Modification des vecteurs d’Expression Baculovirus pour produire sécrétée des protéines végétales dans des cellules d’insecte

JoVE Journal
Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Nous présentons ici les protocoles utilisant les insectes cellulaire et baculovirus protein expression pour produire de grandes quantités de protéines végétales sécrétée de cristallisation de protéines. Un vecteur d’expression baculovirus a été modifié par GP67 ou peptide signal hemolin insectes pour expression plante de sécrétion des protéines dans des cellules d’insecte.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Chakraborty, S., Trihemasava, K., Xu, G. Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells. J. Vis. Exp. (138), e58283, doi:10.3791/58283 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Il a été un défi pour les scientifiques exprimer les protéines eucaryotes sécrétoires recombinantes pour les études structurales et biochimiques. Le système d’expression baculovirus insectes cellulaire est l’un des systèmes utilisés pour exprimer les protéines sécrétoires eucaryotes recombinantes avec quelques modifications post-traductionnelles. Les protéines sécrétoires doivent être acheminés à travers les voies sécrétrices de la glycosylation des protéines, la formation de liaisons disulfure et autres modifications post-traductionnelles. Pour améliorer l’expression cellulaire insectes existants des protéines végétales sécrétoire, un vecteur d’expression baculovirus est modifié par l’ajout de soit un GP67 ou une séquence de peptide signal de hemolin entre le promoteur et le clonage de plusieurs sites. Ce système nouvellement conçu vecteur mis à jour le produit avec succès un rendement élevé de protéines réceptrices plante sécrétées recombinantes solubles d’Arabidopsis thaliana. Deux des protéines végétales exprimées, les domaines extracellulaires de récepteurs de la membrane plasmique d’Arabidopsis TDR et PRK3, ont été cristallisés pour les études de diffraction des rayons x. Le système mis à jour le vecteur est un outil amélioré qui est potentiellement utilisable pour l’expression de protéines recombinantes de sécrétion dans le règne animal ainsi.

Introduction

Il est impératif pour un laboratoire de recherche être capable de produire de grandes quantités de protéines recombinantes homogènes pour les caractérisations biochimiques et biophysiques, surtout pour les études de diffraction des rayons x. Il existe plusieurs systèmes d’expression hétérologue bien établies telles que Escherichia coli, levure, cellules d’insectes, des cellules de mammifères, les cellules végétales, etc. , parmi eux, le système d’expression baculovirus insectes cellulaire est un des plus couramment utilisé des techniques pour produire de grandes quantités de structurellement pliés grosses eucaryotes protéines recombinantes pour la cristallisation de protéines1.

Les vecteurs d’expression du système baculovirus expression sont conçus pour contenir un polyédrine fort ou un promoteur de P10 pour produire un rendement élevé de protéines intracellulaires recombinantes2,3. Pour faire un baculovirus recombinant, le gène d’intérêt est cloné dans un insecte vecteur contenant le locus polyédrine (Paolo) du génome Autographa californica multi-nucleopolyhedroviral. La construction qui en résulte est ensuite séquencée et son cadre de lecture ouvert correcte (ORF) est vérifié. La construction correcte est ensuite introduite dans la cellule d’insecte hôte à travers le processus de la transfection. Le gène d’intérêt est inséré dans le génome viral par recombinaison homologue. Cet événement donne lieu à la production du génome viral recombinant, qui réplique puis sur produire recombinant ont bourgeonné de particules de virus1.

Les cellules d’insectes qui sont plus couramment utilisés dans le système d’expression sont des cellules (Hi5) cinq Sf9 et haute. Les cellules SF9 sont un isolat clonal de Sf21, dérivé des pupes cellules ovariennes de Spodoptera frugiperda, et Hi5 cellules sont un isolat clonal dérivé le parental Trichoplusia ni cellules ovariennes ligne TN-3684,5. Transfections Co, amplification des virus et des essais de plaque sont menées sur les cellules Sf9, tandis que les cellules de Hi5 sont typiquement pour produire des quantités plus élevées de protéines recombinantes6. Il est à noter que les cellules de Hi5 ne conviennent pas pour la génération et l’amplification des descendances de virus à cause de leur tendance à produire des virus mutants. Traditionnellement, une plage de température de 25-30 ° C est considérée comme bonne pour la culture de cellules d’insectes. Toutefois, il a été signalé que les 27-28 ° C est la température optimale pour la cellule insectes croissance et infection7,8.

L’introduction d’une séquence signal fort qui précède le gène est nécessaire pour la forte expression des protéines sécrétées. La séquence signal guideraient efficacement la protéine recombinante traduite dans le réticulum endoplasmique pour la sécrétion de protéines et de modifications post-traductionnelles nécessaires à repliement adéquat et de stabilisation3. Séquences de peptide signal, tels que le baculovirus enveloppe protéique GP64/67, abeille mélittine et autres, ont été choisis pour faciliter l’expression de protéines recombinantes sécrétrices dans le systèmes de médiation baculovirus expression3. L’introduction du peptide signal de GP67 s’est avérée d’améliorer le rendement de l’expression d’une protéine recombinante sécrétée, en comparaison à l’aide du peptide signal intrinsèque du gène cible9. Hemolin est une protéine de l’hémolymphe de la teigne de soie géante Hyalophora cecropia, induite à bactéries infection10. En raison du niveau relativement élevé d’expression induite, la séquence de peptide signal du gène peut être utilisée à la médiation de l’expression de la sécrétion des protéines recombinantes dans le système baculovirus-insecte cellule.

L’Arabidopsis trachée élément différenciation inhibitrice facteur du récepteur (TDR) et Pollen Receptor Kinase 3 (PRK3) tous deux appartiennent à la famille de répétition comme récepteur Kinase (LRR-RLK) plante riche en Leucine de protéines11,12 . Afin d’étudier la structure et la fonction de cette famille de récepteurs des protéines végétales, aussi bien pour en faciliter la caractérisation structurale et biochimique des autres protéines végétales sécrétée, le système d’expression baculovirus-insecte cellule a été modifié à améliorer le rendement de qualité et de la production de protéines. Les domaines extracellulaires de TDR et PRK3 ont été exprimés avec succès dans le système d’expression baculovirus-insect cell à l’aide de deux vecteurs d’expression mis à jour le. Les deux domaines extracellulaires de TDR et PRK3 protéines ont été cristallisés. Cet article rend compte de l’expression et purification de grandes quantités de protéines recombinantes végétale sécrétée avec vecteurs d’expression baculovirus modifié deux en incorporant un GP67 ou une séquence de signaux de hemolin entre le promoteur et le clonage à des fins multiples sites.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

NOTE : Un système de cellule/baculovirus insectes avec des vecteurs d’expression modifiées pour l’expression de la protéine sécrétoire plante et cristallisation est utilisé.

1. modification d’un vecteur d’Expression Baculovirus avec le Peptide Signal GP67 pour Expression de sécrétion des protéines végétales

  1. Synthétiser un fragment d’ADN contenant un 5' BglII coupe site13, la séquence de signaux de sécrétion GP67 et un site multi clonage avec NotI, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI et XhoI (Figure 1 a).
    NOTE : Puisque les BglII et BamHI digéré ADN a permis aux mêmes fins adhésifs, le vecteur linéarisé peut ligaturer pour le fragment d’ADN digéré, tandis que les sites BamHI tant BglII dans la séquence de ligature recuite vont être mutés à une séquence qui n’est pas CLIVABLES par BglII ou BamHI14.
  2. Digest 4 µg d’ADN avec BglII et XhoI et 4 µg d’un vecteur d’expression ADN avec BamHI et XhoI14. Mélanger 10 unités de chaque enzyme de restriction avec l’ADN dans un 1 x tampon de réaction de concentration (acétate de potassium 50 mM, 20 mM Tris-acétate, acétate de magnésium de 10 mM et 100 µg/mL de BSA, pH 7,9 à 25 ° C) et laisser incuber le mélange à 37 ° C pendant 4 h.
    1. Purifier le fragment d’ADN excisé et le vecteur linéarisé ADN par un ADN gel extraction kit15.
  3. Mélanger 100 ng du vecteur ADN linéarisé avec 400 ng d’ADN digéré fragment dans un mélange de réaction de ligature de 10 µL contenant 1 x tampon de réaction T4 DNA ligase (50 mM Tris-HCl 10 mM MgCl2, ATP 1 mM et 10 mM DTT, pH de 7,5 à 25 ° C) et de 5 unités d’ADN T4 ligase. Incuber le mélange réactionnel à 16 ° C pendant 16 h.
  4. Transformer 5 µL du mélange ligature dans 100 µL de cellules capables de DH5α suite à un protocole de transformation standard, puis sélectionnez les colonies qui en résulte sur une plaque de gélose LB ampicillin16. Prendre 5-10 colonies et grandir chaque colonie dans 2 mL de milieu LB contenant 100 ampicilline µg/mL à 220 tr/mn et 37 ° C dans un incubateur à agitation pendant 16 h.
  5. Extraire chaque ADN plasmidique avec un DNA miniprep kit17 et confirmer les clones par séquençage de l’ADN d’une amorce de AGTATTTTACTGTTTTCGTAACAG.
  6. PCR-amplifier le gène TDR a. thaliana fragment encodage résidus 30-642 d’un gène synthétique de TDR construire (avant apprêt : CATG GCGGCCGC CTCAAGTTTTCACCTCAACTCTTGTC, apprêt inverse : GC GGATCC LTC GTG GTG ATG GTG GTG GTG ACCGTCTATATCTGCATTTCCGGC). Amplifier l’ADN pour 30 cycles dans un tampon de réaction de polymérase d’ADN contenant un mélange dNTP de 0,5 mM, 0,2 µM élémentaires, 0,1 µg d’ADN, 0,4 mM MgCl2et 1 unité de réaction de l’ADN polymérase.
    1. Pour les étapes du cycle de PCR, définir la dénaturation initiale à 95 ° C pendant 30 s et puis 30 cycles de dénaturation à 95 ° C pendant 30 s, recuit à 55 ° C pendant 30 s et l’extension à 72 ° C pendant 1 min, avec une extension finale à 72 ° C pendant 5 min.
  7. Digérer le fragment PCR tant le vecteur mis à jour l’avec NotI et BamHI enzymes endonucléases de restriction. Ligaturer le fragment de gène avec le vecteur linéarisé. Mélanger 100 ng du vecteur ADN linéarisé avec 400 ng d’ADN digéré fragment dans un mélange de réaction de ligature de 10 µL contenant du tampon de réaction T4 DNA ligase et 5 unités de T4 DNA ligase. Incuber le mélange réactionnel à 16 ° C pendant 16 h.
  8. Transformer 5 µL du mélange ligature dans 100 µL de cellules capables de DH5α suite à un protocole de transformation standard, puis sélectionnez les colonies qui en résulte sur une plaque de gélose LB ampicillin16. Confirmer les clones correctes par séquençage de l’ADN.

2. modification d’un vecteur d’Expression Baculovirus avec le Peptide Signal Hemolin insectes pour Expression de sécrétion des protéines végétales

  1. Synthétiser un fragment d’ADN contenant un 5' BglII coupe site13, la séquence de signaux de sécrétion insectes hemolin et un site multi clonage avec NotI, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI et XhoI (Figure 1 b).
  2. Digest 4 µg d’ADN avec BglII et XhoI et 4 µg d’un vecteur d’expression ADN avec BamHI et XhoI14. Mélanger 10 unités de chaque enzyme de restriction avec l’ADN dans un 1 x tampon de réaction de concentration (acétate de potassium 50 mM, 20 mM Tris-acétate, acétate de magnésium de 10 mM et 100 µg/mL de BSA, pH 7,9 à 25 ° C) et laisser incuber le mélange à 37 ° C pendant 4 h.
    1. Purifier le fragment d’ADN excisé et le vecteur linéarisé ADN par un ADN gel extraction kit15.
  3. Mélanger 100 ng du vecteur ADN linéarisé avec 400 ng d’ADN digéré fragment dans un mélange de réaction de ligature de 10 µL contenant 1 x tampon de réaction T4 DNA ligase (50 mM Tris-HCl 10 mM MgCl2, ATP 1 mM et 10 mM DTT, pH de 7,5 à 25 ° C) et de 5 unités d’ADN T4 ligase. Incuber le mélange réactionnel à 16 ° C pendant 16 h.
  4. Transformer 5 µL du mélange ligature dans 100 µL de cellules capables de DH5α, puis sélectionnez les colonies sur une gélose au ampicilline LB. Prendre 5-10 colonies et grandir chaque colonie dans un milieu LB de 2 mL contenant 100 µg/mL d’ampicilline à 220 tr/mn et 37 ° C dans un incubateur à agitation pendant 16 h.
  5. Extraire l’ADN de plasmide avec un DNA miniprep kit17 et confirmer les clones par séquençage de l’ADN d’une amorce de AGTATTTTACTGTTTTCGTAACAG.
  6. PCR-amplifier a. thaliana Pollen Receptor Kinase 3 (PRK3) fragment du gène codant des résidus 20-237 d’un synthétique PRK3 gène chimère (avant apprêt : CATG GCGGCCGC CTACAAAACGTTAGTGAATCGGAACC, apprêt inverse : CGC GGATCC LTC GTG GTG ATG GTG GTG GTG TGAAGGTTTCTCATCGCATTCTATATTC). Amplifier l’ADN pour 30 cycles dans un tampon de réaction de polymérase d’ADN contenant un mélange dNTP de 0,5 mM, 0,2 µM élémentaires, 0,1 µg d’ADN, 0,4 mM MgCl2et 1 unité de réaction de l’ADN polymérase.
    1. Pour les étapes du cycle de PCR, définir la dénaturation initiale à 95 ° C pendant 30 s et puis 30 cycles de dénaturation à 95 ° C pendant 30 s, recuit à 55 ° C pendant 30 s et l’extension à 72 ° C pendant 30 s au sein de chaque cycle et l’extension finale à 72 ° C pendant 5 min.
  7. Digérer le fragment PCR tant le vecteur mis à jour l’avec NotI et BamHI enzymes endonucléases de restriction. Ligaturer le fragment de gène avec le vecteur linéarisé. Mélanger 100 ng du vecteur ADN linéarisé avec 400 ng d’ADN digéré fragment dans un mélange de réaction de ligature de 10 µL contenant du tampon de réaction T4 DNA ligase et 5 unités de T4 DNA ligase. Incuber le mélange réactionnel à 16 ° C pendant 16 h.
  8. Transformer 5 µL du mélange ligature dans 100 µL de cellules capables de DH5α suite à un protocole de transformation standard, puis sélectionnez les colonies qui en résulte sur une plaque de gélose LB ampicillin16. Confirmer les clones correctes par séquençage de l’ADN.

3. la production et l’Amplification de Baculovirus construit nourrissait la Cassette d’Expression de protéine recombinante

  1. Utilisez 100 ng de plasmide construct de transformer 40 µL de cellules capables de DH10Bac selon le protocole du système baculovirus expression1. La transformation incuber à 37 ° C pendant 48 h.
  2. Ramasser les deux colonies blanches de chaque plaque de transformation, inoculer chaque colonie dans 2 mL de milieu LB contenant 50 µg/mL kanamycine, gentamicine 7 de µg/mL et 10 tétracycline µg/mL. Suivre le protocole du système expression baculovirus1 d’extraire et de vérifier la bacmid ADN. Aliquote chaque ADN dans deux tubes avec 20 µL de chaque et stockez les tubes à-20 ° C.
    Remarque : Les étapes suivantes nécessitent une opération aseptique.
  3. Atteindre une monocouche de cellules Sf9 dans les antibiotiques pénicilline-streptomycine de milieux de culture avec 10 % sérum fœtal (SVF) et 100 µg/mL (ou 100 UI/ml) à 27 ° C 80 % confluent en une plaque 6 puits. Estimer le pourcentage de confluence basée sur le pourcentage de surface couverte sur la plaque de culture de tissus.
  4. Préparer les solutions suivantes dans deux tubes à centrifuger de 1,5 mL stérile.
    1. Tube 1 : Pour chaque transfection, diluer 20 µL de bacmid ADN dans 100 µL de milieu de culture cellulaire sans additifs Sf9 sans antibiotiques. Mélanger doucement la dilution en effleurant la paroi du tube.
    2. Tube 2 : Pour chaque transfection, diluer 8 µL de réactif de transfection de lipides dans 100 µL de milieu de culture cellulaire sans additifs Sf9 sans antibiotiques. Bien mélanger la dilution par pipetage de haut en bas pour 6 x.
  5. Combiner les deux solutions, mélangez-les délicatement en pipettant également lentement de haut en bas pour x 3 et les incuber pendant 20 à 40 minutes à température ambiante.
  6. Lavez chaque puits de la monocouche Sf9 cellules 2 x avec 3 mL de milieu de culture cellulaire sans additifs Sf9 sans antibiotiques. Pour chaque transfection, ajouter 0,8 mL de milieu de culture cellulaire sans additifs Sf9 sans antibiotiques dans chaque tube contenant le mélange de lipides-ADN. Mélanger doucement le contenu des tubes de pipetage lentement de haut en bas pour 3 x. Aspirer les médias de lavage des plaques et superposer les échantillons avec le mélange de transfection.
  7. Après l’ajout du mélange transfection, incuber la plaque transfectée pendant 5 h à 27 ° C. Remplacer les médias de transfection avec le milieu de culture de cellules Sf9 complet contenant 10 % FBS et 100 µg/mL (ou 100 UI/ml) antibiotiques pénicilline-streptomycine. Incuber la plaque transfectée à 27 ° C, pendant 4 jours.
  8. Récolter et amplifier le baculovirus recombinant.
    1. Recueillir le liquide surnageant de la plaque infecté dans un tube conique stérile de 15 mL après 4 jours d’incubation. Faites tourner le surnageant à 1010 x g pendant 5 min éliminer les débris cellulaires. Ignorer le culot et éliminer le surnageant dans un tube propre et conserver à 4 ° C pendant 1 an.
      NOTE : Ceci est le virus P0. Il peut être aliquotés et congelés à-80 ° C pour une plus longue période de temps.
    2. Pour amplifier chaque virus recombinant, poussent une monocouche de cellules Sf9 sur un plat de 150 millimètres au confluent de 80 %. Aspirer les médias de la plaque, ajouter 2 mL du virus P0 à l’adhérent de cellules à la plaque et incuber la plaque dans une étuve à 27 ° C pendant 1 heure. Balancer la plaque toutes les 15 min pour mélanger le milieu avec les cellules.
      1. Ajouter 25 mL de médias de Grace complet contenant 10 % FBS et 100 µg/mL (ou 100 UI/ml) antibiotiques pénicilline-streptomycine. Incuber les plaques pendant 3 jours dans une étuve à 27 ° C pour obtenir le virus de passage de P1.
    3. Recueillir le liquide surnageant de la plaque infecté dans un tube conique stérile de 50 mL et un essorage à 1010 x g pendant 5 min éliminer les débris cellulaires. Décanter le liquide surnageant dans un tube propre et conserver à 4 ° C pendant 1 an.
      Remarque : Le virus P1 peut être aliquotés et congelés à-80 ° C pour une plus longue période de temps.
    4. Pour amplifier le virus de P1 à P2 passage, cultiver une monocouche de cellules Sf9 sur un plateau de 150 mm à 90 % confluence, aspirer les médias de la plaque, ajouter 2 mL du virus P1 à la plaque et il incuber pendant 1 heure dans une étuve à 27 ° C.
    5. Répétez les étapes 3.8.2 et 3.8.3 pour obtenir les passages P2 et P3 des virus. Ne stockez pas le virus P3 pendant plus de 2 mois.

4. protein Expression, Purification avec NiNTA et cristallisation

  1. La culture 1 L de Hi5 cellules d’insectes dans les antibiotiques pénicilline-streptomycine de milieux de culture avec 100 µg/mL (ou 100 UI/ml) à une densité de 2 x 106 à 100 tr/min dans un shaker incubateur de 27 ° C. Tournez en bas les cellules à 570 x g pendant 5 min, éliminer le surnageant, remettre en suspension les cellules dans 20 mL du virus P3 fraîchement produit et gardez-le à température ambiante pour 1 h. agiter doucement le flacon de spin pour remettre en suspension les cellules 1 x toutes les 15 min.
  2. Les cellules de transfert à 1 L d’antibiotiques pénicilline-streptomycine 100 µg/mL (ou 100 UI/ml), les milieux de culture, la culture des cellules à 100 tr/min dans un shaker incubateur de 27 ° C pendant 72 h. Spin down les cellules à 1 010 x g pendant 5 min et recueillir le surnageant.
  3. Indicateur de pH d’utilisation des bandes pour ajuster le pH du liquide surnageant à 8.0 en ajoutant 0,1 M HCl ou NaOH 0,1 M et ajouter le tampon de liaison à une concentration finale, contenant un tampon Tris 20 mM à pH 8,0, 100 mM NaCl et imidazole de 5 mM. Ajouter une certaine quantité de résine NiNTA (10 à 40 mL) basée sur le rendement estimé de la protéine recombinante His-tag.
    1. Mélanger la solution sur une agitation magnétique avec une vitesse réduite à 4 ° C pendant 1 h. lavage la résine et Éluer la protéine liée suivant le protocole de purification standard NiNTA18.
  4. Sous réserve de la protéine purifiée de l’échange d’ions et la chromatographie par filtration, mais aussi d’autres méthodes de purification des protéines, pour obtenir un échantillon homogène de gel.
    Remarque : Pour le TDR ectodomaine, Tris, 20 mM, pH 8, 100 mM NaCl étaient utilisés comme tampon de gel filtration. Pour l’ectodomaine PRK3, 20 mM bis-Tris, pH 6, 100 mM NaCl servaient de tampon préféré gel filtration.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Comme illustré à la Figure 1, deux vecteurs d’expression baculovirus mis à jour le pFastBac1 ont été utilisés pour exprimer les protéines sécrétées avec le GP67 ou la séquence signal hemolin pour remplacer la séquence signal intrinsèque du gène cible. Le GP67 virale et les gènes hemolin insectes ont été démontrés d’avoir des niveaux d’expression de sécrétion élevée dans les cellules. Protéines de fusion avec ou l’autre de ces deux séquences signal sont censés avoir grandement amélioré les niveaux d’expression de la sécrétion. Identiques que multiples sites de clonage (MCS) ont été conçus dans ces deux vecteurs modifiés. Un site de NotI a été placé délibérément du côté le plus 5'-des MCS, parce que NotI a une séquence de huit nucléotides plutôt que la séquence de six nucléotides plus courante présente dans de nombreux autres sites de restriction. Ainsi, un site de NotI est moins présent dans les gènes cibles que la plupart d’autre sites de restriction, ce qui rend la digestion de restriction et le clonage de la plupart des gènes de cible plus réaliste par rapport à l’utilisation des autres sites de restriction. Clonage du gène cible entre la NotI et un site de restriction en aval va présenter seulement trois résidus d’acides aminés, GGR, précédant le gène cible.

Le pBac1-GP67 et pBac1-Hem ont été utilisés avec succès pour exprimer les domaines extracellulaires des récepteurs a. thaliana TDR et PRK3, respectivement (Figure 2). Après que les protéines recombinantes ont été purifiées par NiNTA à l’aide d’une balise d’histidine-6 C-terminale génie, le rendement moyen de protéine correspondait environ 20 mg/L de cellules de Hi5. La pureté de chaque protéine est proche ou supérieure à 50 %, a examiné avec le SDS-PAGE et coloration de Coomassie.

Les protéines recombinantes des domaines extracellulaires de TDR et PRK3 ont été plus amplement purifiés par chromatographie d’exclusion (Figure 2). La protéine purifiée était concentrée à 5 mg/mL et ensuite soumis à un dépistage de cristallisation. Les conditions qui ont donné des cristaux préliminaires de chaque protéine, on a optimisé jusqu'à ce que des cristaux de protéines avec une taille supérieure à 20 µm ont été observés (Figure 3). Les structures cristallines des deux protéines ont été rapportés11,12.

Figure 1
Figure 1 : cartes des vecteurs mis à jour le pFastBac1. Les séquences d’ADN sur ces panneaux ont été insérés en aval du promoteur polyédrine du vecteur pFastBac1, posséder la séquence peptidique de signal et les sites de clonage multiple (MCS) de gènes cibles. Les deux vecteurs contiennent le même MCS. (A), ce panneau affiche une séquence des sites clonage en aval du promoteur dans le vecteur pBac1-GP67 polyédrine. La séquence d’acides aminés de peptide de signal GP67 traduite est colorée en rouge. Chaque site de restriction unique dans la MCS est soulignée, avec le nom du site étiqueté ci-dessus. (B), ce panneau affiche une séquence des sites clonage en aval du promoteur dans le vecteur pBac1-Hem polyédrine. La séquence d’acides aminés traduit hemolin signal peptide est colorée en rouge. Chaque site de restriction unique dans la MCS est soulignée, avec le nom du site étiqueté ci-dessus. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : expression de la protéine avec les vecteurs mis à jour le pFastBac1 dans le système baculovirus-insecte cellule. (A) l’ectodomaine de TDR a été exprimé dans des cellules d’insecte Hi5, purifié par chromatographie d’exclusion (S), nickel-affinité et taille et séparés sur gel SDS-PAGE. La résine de nickel a été lavée une fois avec un tampon contenant 5 mM imidazole (lavage 1) et une seconde fois avec imidazole de 20 mM (lavage 2). (B) Ceci est une analyse de SDS-PAGE, montrant l’expression et purification d’affinité de nickel (NiNTA), ainsi que la chromatographie d’exclusion de l’ectodomaine PRK3. Marqueurs de poids moléculaire (MW) avec les montants correspondants sont étiquetés. Les flèches rouges dans chaque panneau indiquent les expressions et les tailles attendues de la recombinante TDR et PRK3 ectodomaine protéines. Les natures multi-bandes des protéines exprimées sont probables dues à la glycosylation hétérogène. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : Cristaux de protéine des domaines extracellulaires de Arabidopsis thaliana TDR et PRK3. (A), ce panneau indique les cristaux de protéine des domaines extracellulaires de a. thaliana TDR. (B) ce panneau montre les cristaux de protéine des domaines extracellulaires d’a. thaliana PRK3. Une échelle graphique ci-dessous chaque photo. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Compte tenu de la diversité dans la taille et de la stabilité des milliers de protéines présentes dans les systèmes biologiques, il est souvent empirique pour une recherche laboratoire de décider quel système d’expression hétérologue doit être choisi pour l’expression d’une protéine spécifique. Le système d’expression e. coli est souvent le premier choix pour l’expression de la protéine en raison du cycle de vie court de la bactérie, le faible coût des milieux de culture et assez facilement pour intensifier les19. Pour l’expression de grosses protéines eucaryotes avec tailles de plus de 60 kDa, cependant, à l’aide de l' e. coli système entraîne souvent des protéines insolubles dans le corps d’inclusion ou agrégation20. Pour l’expression de ces protéines difficiles et d’autres protéines sécrétées, le système d’expression baculovirus-insect cell peut être plus avantageux que les E. coli. Surtout lorsqu’elles expriment des protéines eucaryotes sécrétées, ce système d’expression mis à jour le baculovirus-insecte cellule pourrait être un choix privilégié.

Nombreuses protéines sécrétées eucaryotes, y compris les protéines végétales sécrétée, besoin glycosylation complexe, formation de liaisons disulfure et autres modifications post-traductionnelles au cours de la protéine repliement et la sécrétion de21. Systèmes d’e. coli ne disposent pas de la machinerie cellulaire pour traiter les modifications complexes nécessaires pour la plupart des protéines eucaryotes22. Levure a un système de glycosylation relativement plus avancé qu’e. coli23. Toutefois, pour l’expression des protéines sécrétées chez les espèces eucaryotes supérieures et les plantes, le système baculovirus-insect cell présente un avantage significatif. Puisque glycosylation affecte le repliement des protéines et stabilité24, bon nombre des protéines recombinantes sécrétées exprimée dans les systèmes d’e. coli et de la levure ont un faible rendement et tendent à agréger, vraisemblablement en raison de repliement des protéines incorrect. Le système baculovirus et les insectes a été modifié pour améliorer la glycosylation des protéines, qui en fait un système idéal pour l’expression des protéines eucaryotes sécrétées25. Dans cette étude, le GP67 tant l’hemolin signalent peptides ont été utilisées avec succès pour guider l’expression de la sécrétion de deux protéines réceptrices de plante pour la cristallisation de protéines. Avec ces études à l’esprit cependant, le choix d’un peptide signal est une étape cruciale, et il a besoin d’études comparatives plus systématiques avec un ensemble de gènes cibles de différents organismes.

L’idée d’utiliser les peptides signaux GP67 tant hemolin pour renforcer l’expression de la sécrétion des protéines a été alimentée par les rendements de forte expression des deux gènes. Toutefois, si la sécrétion de protéines et les mécanismes de modification post-traductionnelle de l’hôte d’expressions sont surchargées avec protéines recombinantes exprimées, les protéines recombinantes sécrétées peut-être pas modifications adéquates, notamment de glycosylation. Les deux vecteurs modifiés ont été utilisés pour exprimer avec succès les nombreuses plantes protéines sécrétoires11,12,26, dont beaucoup ont tendance à s’agréger, ce qui est probablement dû à la glycosylation inexact ou insuffisante. Par conséquent, pour l’expression de ces protéines difficiles, les deux séquences de peptides signaux forts et faibles doivent être testées et la qualité des protéines recombinantes exprimées doit être comparé. Gardez à l’esprit qu’une séquence de peptide signal faible fera baisser le rendement global de la protéine ; Toutefois, il peut donner le mécanisme de sécrétion de l’hôte de l’expression une capacité suffisante pour traiter la sécrétion des protéines et des modifications.

En plus de l’expression des protéines sécrétées hétérologues dans des cellules d’insecte, les cellules de mammifères et systèmes d’expression cellulaire végétale ont été utilisées avec succès dans la surexpression de la recombinaison chez les mammifères et les protéines végétales, respectivement27, 28,29. En comparaison avec les systèmes hétérologues, l’expression endogène proche condition des mammifères ou les protéines végétales sécrétée auront les machineries de modification presque natif dans les cellules de l’hôte pour produire des protéines bien pliés. La mise en garde d’utiliser le système d’expression quasi native est que les protéines recombinantes exprimées peuvent interférer avec la fonction physiologique des cellules, qui peuvent avoir des effets adverses sur le rendement de l’expression finale des protéines.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

Ce travail a été soutenu par les fonds de démarrage nouvelle faculté de North Carolina State University pour Guozhou Xu.

Materials

Name Company Catalog Number Comments
Incubator shaker VWR Model Excella E25 27 oC
Incubator VWR Model 2005 27 oC
Centrifuge BECKMAN Model J-6 with a swing bucket rotor
Herculase II Fusion DNA Polymerase Agilent 600677-51 For PCR amplification of DNA
Thermal Cycler BIO-RAD Model C1000 Touch For PCR amplification of DNA
Incubator shaker New Brunswick Scientific Model I 24 For growing baceria culture
Customer DNA synthesis GENSCRIPT
BamHI (HF) New England Biolabs R3136S Restriction Endonuclease
BglII New England Biolabs R0144S Restriction Endonuclease
NotI (HF) New England Biolabs R3189S Restriction Endonuclease
XhoI New England Biolabs R0146S Restriction Endonuclease
T4 DNA ligase New England Biolabs M0202T DNA ligation
QIAquick Gel Extraction Kit Qiagen 28704 DNA purification from Agorase gel
QIAprep Spin Miniprep Kit Qiagen 27104 Plasmid DNA purification from bacteria culture
Agarose Thermo Fisher Scientific 15510-019 For DNA gel electropherosis
MAX Efficiency DH5α competen cell Invitrogen 18-258-012 For transformation of DNA ligation mixture
Lennox L LB Broth Research Product International Corp. L24066-5000.0 For making bacteria culture
Ampicillin sodium salt Thermo Fisher Scientific 11593-019 Antibiotics
Kanamycin Sulfate Thermo Fisher Scientific 15160-054 Antibiotics
Tetracycline Thermo Fisher Scientific 64-75-5 Antibiotics
Gentamicin Thermo Fisher Scientific 15710-064 Antibiotics
MAX Efficiency DH10Bac competent cells Thermo Fisher Scientific 10361-012 For making bacmid DNA
S.O.C. Medium Thermo Fisher Scientific 15544-034 For DNA transformation
CellFECTIN II Reagent Thermo Fisher Scientific 10362-101 Insect cell transfection reagent
Bac-to-Bac Expression System Thermo Fisher Scientific 10359-016 Baculovirus-insect cells expression kit
Bluo-gal Thermo Fisher Scientific 15519-028 For isolation of recominant Bacmid DNA
IPTG Thermo Fisher Scientific 15529-019 For isolation of recominant Bacmid DNA
pFastBac1 Thermo Fisher Scientific 10360014 Baculorirus expression vector
Sf9 cells Thermo Fisher Scientific 11496015 Sf9 monolayer cells
Hi5 cells Thermo Fisher Scientific B85502 High Five insect cells
Grace’s insect medium, unsupplemented Thermo Fisher Scientific 11595030 Sf9 cell transfection minimum medium
Grace’s insect medium, supplemented Thermo Fisher Scientific 11605102 Sf9 monolayer cell culture complete medium
Sf-900 II SFM Thermo Fisher Scientific 10902104 Sf9 suspension cell culture medium without FBS
Express Five SFM Thermo Fisher Scientific 10486025 Hi5 cell culture medium
Penicillin-Streptomycin Thermo Fisher Scientific 15140122 100 ml (10,000 I.U./ml)
L-Glutamine (200 mM) Thermo Fisher Scientific 25030081 100 ml
FBS Certified Thermo Fisher Scientific 16000-044 500 ml
6-well plates Thermo Fisher Scientific 08-772-1B Flat-bottom
150 mm plates Thermo Fisher Scientific 353025 100/case
1.5 ml Microcentrifuge Tubes USA Scientific 1415-2500 500 tubes/bag
15 ml conical screw cap centrifuge tubes USA Scientific 1475-0511 25 tubes/bag
50 ml conical screw cap centrifuge tubes USA Scientific 1500-1211 25 tubes/bag
Ni-NTA Superflow Qiagen 30430 NiNTA resin
pH-indicator strips EMD Millipore Corporation 1.09535.0001 pH 0 - 14

DOWNLOAD MATERIALS LIST

References

  1. Contreras-Gomez, A., Sanchez-Miron, A., Garcia-Camacho, F., Molina-Grima, E., Chisti, Y. Protein production using the baculovirus-insect cell expression system. Biotechnology Progress. 30, 1-18 (2014).
  2. Khan, S., Ng, M. L., Tan, Y. J. Expression of the severe acute respiratory syndrome coronavirus 3a protein and the assembly of coronavirus-like particles in the baculovirus expression system. Methods in Molecular Biology. 379, 35-50 (2007).
  3. Possee, R. D., King, L. A. Baculovirus Transfer Vectors. Methods in Molecular Biology. 1350, 51-71 (2016).
  4. Vaughn, J. L., Goodwin, R. H., Tompkins, G. J., McCawley, P. The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae). In Vitro. 13, 213-217 (1977).
  5. Hink, W. F. Established insect cell line from the cabbage looper, Trichoplusia ni. Nature. 226, 466-467 (1970).
  6. Davis, T. R., et al. Comparative recombinant protein production of eight insect cell lines. In Vitro Cellular & Development Biology - Animal. 29A, 388-390 (1993).
  7. Wickham, T. J., Nemerow, G. R. Optimization of growth methods and recombinant protein production in BTI-Tn-5B1-4 insect cells using the baculovirus expression system. Biotechnology Progress. 9, 25-30 (1993).
  8. Davis, T. R., Trotter, K. M., Granados, R. R., Wood, H. A. Baculovirus expression of alkaline phosphatase as a reporter gene for evaluation of production, glycosylation and secretion. Nature Biotechnology. 10, 1148-1150 (1992).
  9. Murphy, C. I., et al. Enhanced expression, secretion, and large-scale purification of recombinant HIV-1 gp120 in insect cell using the baculovirus egt and p67 signal peptides. Protein Expression and Purification. 4, 349-357 (1993).
  10. Sun, S. C., Lindstrom, I., Boman, H. G., Faye, I., Schmidt, O. Hemolin: an insect-immune protein belonging to the immunoglobulin superfamily. Science. 250, 1729-1732 (1990).
  11. Li, Z., Chakraborty, S., Xu, G. Differential CLE peptide perception by plant receptors implicated from structural and functional analyses of TDIF-TDR interactions. PLoS One. 12, e0175317 (2017).
  12. Chakraborty, S., Pan, H., Tang, Q., Woolard, C., Xu, G. The Extracellular Domain of Pollen Receptor Kinase 3 is structurally similar to the SERK family of co-receptors. Scientific Reports. 8, 2796 (2018).
  13. Khorana, H. G. Total synthesis of a gene. Science. 203, 614-625 (1979).
  14. Bahl, C. P., Marians, K. J., Wu, R. A general method for inserting specific DNA sequences into cloning vehicles. Gene. 1, 81-92 (1976).
  15. Xu, W., Zhang, Y. Isolation and Characterization of Vaccine-Derived Polioviruses, Relevance for the Global Polio Eradication Initiative. Methods in Molecular Biology. 1387, 213-226 (2016).
  16. Hanahan, D. Studies on transformation of Escherichia coli with plasmids. Journal of Molecular Biology. 166, 557-580 (1983).
  17. Zhang, S., Cahalan, M. D. Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit. Journal of Visualized Experiments. (6), 247 (2007).
  18. Reddy, B. G., et al. Expression and purification of the alpha subunit of the epithelial sodium channel, ENaC. Protein Expression and Purification. 117, 67-75 (2016).
  19. Harris, T. J., Emtage, J. S. Expression of heterologous genes in E. coli. Microbiological Sciences. 3, 28-31 (1986).
  20. Kaur, J., Kumar, A., Kaur, J. Strategies for optimization of heterologous protein expression in E. coli: Roadblocks and reinforcements. International Journal of BIological Macromolecules. 106, 803-822 (2018).
  21. Guo, Y., Yang, F., Tang, X. An Overview of Protein Secretion in Yeast and Animal Cells. Methods in Molecular Biology. 1662, 1-17 (2017).
  22. Blight, M. A., Chervaux, C., Holland, I. B. Protein secretion pathway in Escherichia coli. Current Opinion in Biotechnology. 5, 468-474 (1994).
  23. Idiris, A., Tohda, H., Kumagai, H., Takegawa, K. Engineering of protein secretion in yeast: strategies and impact on protein production. Applied Microbiology and Biotechnology. 86, 403-417 (2010).
  24. Wormald, M. R., Dwek, R. A. Glycoproteins: glycan presentation and protein-fold stability. Structure. 7, R155-R160 (1999).
  25. Geisler, C., Mabashi-Asazuma, H., Jarvis, D. L. An Overview and History of Glyco-Engineering in Insect Expression Systems. Methods in Molecular Biology. 1321, 131-152 (2015).
  26. Li, Z., Chakraborty, S., Xu, G. X-ray crystallographic studies of the extracellular domain of the first plant ATP receptor, DORN1, and the orthologous protein from Camelina sativa. Acta Crystallographica Section F: Structural BIology and Crystallization Communications. 72, 782-787 (2016).
  27. Aricescu, A. R., Owens, R. J. Expression of recombinant glycoproteins in mammalian cells: towards an integrative approach to structural biology. Current Opinion in Structural Biology. 23, 345-356 (2013).
  28. Reuter, L. J., Bailey, M. J., Joensuu, J. J., Ritala, A. Scale-up of hydrophobin-assisted recombinant protein production in tobacco BY-2 suspension cells. Plant Biotechnology Journal. 12, 402-410 (2014).
  29. Dohi, K., et al. Inducible virus-mediated expression of a foreign protein in suspension-cultured plant cells. Archives of Virology. 151, 1075-1084 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics