O vírus P1 pode ser aliquotadas e armazenado a-80 ° C por um longo período de tempo.
    4. Para amplificar o vírus de P1 para P2 passagem, crescer uma monocamada de células Sf9 em uma placa de 150 mm a confluência de 90%, aspirar a mídia da placa, adicione 2 mL do vírus P1 para a placa e incubá-lo por 1h em uma incubadora de 27 ° C.
    5. Repita as etapas 3.8.2 e 3.8.3 para obter as passagens P2 e P3 dos vírus. Não guarde o P3 vírus por mais de 2 meses.

4. proteína expressão, purificação com NiNTA e cristalização

  1. Cultura 1 L de células de inseto Hi5 em meios de cultura com 100 µ g/mL (ou 100 teórica) antibióticos penicilina-estreptomicina para uma densidade de 2 x 106 a 100 rpm em um shaker de incubadora de 27 ° C. Gire para baixo as células a 570 x g por 5 min, decante o sobrenadante, Ressuspender as células em 20 mL do vírus P3 recentemente produzido e mantê-lo em temperatura ambiente por 1 h. Agite suavemente o frasco de rotação para Ressuspender as células 1 x a cada 15 min.
  2. Transferir as células para 1 L de antibióticos penicilina-estreptomicina de meios de cultura com 100 µ g/mL (ou 100 teórica), cultura de células em 100 rpm em um shaker de incubadora de 27 ° C por 72 h. Spin para baixo as células a 1.010 x g por 5 min e recolher o sobrenadante.
  3. Indicador de pH de uso tiras para ajustar o pH do líquido sobrenadante para 8.0 adicionando ou 0.1 M HCl ou NaOH 0.1 de M e adicionar tampão de ligação em uma concentração final, contendo tampão Tris de 20mm a pH 8.0, 100 mM de NaCl e imidazol de 5 mM. Adicione uma certa quantidade de resina NiNTA (10-40 mL) com base no rendimento estimado da proteína recombinante com sua tag expressa.
    1. Misturar a solução em uma agitação magnética com baixa velocidade a 4 ° C, durante 1 h. lavagem a resina e eluir a proteína ligada seguindo o padrão de protocolo de purificação NiNTA18.
  4. Submeta a proteína purificada a troca iônica e cromatografia de filtração, bem como outros métodos de purificação de proteínas, para produzir uma amostra homogênea do gel.
    Nota: Para o ectodomínio TDR, 20 mM Tris, pH 8, 100 mM de NaCl foram usadas como amortecedor de gel filtração. Para o ectodomínio PRK3, bis-Tris de 20 mM, pH 6, 100 mM de NaCl foram usados como o amortecedor de filtração de gel preferencial.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Como mostrado na Figura 1, dois vetores de expressão de baculovirus pFastBac1 modificados foram usados para expressar as proteínas secretadas com o GP67 ou a sequência de sinal hemolin para substituir a sequência de sinal intrínseco do gene do alvo. O GP67 viral e os genes de insetos hemolin têm demonstrados que têm níveis de expressão de alta secreção nas células. Proteínas de fusão com qualquer destas duas sequências de sinal deverão ter melhorado os níveis de expressão de secreção. Idênticos em que vários sites de clonagem (MCS) foram projetados nestes dois vetores modificados. Um site NotI foi deliberadamente colocado lado mais 5'-o MCS, porque NotI tem uma sequência de oito-nucleotide, ao invés da sequência de seis-nucleotide mais comuns presente em muitos outros sítios de restrição. Como tal, um site de NotI é menos presente nos genes alvo do que a maioria dos outros sites de restrição, fazendo digestão de restrição e a clonagem da maioria dos genes-alvo mais viáveis em comparação com usando outros sítios de restrição. Clonagem do gene alvo entre um site de restrição a jusante e a NotI apresentará apenas três resíduos de aminoácidos, GRULKE, precedendo o gene alvo.

O pBac1-GP67 e pBac1-Hem têm sido utilizados com sucesso para expressar os domínios extracelulares dos receptores da . thaliana TDR e PRK3, respectivamente (Figura 2). Depois que as proteínas recombinantes foram purificadas por NiNTA usando uma marca de histidina-6 C-terminal engenharia, o rendimento médio da proteína foi consistente em torno de 20 mg/L de células de Hi5. A pureza de cada proteína é próximo ou superior a 50%, examinado com SDS-PAGE e coloração Coomassie.

As proteínas recombinantes dos domínios extracelulares de TDR e PRK3 foram mais purificadas por cromatografia de exclusão (Figura 2). A proteína purificada concentrava-se a 5 mg/mL e em seguida, submetido a uma triagem de cristalização. As condições, que produziram cristais preliminares de cada proteína, foram otimizadas até cristais de proteína com um tamanho maior do que 20 µm foram observadas (Figura 3). As estruturas de cristal de ambas as proteínas foram relatados11,12.

Figure 1
Figura 1: mapas dos vetores modificados pFastBac1. As sequências de DNA mostradas a estes painéis foram inseridas a jusante do promotor polyhedrin do vetor pFastBac1, possuir a sequência do peptídeo sinal e os vários locais de clonagem (MCS) para genes-alvo. Ambos os vetores contêm a mesma MCS. (A), este painel mostra uma sequência dos sites clonagem a jusante do promotor do vetor de pBac1-GP67 polyhedrin. A sequência de aminoácidos de peptídeo de sinal traduzida GP67 é colorida em vermelho. Cada site exclusivo restrição em MCS é sublinhado, com o nome do site rotulado acima. (B), este painel mostra uma sequência dos sites clonagem a jusante do promotor polyhedrin do vetor pBac1-Hem. A sequência de aminoácidos do peptídeo de sinal hemolin traduzido é colorida em vermelho. Cada site exclusivo restrição em MCS é sublinhado, com o nome do site rotulado acima. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2: a expressão da proteína com os vetores de pFastBac1 modificados no sistema baculovirus-inseto celular. (A) o ectodomínio da TDR foi expressa em células de inseto Hi5, purificada por cromatografia de exclusão níquel-afinidade e tamanho (S) e resolvido em gel de SDS-PAGE. A resina de níquel foi lavada uma vez com um buffer contendo imidazole 5mm (lavagem 1) e uma segunda vez com imidazol 20mm (lavagem 2). (B) esta é uma análise de SDS-PAGE, mostrando a expressão e purificação da afinidade de níquel (NiNTA), assim como a cromatografia de exclusão do ectodomínio da PRK3. Marcadores de peso molecular (MW), com os tamanhos correspondentes são rotulados. As setas vermelhas em cada painel denotam as expressões e os tamanhos esperados da recombinante TDR e PRK3 ectodomínio proteínas. As naturezas multi-banda das proteínas expressas são provavelmente devido a glicosilação heterogênea. Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3: Cristais de proteína dos domínios extracelulares de Arabidopsis thaliana TDR e PRK3. (A), este painel mostra os cristais de proteína dos domínios extracelulares de a. thaliana TDR. (B) este painel mostra os cristais de proteína dos domínios extracelulares da . thaliana PRK3. Uma barra de escala é mostrada abaixo de cada foto. Clique aqui para ver uma versão maior desta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Dada a diversidade no tamanho e na estabilidade dos milhares de proteínas presentes nos sistemas biológicos, é frequentemente empírica para uma pesquisa laboratorial para decidir qual sistema de expressão heteróloga tem de ser escolhida para a expressão de uma proteína específica. O sistema de expressão de Escherichia coli é frequentemente a primeira escolha para a expressão da proteína devido ao curto ciclo de vida das bactérias, baixo custos dos meios de cultura e relativa facilidade para escalar até19. Para a expressão de proteínas eukaryotic grandes com tamanhos mais de 60 kDa, no entanto, usando o Escherichia coli sistema muitas vezes resulta em proteínas insolúveis no corpo de inclusão ou agregação de20. Para a expressão de proteínas aqueles difíceis e para outras proteínas secretadas, o sistema de expressão de células de baculovirus-inseto pode ser mais vantajoso do que o colibacilo. Especialmente quando expressar proteínas eukaryotic secretadas, este sistema de expressão de células de baculovirus-inseto modificado pode ser uma escolha preferencial.

Muitas proteínas eukaryotic secretadas, incluindo proteínas vegetais secretado, precisam de glicosilação complexa, bissulfeto formação e outras modificações borne-translational durante proteína dobráveis e secreção21. Sistemas de e. coli não possuem a maquinaria celular para processar as complexas modificações necessárias para muitas das proteínas eukaryotic22. Fermento tem um relativamente mais avançado sistema de glicosilação que Escherichia coli23. No entanto, para a expressão das proteínas secretadas em espécies eucarióticas superiores e plantas, o sistema de célula de baculovirus-inseto apresenta uma vantagem significativa. Desde glycosylation afeta o enrolamento de proteínas e estabilidade24, muitas das proteínas recombinantes secretadas expressa em sistemas de e. coli e leveduras têm um baixo rendimento e tendem a agregar, presumivelmente devido ao enrolamento de proteínas incorreta. O sistema de baculovirus-inseto foi modificado para melhorar a proteína glycosylation, que o torna um sistema ideal para a expressão de proteínas eukaryotic secretada25. Neste estudo, tanto o GP67 e o hemolin sinal de peptídeos têm sido utilizados com sucesso para guiar a expressão de secreção de duas proteínas do receptor de planta para cristalização de proteínas. Com estes estudos em mente, a escolha de qualquer peptídeo sinal é uma etapa crítica, e precisa de mais sistemáticos estudos comparativos com um conjunto de genes-alvo de diferentes organismos.

A ideia de usar tanto GP67 como hemolin peptídeos de sinal para melhorar a expressão de secreção de proteínas foi guiada pelos rendimentos de alta expressão de ambos os genes. No entanto, se a secreção de proteínas e maquinaria de modificação pós-traducional do host expressão estão sobrecarregados com as proteínas recombinantes expressas, as proteínas recombinantes secretadas não podem ter modificações adequadas, especialmente de glicosilação. Ambos os vetores modificados têm sido utilizados com sucesso expressar numerosas plantas proteínas secretoras11,12,26, muitos dos quais tendem a agregação, que é provavelmente devido a glicosilação incorreta ou inadequada. Portanto, para a expressão de proteínas aqueles difíceis, ambas as sequências de peptídeo sinal forte e fraco tem que ser testado e a qualidade das proteínas recombinantes expressadas precisa ser comparado. Tenha em mente que uma sequência de peptídeo sinal fraco irá diminuir o rendimento total da proteína; no entanto, pode dar a maquinaria de secreção do host expressão capacidade suficiente para processar a secreção de proteína e modificações.

Além da expressão das proteínas secretadas heterólogos em células de inseto, as células de mamíferos e sistemas de expressão de célula de planta têm sido utilizados com sucesso em superexpressão de mamíferos recombinante e proteínas vegetais, respectivamente,27, 28,29. Em comparação com os sistemas heterólogos, a expressão endógena perto condição dos mamíferos ou as proteínas vegetais secretado terá as máquinas quase nativo modificação nas células hospedeiras para produzir proteínas bem dobradas. A limitação do uso do sistema de expressão quase nativo é que as proteínas recombinantes expressas podem interferir com a função fisiológica das células, que potencialmente podem ter efeitos adversos sobre o rendimento final da expressão das proteínas.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada para divulgar.

Acknowledgments

Este trabalho foi financiado pelos fundos de inicialização nova faculdade da North Carolina State University para Guozhou Xu.

Materials

Name Company Catalog Number Comments
Incubator shaker VWR Model Excella E25 27 oC
Incubator VWR Model 2005 27 oC
Centrifuge BECKMAN Model J-6 with a swing bucket rotor
Herculase II Fusion DNA Polymerase Agilent 600677-51 For PCR amplification of DNA
Thermal Cycler BIO-RAD Model C1000 Touch For PCR amplification of DNA
Incubator shaker New Brunswick Scientific Model I 24 For growing baceria culture
Customer DNA synthesis GENSCRIPT
BamHI (HF) New England Biolabs R3136S Restriction Endonuclease
BglII New England Biolabs R0144S Restriction Endonuclease
NotI (HF) New England Biolabs R3189S Restriction Endonuclease
XhoI New England Biolabs R0146S Restriction Endonuclease
T4 DNA ligase New England Biolabs M0202T DNA ligation
QIAquick Gel Extraction Kit Qiagen 28704 DNA purification from Agorase gel
QIAprep Spin Miniprep Kit Qiagen 27104 Plasmid DNA purification from bacteria culture
Agarose Thermo Fisher Scientific 15510-019 For DNA gel electropherosis
MAX Efficiency DH5α competen cell Invitrogen 18-258-012 For transformation of DNA ligation mixture
Lennox L LB Broth Research Product International Corp. L24066-5000.0 For making bacteria culture
Ampicillin sodium salt Thermo Fisher Scientific 11593-019 Antibiotics
Kanamycin Sulfate Thermo Fisher Scientific 15160-054 Antibiotics
Tetracycline Thermo Fisher Scientific 64-75-5 Antibiotics
Gentamicin Thermo Fisher Scientific 15710-064 Antibiotics
MAX Efficiency DH10Bac competent cells Thermo Fisher Scientific 10361-012 For making bacmid DNA
S.O.C. Medium Thermo Fisher Scientific 15544-034 For DNA transformation
CellFECTIN II Reagent Thermo Fisher Scientific 10362-101 Insect cell transfection reagent
Bac-to-Bac Expression System Thermo Fisher Scientific 10359-016 Baculovirus-insect cells expression kit
Bluo-gal Thermo Fisher Scientific 15519-028 For isolation of recominant Bacmid DNA
IPTG Thermo Fisher Scientific 15529-019 For isolation of recominant Bacmid DNA
pFastBac1 Thermo Fisher Scientific 10360014 Baculorirus expression vector
Sf9 cells Thermo Fisher Scientific 11496015 Sf9 monolayer cells
Hi5 cells Thermo Fisher Scientific B85502 High Five insect cells
Grace’s insect medium, unsupplemented Thermo Fisher Scientific 11595030 Sf9 cell transfection minimum medium
Grace’s insect medium, supplemented Thermo Fisher Scientific 11605102 Sf9 monolayer cell culture complete medium
Sf-900 II SFM Thermo Fisher Scientific 10902104 Sf9 suspension cell culture medium without FBS
Express Five SFM Thermo Fisher Scientific 10486025 Hi5 cell culture medium
Penicillin-Streptomycin Thermo Fisher Scientific 15140122 100 ml (10,000 I.U./ml)
L-Glutamine (200 mM) Thermo Fisher Scientific 25030081 100 ml
FBS Certified Thermo Fisher Scientific 16000-044 500 ml
6-well plates Thermo Fisher Scientific 08-772-1B Flat-bottom
150 mm plates Thermo Fisher Scientific 353025 100/case
1.5 ml Microcentrifuge Tubes USA Scientific 1415-2500 500 tubes/bag
15 ml conical screw cap centrifuge tubes USA Scientific 1475-0511 25 tubes/bag
50 ml conical screw cap centrifuge tubes USA Scientific 1500-1211 25 tubes/bag
Ni-NTA Superflow Qiagen 30430 NiNTA resin
pH-indicator strips EMD Millipore Corporation 1.09535.0001 pH 0 - 14

DOWNLOAD MATERIALS LIST

References

  1. Contreras-Gomez, A., Sanchez-Miron, A., Garcia-Camacho, F., Molina-Grima, E., Chisti, Y. Protein production using the baculovirus-insect cell expression system. Biotechnology Progress. 30, 1-18 (2014).
  2. Khan, S., Ng, M. L., Tan, Y. J. Expression of the severe acute respiratory syndrome coronavirus 3a protein and the assembly of coronavirus-like particles in the baculovirus expression system. Methods in Molecular Biology. 379, 35-50 (2007).
  3. Possee, R. D., King, L. A. Baculovirus Transfer Vectors. Methods in Molecular Biology. 1350, 51-71 (2016).
  4. Vaughn, J. L., Goodwin, R. H., Tompkins, G. J., McCawley, P. The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae). In Vitro. 13, 213-217 (1977).
  5. Hink, W. F. Established insect cell line from the cabbage looper, Trichoplusia ni. Nature. 226, 466-467 (1970).
  6. Davis, T. R., et al. Comparative recombinant protein production of eight insect cell lines. In Vitro Cellular & Development Biology - Animal. 29A, 388-390 (1993).
  7. Wickham, T. J., Nemerow, G. R. Optimization of growth methods and recombinant protein production in BTI-Tn-5B1-4 insect cells using the baculovirus expression system. Biotechnology Progress. 9, 25-30 (1993).
  8. Davis, T. R., Trotter, K. M., Granados, R. R., Wood, H. A. Baculovirus expression of alkaline phosphatase as a reporter gene for evaluation of production, glycosylation and secretion. Nature Biotechnology. 10, 1148-1150 (1992).
  9. Murphy, C. I., et al. Enhanced expression, secretion, and large-scale purification of recombinant HIV-1 gp120 in insect cell using the baculovirus egt and p67 signal peptides. Protein Expression and Purification. 4, 349-357 (1993).
  10. Sun, S. C., Lindstrom, I., Boman, H. G., Faye, I., Schmidt, O. Hemolin: an insect-immune protein belonging to the immunoglobulin superfamily. Science. 250, 1729-1732 (1990).
  11. Li, Z., Chakraborty, S., Xu, G. Differential CLE peptide perception by plant receptors implicated from structural and functional analyses of TDIF-TDR interactions. PLoS One. 12, e0175317 (2017).
  12. Chakraborty, S., Pan, H., Tang, Q., Woolard, C., Xu, G. The Extracellular Domain of Pollen Receptor Kinase 3 is structurally similar to the SERK family of co-receptors. Scientific Reports. 8, 2796 (2018).
  13. Khorana, H. G. Total synthesis of a gene. Science. 203, 614-625 (1979).
  14. Bahl, C. P., Marians, K. J., Wu, R. A general method for inserting specific DNA sequences into cloning vehicles. Gene. 1, 81-92 (1976).
  15. Xu, W., Zhang, Y. Isolation and Characterization of Vaccine-Derived Polioviruses, Relevance for the Global Polio Eradication Initiative. Methods in Molecular Biology. 1387, 213-226 (2016).
  16. Hanahan, D. Studies on transformation of Escherichia coli with plasmids. Journal of Molecular Biology. 166, 557-580 (1983).
  17. Zhang, S., Cahalan, M. D. Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit. Journal of Visualized Experiments. (6), 247 (2007).
  18. Reddy, B. G., et al. Expression and purification of the alpha subunit of the epithelial sodium channel, ENaC. Protein Expression and Purification. 117, 67-75 (2016).
  19. Harris, T. J., Emtage, J. S. Expression of heterologous genes in E. coli. Microbiological Sciences. 3, 28-31 (1986).
  20. Kaur, J., Kumar, A., Kaur, J. Strategies for optimization of heterologous protein expression in E. coli: Roadblocks and reinforcements. International Journal of BIological Macromolecules. 106, 803-822 (2018).
  21. Guo, Y., Yang, F., Tang, X. An Overview of Protein Secretion in Yeast and Animal Cells. Methods in Molecular Biology. 1662, 1-17 (2017).
  22. Blight, M. A., Chervaux, C., Holland, I. B. Protein secretion pathway in Escherichia coli. Current Opinion in Biotechnology. 5, 468-474 (1994).
  23. Idiris, A., Tohda, H., Kumagai, H., Takegawa, K. Engineering of protein secretion in yeast: strategies and impact on protein production. Applied Microbiology and Biotechnology. 86, 403-417 (2010).
  24. Wormald, M. R., Dwek, R. A. Glycoproteins: glycan presentation and protein-fold stability. Structure. 7, R155-R160 (1999).
  25. Geisler, C., Mabashi-Asazuma, H., Jarvis, D. L. An Overview and History of Glyco-Engineering in Insect Expression Systems. Methods in Molecular Biology. 1321, 131-152 (2015).
  26. Li, Z., Chakraborty, S., Xu, G. X-ray crystallographic studies of the extracellular domain of the first plant ATP receptor, DORN1, and the orthologous protein from Camelina sativa. Acta Crystallographica Section F: Structural BIology and Crystallization Communications. 72, 782-787 (2016).
  27. Aricescu, A. R., Owens, R. J. Expression of recombinant glycoproteins in mammalian cells: towards an integrative approach to structural biology. Current Opinion in Structural Biology. 23, 345-356 (2013).
  28. Reuter, L. J., Bailey, M. J., Joensuu, J. J., Ritala, A. Scale-up of hydrophobin-assisted recombinant protein production in tobacco BY-2 suspension cells. Plant Biotechnology Journal. 12, 402-410 (2014).
  29. Dohi, K., et al. Inducible virus-mediated expression of a foreign protein in suspension-cultured plant cells. Archives of Virology. 151, 1075-1084 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics