CRISPR-Cas9-आधारित जीनोम इंजीनियरिंग चयनित वायरल एकीकरण साइटों के साथ एचआईवी-1 संक्रमण के लिए Jurkat रिपोर्टर मॉडल उत्पन्न करने के लिए

* These authors contributed equally
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

हम में नई की पीढ़ी के लिए एक जीनोम इंजीनियरिंग कार्यप्रवाह वर्तमान इन विट्रो मॉडल एचआईवी के लिए-1 संक्रमण है कि दोहराऊंगा चयनित जीनोमिक साइटों पर वायरल एकीकरण. एचआईवी-व्युत्पंन पत्रकारों के लक्ष्यीकरण CRISPR-Cas9-मध्यस्थता, साइट विशेष जीनोम हेरफेर द्वारा सुविधा है । एकल-सेल क्लोन जनरेशन, स्क्रीनिंग, और सही लक्ष्यीकरण सत्यापन के लिए विस्तृत प्रोटोकॉल प्रदान किए जाते हैं ।

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Bialek, J. K., Walther, T., Hauber, J., Lange, U. C. CRISPR-Cas9-based Genome Engineering to Generate Jurkat Reporter Models for HIV-1 Infection with Selected Proviral Integration Sites. J. Vis. Exp. (141), e58572, doi:10.3791/58572 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

मानव इम्यूनो वायरस (एचआईवी) समवर्ती साइटों और जीनोमिक के आकर्षण के बीच में मेजबान सेल जीनोम में अपने वायरल डीएनए गैर बेतरतीब ढंग से एकीकृत करता है । यहां हम CRISPR-Cas9 आधारित जीनोम इंजीनियरिंग प्रौद्योगिकी का उपयोग कर चुना जीनोमिक एकीकरण साइटों के साथ एचआईवी संक्रमण के लिए इन विट्रो मॉडल में उपंयास की पीढ़ी के लिए एक विस्तृत प्रोटोकॉल वर्तमान । इस विधि के साथ, चुनाव के एक रिपोर्टर अनुक्रम एक लक्षित, चुना जीनोमिक लोकस में एकीकृत किया जा सकता है, नैदानिक प्रासंगिक एकीकरण साइटों को प्रतिबिंबित ।

प्रोटोकॉल में, एक एचआईवी के डिजाइन रिपोर्टर व्युत्पंन और एक लक्ष्य साइट और gRNA अनुक्रम का चयन वर्णित हैं । समरूपता हथियारों के साथ एक लक्ष्यीकरण वेक्टर का निर्माण और Jurkat टी कोशिकाओं में transfected है । रिपोर्टर अनुक्रम लक्ष्य स्थल पर एक Cas9-मध्यस्थता डबल-किनारा तोड़ने द्वारा सुविधा मुताबिक़ पुनर्संयोजन द्वारा चयनित जीनोमिक साइट के लिए लक्षित है । एकल सेल क्लोन उत्पंन और प्रवाह cytometry और पीसीआर द्वारा घटनाओं को लक्षित करने के लिए जांच की जाती है । चयनित क्लोन तो विस्तार कर रहे हैं, और सही लक्ष्यीकरण पीसीआर, अनुक्रमण, और दक्षिणी सोख्ता द्वारा सत्यापित है । CRISPR-Cas9-मध्यस्थता जीनोम इंजीनियरिंग के संभावित बंद लक्ष्य घटनाओं का विश्लेषण कर रहे हैं ।

इस प्रोटोकॉल का उपयोग करके, उपंयास सेल संस्कृति प्रणालियों कि मॉडल नैदानिक प्रासंगिक एकीकरण साइटों पर एचआईवी संक्रमण उत्पंन किया जा सकता है । हालांकि एकल सेल क्लोन और सही रिपोर्टर अनुक्रम एकीकरण के सत्यापन की पीढ़ी के समय लेने वाली है, जिसके परिणामस्वरूप क्लोनिंग लाइनों शक्तिशाली उपकरण को कार्यात्मक वायरल एकीकरण साइट पसंद का विश्लेषण कर रहे हैं ।

Introduction

संक्रमण पर मेजबान जीनोम में वायरल डीएनए के एकीकरण मानव इम्यूनो वायरस (एचआईवी) के जीवन चक्र में एक महत्वपूर्ण कदम है । एकीकरण के बाद, एचआईवी लंबे समय तक रहते थे CD4 + टी सेल सबसेट जैसे स्मृति CD4 + टी कोशिकाओं में विलंबता की स्थापना के द्वारा बनी रहती है । एचआईवी एकीकरण के लिए गैर यादृच्छिक1,2प्रतीत होता है । आवर्तक रूप से एकीकृत वायरल डीएनए के साथ जीनोमिक हॉटस्पॉट की एक संख्या तीव्र और जीर्ण संक्रमित व्यक्तियों में एकीकरण साइटों के अनुक्रमण के माध्यम से कई अध्ययनों में पता लगाया गया है2,3,4 ,5,6,7,8. दिलचस्प है, इन एकीकरण साइटों में से कुछ पर, एक ही लोकस संक्रमित कोशिकाओं का एक बड़ा अंश में पाया गया था, विचार है कि समवर्ती साइटों पर एकीकरण सकारात्मक क्लोनिंग1विस्तार को प्रभावित कर सकता है अग्रणी ।

के लिए आवर्तक एकीकरण साइटों के महत्व के बारे में हमारी समझ अग्रिम, वायरल एकीकरण साइट चुनाव का पता लगाया जाना चाहिए । हालांकि, कई तकनीकी पहलुओं एचआईवी एकीकरण साइट पसंद और परिणामों का अध्ययन में बाधा । मोटे तौर पर इस्तेमाल सेल संस्कृति JLat सेल लाइनों की तरह एचआईवी विलंबता के लिए मॉडल नैदानिक प्रासंगिक आवर्तक एकीकरण साइटों9प्रतिबिंबित नहीं करते । प्राथमिक रोगी-व्युत्पन्न कोशिकाओं पर अध्ययन, एक तरफ, अनुक्रमण द्वारा एकीकरण साइट परिदृश्य का वर्णन सक्षम लेकिन कार्यात्मक विश्लेषण के लिए अनुमति नहीं है. हमारे ज्ञान के लिए, कोई पर्याप्त प्रयोगात्मक मॉडल कार्यात्मक नैदानिक प्रासंगिक एकीकरण साइटों का विश्लेषण करने के लिए उपलब्ध है ।

यहां हम एक विस्तृत कार्यप्रवाह वर्तमान CRISPR-Cas9 आधारित जीनोम इंजीनियरिंग प्रौद्योगिकी का उपयोग एचआईवी संक्रमण के लिए उपंयास मॉडल उत्पंन करने के लिए । यहां वर्णित कार्यप्रवाह टी सेल व्युत्पंन रिपोर्टर सेल लाइनों कि मॉडल एचआईवी संक्रमण, एक चुना एकीकरण साइट पर एक genomically एकीकृत वायरल रिपोर्टर ले उत्पंन करने के लिए इस्तेमाल किया जा सकता है । वे इस प्रकार नए उपकरणों के रूप में सेवा कर रहे है पता लगाने कैसे वायरल एकीकरण साइट एचआईवी जीव विज्ञान और कैसे वायरस अलग उपचार रणनीतियों (उदाहरण के लिए प्रतिक्रिया करता है, विलंबता reversing एजेंटों द्वारा inducibility) प्रभाव कर सकते हैं । हमारे विधि CRISPR-Cas9-आधारित जीनोम इंजीनियरिंग के लाभ का उपयोग करता है, जिसमें मुताबिक़ पुनर्संयोजन द्वारा रिपोर्टर अनुक्रम के एकीकरण के लक्ष्य साइट पर एक Cas9 nuclease प्रेरित डबल-किनारा तोड़ने के द्वारा की सुविधा है । एकीकरण के लिए लक्ष्य साइटों एचआईवी संक्रमित व्यक्तियों और Cas9 के लिए उपयुक्त पाम रूपांकनों की उपस्थिति-मध्यस्थता जीनोम इंजीनियरिंग पर अध्ययन से वर्णित आवर्तक एकीकरण साइटों को निकटता के अनुसार चुना जाता है ।

हमारे अनुकरणीय परिणामों में, हम BACH2 जीन लोकस, जो BTB और सीएनसी समरूपता transcriptional 2 नियामक के लिए कोड पर ध्यान केंद्रित किया है । एंटीरेट्रोवाइरल थेरेपी पर जीर्ण एचआईवी संक्रमित व्यक्तियों में, BACH2 एकीकृत एचआईवी के loci दिखा संवर्धन में से एक है-1 अनुक्रम3,6,7,8,10। हम एक ंयूनतम एचआईवी-1-व्युत्पंन लंबे टर्मिनल दोहराने (बाएं), tdTomato कोडिंग अनुक्रम, और गोजातीय वृद्धि हार्मोन (BGH) polyadenylation संकेत (फिलीस्तीनी अथॉरिटी) है, जो हम BACH2 intron 5 में दो विशिष्ट साइटों को लक्षित किया है शामिल रिपोर्टर व्युत्पंन चुना है । प्रस्तुत प्रोटोकॉल Jurkat कोशिकाओं, एक मानव CD4 + टी सेल व्युत्पन्न निलंबन सेल लाइन के लिए अनुकूलित है, लेकिन अन्य सेल लाइनों का इस्तेमाल किया जा सकता है और प्रोटोकॉल तदनुसार अनुकूलित. हम लक्ष्य स्थल के चयन के लिए एक विस्तृत कार्यप्रवाह प्रस्तुत करते हैं, समरूपता हथियार, CRISPR-Cas9 के साथ लक्ष्य वेक्टर का निर्माण चुना जीनोमिक साइट में रिपोर्टर की मध्यस्थता लक्ष्यीकरण, पीढ़ी और क्लोनिंग लाइनों के चयन, और व्यापक सत्यापन के नव सृजित, लक्षित रिपोर्टर सेल लाइनों ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. जीनोम इंजीनियरिंग के लिए लक्ष्यीकरण रणनीति और वेक्टर (टीवी) डिजाइन लक्ष्यीकरण

नोट: जीनोम इंजीनियरिंग के पहले कदम चयन और CRISPR-Cas9-मध्यस्थता लक्ष्यीकरण के लिए आवश्यक उपकरणों की पीढ़ी शामिल है । एक जीनोमिक एकीकरण साइट लोकस का चयन, लक्ष्यीकरण के लिए सेल प्रकार के विकल्प, और एकीकरण के लिए एक एचआईवी व्युत्पंन रिपोर्टर के डिजाइन इस कदम से पहले होना चाहिए । इस प्रोटोकॉल एक एचआईवी-LTR_tdTomato_BGH-PA Jurkat लक्ष्य कोशिकाओं में ंयूनतम रिपोर्टर के लक्ष्यीकरण का वर्णन करता है । CRISPR-Cas9-आधारित लक्ष्यीकरण, जनरेशन, स्क्रीनिंग और क्लोनिंग लाइनों के सत्यापन के लिए कार्यप्रवाह का एक प्रवाह चार्ट चित्रा 1में दर्शाया गया है । वर्णित लक्ष्यीकरण कार्यनीति चयनित एकीकरण साइट पर gRNA-निर्देशित dsDNA विरामों को जेनरेट करने के लिए S. pyogenes Cas9 (SpCas9) का उपयोग करती है. रिपोर्टर तो एक गैर प्रदान द्वारा मुताबिक़ पुनर्संयोजन के माध्यम से चुना जीनोमिक लोकस में लक्षित है रैखिक लक्ष्यीकरण वेक्टर (टी वी) है कि रिपोर्टर तो तथाकथित 5 ' और 3 ' समरूपता हथियार (HA)11द्वारा पार्श्व अनुक्रम शामिल हैं ।

  1. लक्षित लोकस, gRNA, और लक्ष्यीकरण वेक्टर डिजाइन का विकल्प
    1. व्यक्तिगत वैज्ञानिक प्रश्न के आधार पर लक्षित thegenomic लोकस चुनें । का प्रयोग करें विभिंन अध्ययन में रोगियों में पाया एचआईवी के आवर्तक एकीकरण साइटों की सूची प्रकाशित2,3,4,5,6,7,8 के रूप में एक दिशानिर्देश. silico में वांछित जीनोमिक लोकस के जीनोमिक अनुक्रम को निकालने के लिए लक्षित किया जा करने के लिए (पूर्ण जीन के अनुक्रम या जीनोमिक अनुक्रम के कम से कम 5 केबी) UCSC जीनोम ब्राउज़र (http://genome.edu.ucsc.edu) का उपयोग कर ।
    2. चुना जीनोमिक के लक्ष्यीकरण के लिए गाइड RNAs (gRNAs) 20 nt का चयन लोकस ई-कुरकुरा webtool (http://www.e-crisp.org) का उपयोग कर ।
      1. "होमो sapiens GRCh38" के रूप में जीव का चयन करें । इनपुट २,००० वांछित जीनोमिक लोकस को कवर जीनोमिक अनुक्रम के बीपी 1.1.1 कदम में निकाला ।
      2. मध्यम आवेदन सेटिंग्स का उपयोग कर एक gRNA खोज शुरू (किसी भी पाम, किसी भी 5 ' आधार, बंद लक्ष्य बेमेल बर्दाश्त, और introns/CPG द्वीप शामिल नहीं हैं) । संभव gRNA डिजाइन के साथ एक सूची दिखाई देगा, विशिष्टता और दक्षता के लिए कम स्कोर करने के लिए उच्चतम से रैंकिंग ।
      3. एक gRNA है कि अधिमानतः विशिष्टता और दक्षता के लिए एक उच्च स्कोर से पता चलता है का चयन करें और के रूप में वांछित जीनोमिक लोकस के लिए संभव के रूप में बंद करने के लिए लक्षित किया जाएगा ।
        नोट: वांछित जीनोमिक लोकस और विशिष्ट और कुशल gRNA के डिजाइन करने के लिए निकटता के बीच एक समझौता हो पाया है ।
    3. NCBI ब्लास्ट ब्राउज़र (https://blast.ncbi.nlm.nih.gov) का उपयोग कर संदर्भ जीनोम के खिलाफ चुना gRNA अनुक्रम विस्फोट gRNA बंधन साइट की विशिष्टता के लिए जांच करने के लिए ।
      1. जीनोम के रूप में "मानव" का चयन करें । gRNA अनुक्रम क्वेरी अनुक्रम के रूप में इनपुट । प्रोग्राम के रूप में "अत्यधिक समान अनुक्रम" (megablast) का चयन करें । सुनिश्चित करें कि gRNA अनुक्रम अद्वितीय है । यदि नहीं, तो चरण 1.1.2.3 और विस्फोट से एक अलग gRNA चुना है ।
    4. एक बार gRNA अनुक्रम चुना जाता है, silico में चयन १,००० bp ऊपर और जीनोमिक अनुक्रम से gRNA अनुक्रम के बहाव के रूप में 5 ' और 3 ' हा तदनुसार कदम 1.1.1 में निकाले ।
      नोट: gRNAs चुना जीनोमिक एकीकरण साइट लोकस करने के लिए मुताबिक़ किया जाना चाहिए और एक protospacer आसंन आकृति के निकट स्थित (पाम; उदा., NGG for SpCas9) (चित्रा 2a) । टीवी रिपोर्टर अनुक्रम है कि 5 ' और 3 ' है द्वारा पार्श्व होता है । १००० बीपी ऊपर और gRNA अनुक्रम11के बहाव को कवर किया है । पूर्ण gRNA अनुक्रम को HA में शामिल नहीं किया जाना चाहिए । एक 5 nt तक ओवरलैप स्वीकार्य है (चित्रा 2a) ।
  2. gRNA और लक्ष्यीकरण वैक्टर की पीढ़ी
    नोट: वेक्टर योजनाओं के लिए, चित्र bदेखें ।
    1. SpCas9 और gRNA की अभिव्यक्ति के लिए एक वेक्टर उत्पन्न करने के लिए, रीढ़ के रूप में pX330-U6-Chimeric_BB-cBh-hSpCas9 का उपयोग करें जिसमें से दोनों SpCas9 और एकल गाइड आरएनए (sgRNA) एक साथ व्यक्त किया जा सकता है । gRNA अनुक्रम को रीढ़ में क्लोन करने के लिए, BbsI प्रतिबंध साइटों12का उपयोग करें ।
    2. टीवी जेनरेट करने के लिए, एक उच्च-प्रतिलिपि प्लाज्मिड को रीढ़ के रूप में चुनें (उदा., पीएमके या सीडीएनए 3.1).
      1. सबसे पहले, रिपोर्टर इकट्ठे (इस प्रोटोकॉल में: LTR_tdTomato_BGH-फिलीस्तीनी अथॉरिटी) गिब्सन विधानसभा clong13 द्वारा निर्माण रीढ़ की में एक वाणिज्यिक विधानसभा क्लोनिंग किट का उपयोग कर, और 5 परिचय ' और ' 3 पार्श्व प्रतिबंध साइटों (जैसे, 5 ' PacI और 3 ' SmaI) के बाद प्रतिबंध पाचन क्लोनिंग के लिए है ।
      2. बढ़ाना १००० हा टुकड़ा के जीनोमिक डीएनए (gDNA) से चरण 1.1.4 में चुना गया कक्ष प्रकार (इस प्रोटोकॉल: Jurkat कोशिकाओं) को ठीक करने गतिविधि के साथ एक डीएनए पोलीमरेज़ का उपयोग कर (देखें तालिका 1 और 2 पीसीआर सामग्री के लिए और सायक्लिंग शर्तें) । फिर, रिपोर्टर पर प्रतिबंध साइटों के पार्श्व परिचय 5 ' और 3 ' प्रत्येक हा के सिरों पर (PacI पर 5 ' हा दोनों सिरों पर, SmaI पर 3 ' हा दोनों सिरों पर) ।
      3. क्रमिक क्लोन में पहले से ही रिपोर्टर (चरण 1.2.2.1 में उत्पंन) प्रतिबंध एंजाइमों14,15क्लोनिंग के निर्माण रीढ़ में है । सबसे पहले, क्लोन 5 ' हा PacI प्रतिबंध साइटों का उपयोग कर, तो 3 ' हा में क्लोन SmaI प्रतिबंध साइटों का उपयोग कर ।
        नोट: यदि टीवी रीढ़ की एक अतिरिक्त फ्लोरोसेंट रिपोर्टर होता है, अवांछित रीढ़ एकीकरण प्रवाह cytometry द्वारा मूल्यांकन किया जा सकता है (कदम 3.2.2 और 3.2.3 देखें) । यदि टीवी रीढ़ कोई फ्लोरोसेंट रिपोर्टर शामिल हैं, रीढ़ एकीकरण पीसीआर का उपयोग करके मूल्यांकन किया जाना चाहिए (चरण 3.2.8 देखें) ।

Figure 1
चित्रा 1: CRISPR के लिए कार्यप्रवाह-Cas9-मध्यस्थता लक्ष्यीकरण, पीढ़ी, और परिभाषित एकीकरण साइट के साथ क्लोनर रिपोर्टर लाइनों का चयन. (A) लक्ष्य वेक्टर और transduce Jurkat T कोशिकाओं को लक्ष्य वेक्टर और Cas9/gRNA एक्सप्रेशन प्लाज्मिड के साथ जेनरेट करें । () FACS द्वारा transfected कोशिकाओं ७२ एच पोस्ट अभिकर्मक को समृद्ध करना. () कोशिकाओं को 10 से 14 दिनों के लिए बढ़ने और पीसीआर और फ्लो cytometry द्वारा घटनाओं लक्ष्यीकरण की घटना की पुष्टि करते हैं । () कमजोर पड़ने को सीमित करके एकल सेल क्लोन उत्पन्न करते हैं और क्लोनों को 3 सप्ताह के लिए विकसित करते हैं । () स्क्रीन पीसीआर और ९६ में प्रवाह cytometry द्वारा सही लक्ष्यीकरण के लिए क्लोन अच्छी तरह से प्रारूप । चयनित क्लोनों का विस्तार करें । () दक्षिणी दाग, पीसीआर और अनुक्रमण द्वारा चयनित क्लोनों में सही लक्ष्यीकरण की जांच करें, और Cas9 endonuclease गतिविधि के ऑफ-टारगेट घटनाओं का विश्लेषण । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्र 2: लक्ष्यीकरण रणनीति और वेक्टर डिजाइन । () gRNA और समरूपता शस्त्रों का चुनाव. 20 nt gRNA चुना जीनोमिक लक्ष्य साइट के लिए मुताबिक़ है और एक पाम के निकट स्थित है । समरूपता शस्त्र १,००० बीपी अप-और gRNA के बहाव के पूरक है और gRNA अनुक्रम शामिल नहीं करना चाहिए । () लक्ष्यीकरण के योजनाबद्ध वेक्टर और gRNA/Cas9 वेक्टर । लक्ष्यीकरण वेक्टर में चुने हुए रिपोर्टर अनुक्रम होते हैं जो 5 ' और 3 ' समरूपता आर्म्स द्वारा पार्श्व किए जाते हैं. gRNA/Cas9 वेक्टर पर आधारित है pX330-U6-Chimeric_BB-cBh-hSpCas9 रीढ़ । () मुताबिक़ पुनर्संयोजन द्वारा लक्ष्यीकरण की योजनाबद्ध । लक्ष्य वेक्टर और guideRNA/Cas9 वेक्टर Jurkat कोशिकाओं में transfected हैं । Cas9 जीनोमिक लक्ष्य स्थल पर एक डबल किनारा तोड़ मध्यस्थता (* द्वारा संकेत) और जीनोमिक लक्ष्य लोकस में मुताबिक़ पुनर्संयोजन और रिपोर्टर अनुक्रम के एकीकरण की सुविधा. कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

2. Jurkat कोशिकाओं के CRISPR-Cas9-आधारित लक्ष्यीकरण

  1. Jurkat कोशिकाओं का अभिकर्मक
    1. 24 ज से पहले अभिकर्मक, प्लेट १.२५ x 106 Jurkat टी कोशिकाओं RPMI १६४० के २.५ मिलीलीटर में 10% (v/v) भ्रूण बछड़ा सीरम के साथ पूरक (FCS) और 4 मिमी एल-glutamine [के रूप में संदर्भित "RPMI w.o. एंटीबायोटिक्स (अटल)"] प्रति अच्छी तरह से एक 6-well सेल संस्कृति प्लेट । एक लक्ष्यीकरण प्रयोग के लिए, एक पूरा 6 अच्छी तरह से प्लेट (यानी, 6 वेल्स सेल निलंबन के २.५ मिलीलीटर के साथ प्रत्येक तैयार) ।
    2. अगले दिन, सह-transfect कोशिकाओं के साथ परिपत्र टीवी और pX330-U6-Chimeric_BB-cBh-hSpCas9/gRNA कोशिकाओं के लिए एक अभिकर्मक एजेंट विशिष्ट का उपयोग कर ।
      1. परिपत्र टीवी के 2 µ जी और 2 µ जी के pX330-U6-Chimeric_BB-cBh-hSpCas9/gRNA के लिए µ के लिए अनुकूलित कम सीरम एकाग्रता के साथ वाणिज्यिक RPMI माध्यम के २५० अभिकर्मक एल (सीरम में ५०% की कमी के साथ RPMI) एक प्रतिक्रिया ट्यूब में और अच्छी तरह से मिश्रण जोड़ें ।
      2. ट्यूब और भंवर की दीवार को छूने के बिना डीएनए/माध्यम को धीरे से अभिकर्मक रिएजेंट के 12 µ एल जोड़ें । 15 मिनट के लिए मिश्रण मशीन चलो और कोशिकाओं की एक अच्छी तरह से dropwise जोड़ें । ३७ डिग्री सेल्सियस और 5% सह2पर कोशिकाओं की मशीन ।
        नोट: अभिकर्मक रिएक्शन की तैयारी को स्केल किया जा सकता है । अभिकर्मक के बाद कोई माध्यम परिवर्तन की आवश्यकता नहीं है ।
  2. प्रतिदीप्ति-सक्रिय कक्ष छँटाई (FACS) द्वारा transfected कोशिकाओं के संवर्धन
    1. ७२ एच पोस्ट-अभिकर्मक, पूल transfected कोशिकाओं, उंहें गिनती, और FACS द्वारा संवर्धन के लिए तैयार करते हैं । एक ५० मिलीलीटर शंकु ट्यूब में कोशिकाओं को इकट्ठा, 4 मिनट के लिए ३०० x g और कमरे के तापमान (RT) पर केंद्रापसारक, एक बार पंजाब में कोशिकाओं को धो, फिर से केंद्रापसारक, FACS बफर का एक उचित मात्रा में गोली निलंबित (पंजाब 1% FCS + 1 मिमी EDTA के साथ पूरक) 1 x 10 पर 7 कोशिकाओं/एमएल, और अंत में एक FACS ट्यूब में स्थानांतरण ।
    2. FACS और उन है कि टीवी के फ्लोरोसेंट रिपोर्टर (जैसे, इस प्रोटोकॉल में tdTomato) एक्सप्रेस तरह की कोशिकाओं के अधीन । RPMI १६४० में कोशिकाओं को इकट्ठा 10% FCS, 4 मिमी L-glutamine, और ५० यू/एमएल पेनिसिलिन और streptomycin के साथ पूरक (के रूप में संदर्भित करने के लिए "RPMI w/AB") ।
    3. FACS छंटाई के बाद, RPMI w/ab के 20 मिलीलीटर को जोड़कर एक बार कोशिकाओं को धो लें और आर सी पर 4 मिनट के लिए ३०० x g पर प्रारंभ करें । RPMI w/AB और प्लेट की एक उचित मात्रा में सेल गोली resuspend एक सेल संस्कृति प्लेट के साथ एक अच्छी तरह से में कोशिकाओं सेल नंबर पोस्ट के अनुसार उपयुक्त मात्रा-FACS ।
      नोट: संस्कृति एक छोटी मात्रा में कोशिकाओं को क्रमबद्ध (जैसे, 24 अच्छी तरह से), कोशिका मृत्यु के काफी स्तर के रूप में पहले सप्ताह के बाद में मनाया गया है लक्ष्यीकरण (अप करने के लिए 80-90%) ।
    4. ७५ सेमी ² सेल संस्कृति कुप्पी में 1 x 106 कोशिकाओं/एमएल के घनत्व तक मिश्रित लक्षित सेल जनसंख्या का विस्तार करें । इस के आसपास ले जाएगा 10-14 दिनों के बाद FACS छंटाई ।
  3. मिश्रित लक्षित सेल जनसंख्या में प्रवाह cytometry द्वारा लक्ष्यीकरण घटनाओं की पुष्टि
    1. विस्तार के 10 दिनों के बाद (जब कोशिकाओं के एक घनत्व तक पहुंच गए है 1 x 106 कोशिकाओं/एमएल में ७५ सेमी2 सेल संस्कृति कुप्पी), एक 12-well सेल संस्कृति में RPMI w/AB के 1 मिलीलीटर में मिश्रित लक्षित सेल जनसंख्या के 1 x 106 कोशिकाओं के साथ दो कुओं प्लेट प्लेट.
    2. रिपोर्टर (टीवी की जनरेशन चरण 1.2.2.1 में वर्णित है.) के एचआईवी लीटर के लिए प्रेरित ५० एनजी जोड़कर कुओं में से एक में 12-myristate 13-एसीटेट (पमा) तथा 1 µ m Ionomycin (पमा-िोनो के रूप में संदर्भित) । गैर-प्रेरित नियंत्रण के रूप में दूसरी अच्छी तरह से कक्षों का उपयोग करें । संस्कृति दोनों प्रेरित और गैर प्रेरित कोशिकाओं के लिए 24 एच ।
    3. गैर प्रेरित और प्रेरित कोशिकाओं (प्रत्येक) के सेल निलंबन के ०.५ मिलीलीटर ले लो, उंहें पंजाब में एक बार धोने, और FACS बफर के २०० µ एल में प्रत्येक को निलंबित ।
    4. १००,००० प्रवाह cytometry द्वारा कोशिकाओं का विश्लेषण । गेट व्यवहार्य एकल आगे और sideward तितर बितर में आकार के आधार पर कोशिकाओं, और फ्लोरोसेंट रिपोर्टर जीन अभिव्यक्ति का विश्लेषण ।
      नोट: इस कदम पर (10-14 दिनों के बाद FACS छंटाई), अभिकर्मक द्वारा फ्लोरोसेंट रिपोर्टर की क्षणिक अभिव्यक्ति अब पता लगाना चाहिए । इस समय बिंदु पर फ्लोरोसेंट अभिव्यक्ति रिपोर्टर अनुक्रम के जीनोमिक एकीकरण को इंगित करता है ।
  4. मिश्रित लक्षित प्रकोष्ठ जनसंख्या के जीनोमिक डीएनए पर पीसीआर द्वारा लक्ष्यीकरण घटनाओं का पता लगाना
    नोट: पीसीआर के माध्यम से लक्ष्यीकरण घटनाओं का पता लगाने के लिए, दो प्राइमरी जोड़े डिजाइन 5 ' एकीकरण (int.) जंक्शन और 3 ' int. जंक्शन के लिए विशिष्ट । 5 ' int. जंक्शन पीसीआर के लिए, फॉरवर्ड प्राइमर 5 ' हा और रिपोर्टर (प्राइमरों P1 और 3ए में P2) के बाएं से दाएं में रिवर्स प्राइमर के ऊपर बांधना चाहिए । ' 3 int. जंक्शन पीसीआर के लिए प्राइमरी जोड़ी रिपोर्ट के फिलीस्तीनी अथॉरिटी से अवधि के लिए 100-200 बीपी 3 ' हा के बहाव (प्राइमर पी 2 और 4/ प्राइमर P1 और पी 4 भी गैर के प्रवर्धन के लिए सेवा करेंगे मिश्रित लक्षित जनसंख्या में एलील लक्षित । एक योजनाबद्ध के लिए, चित्र 3ए देखें ।
    1. चरण 2.2.4 से मिश्रित लक्षित सेल जनसंख्या के सेल निलंबन के 2 मिलीलीटर से gDNA तैयार करें । निर्माता के प्रोटोकॉल के अनुसार एक gDNA निष्कर्षण किट का उपयोग करें । उसके बाद गैर-लक्षित कक्षों के gDNA को नियंत्रण के रूप में तैयार करें ।
    2. प्रदर्शन int. जंक्शन पीसीआर (प्राइमरों p1/P2 और 3/4 के लिए 4 ' int. जंक्शन, क्रमशः) और गैर लक्षित एलील पीसीआर (प्राइमरों p1/पी 4) एक उच्च निष्ठा डीएनए पोलीमरेज़ का उपयोग (देखें टेबल 3 और पीसीआर सामग्री और सायक्लिंग शर्तों के लिए) . एक १.५% agarose/ताे जेल पर पीसीआर प्रॉडक्ट्स के 5 µ एल का विश्लेषण करें ।
      नोट: यदि मिश्रित लक्षित जनसंख्या में ऐसी कोशिकाएं होती है जिनमें जीनोम इंजीनियरिंग है, तो एक विशिष्ट पीसीआर उत्पाद को देखा जाना चाहिए जो गैर-लक्षित कक्षों (नकारात्मक नियंत्रण) के gDNA में detectable नहीं है । गैर लक्षित एलील पीसीआर के लिए, एक दोनों लक्षित और गैर लक्षित कोशिकाओं के लिए एक ही आकार के एक उत्पाद का पालन करना चाहिए (जीनोमिक P1 और पी 4 प्राइमरों के लिए सकारात्मक नियंत्रण) । यदि कोई बैंड नहीं मनाया जाता है, चक्र की संख्या में वृद्धि या पीसीआर बफर फेरबदल (उदाहरण के लिए DMSO के अलावा या मिलीग्राम2 +की वृद्धि की मात्रा के माध्यम से), या पोलीमरेज़ बदलकर पीसीआर सायक्लिंग शर्तों फेरबदल पर विचार करें ।

3. क्लोनिंग लाइनों और सही लक्ष्यीकरण के लिए स्क्रीनिंग के उत्पादन

नोट: प्रवाह cytometry और पीसीआर (अनुभाग 2.2-2.4) द्वारा मिश्रित लक्षित सेल जनसंख्या में लक्ष्यीकरण घटनाओं की पुष्टि के बाद, एकल सेल क्लोन (अवधि: 28 से ३५ दिन) और रिपोर्टर अनुक्रम के सही एकीकरण के लिए स्क्रीन उत्पन्न करते हैं ।

  1. कमजोर पड़ने के माध्यम से एकल सेल क्लोन की पीढ़ी चढ़ाना
    1. पहले से तैयार Jurkat-वातानुकूलित मध्यम: स्वस्थ, अनुपचारित Jurkat टी कोशिकाओं को 1 x 106 कोशिकाओं/एमएल, ३०० x जीमें 5 मिनट के लिए हो, और supernatant एक ०.२२ µm सिरिंज फ़िल्टर इकाई का उपयोग कर फिल्टर से दूर ले लो RPMI w/
      नोट: वातानुकूलित मध्यम से कम अवधि के भंडारण के लिए 4 डिग्री सेल्सियस पर या 1 सप्ताह से अधिक भंडारण के लिए-20 डिग्री सेल्सियस पर रखें । कमजोर पड़ने से पहले वातानुकूलित मध्यम से 20 से 30 मिलीलीटर की तैयारी करें ।
    2. कदम 2.2.4 से लक्षित कोशिकाओं की गिनती 10 के बाद-विस्तार के 14 दिनों के लिए और उंहें RPMI w/AB में 1 x 105 कोशिकाओं के एक एकाग्रता के लिए/ लो १०० µ एल के 1 एक्स 105 कोशिकाओं/एमएल समाधान और ९.९ एमएल के साथ पतला १,००० कोशिकाओं की एकाग्रता प्राप्त करने के लिए/ १,००० कोशिकाओं/एमएल समाधान की 1 मिलीलीटर लो और १०० कोशिकाओं की एकाग्रता प्राप्त करने के लिए मध्यम के 9 मिलीलीटर के साथ पतला/
    3. प्लेट ९६-अच्छी तरह से और प्रति अच्छी तरह से 2 कोशिकाओं के प्रति 1 सेल युक्त प्लेटें । 1 सेल के लिए प्रति अच्छी तरह से, 1 मिलीलीटर की १०० कोशिकाओं/एमएल समाधान ले लो और धीरे से 5 मिलीलीटर वातानुकूलित मध्यम और एक बाँझ एजेंट जलाशय में ताजा माध्यम के 4 मिलीलीटर के साथ मिश्रण ।
    4. प्रति अच्छी तरह से 2 कोशिकाओं के लिए, १०० कोशिकाओं/एमएल समाधान के 2 मिलीलीटर ले और वातानुकूलित मध्यम और ताजा माध्यम के 3 मिलीलीटर की 5 मिलीलीटर के साथ धीरे से मिश्रण । प्लेट ९६-अच्छी तरह से दौर नीचे प्लेटें १०० µ एल के साथ संबंधित कोशिका कमजोर पड़ने के प्रति अच्छी तरह से एक मल्टीचैनल प्लास्टिक का उपयोग कर ।
      नोट: 5 से १० ९६-अच्छी तरह से लक्ष्यीकरण प्रति प्लेटें निर्माण स्क्रीनिंग के लिए क्लोन प्राप्त करने के लिए पर्याप्त हैं ।
    5. ९६-अच्छी तरह से प्लेट्स ढेर, एक 6-अच्छी तरह से प्रत्येक में पंजाब के 3 मिलीलीटर युक्त प्लेट के साथ ढेर कवर, और 5% CO2 के साथ एक humidified सेल संस्कृति मशीन में ३७ ° c पर प्लेटें 3 सप्ताह के लिए मशीन ।
      नोट: इस समय के दौरान सेल कल्चर मीडियम को न बदलें । एक या दो बार एक सप्ताह से अधिक मशीन नहीं खोल । सबसे अच्छा परिणाम खुले पानी जलाशय के साथ मशीन में मनाया जाता है ।
    6. मशीन के 3 सप्ताह के बाद, नेत्रहीन प्रकाश माइक्रोस्कोपी (4x बढ़ाई) का उपयोग कर बढ़ी हुई कालोनियों की उपस्थिति की पुष्टि करें और बड़े कालोनियों के साथ कुओं को चिह्नित करें ताकि वे कुओं के नीचे बिंदुओं के रूप में दिखाई दे रहे हैं ।
    7. तैयार १ ९६-अच्छी तरह से दौर नीचे प्लेट १०० µ एल के साथ RPMI w/ धीरे pipetting द्वारा एक अच्छी तरह से चिह्नित की कोशिकाओं को स्थगित । स्थानांतरण १०० सेल निलंबन के µ एल एक में अच्छी तरह से नए ९६ के ठीक प्लेट पहले से ही १०० µ l युक्त RPMI w/ स्थानांतरण १०० µ एक दूसरे खाली ९६ में इस सेल निलंबन के एल-अच्छी तरह से गोल नीचे थाली थाली डुप्लिकेट करने के लिए ।
    8. उगी कालोनियों के साथ सभी चिह्नित कुओं को जारी रखें । RPMI w/AB मीडियम के २०० µ l के साथ सभी रिक् त कुओं को भरें । ३७ डिग्री सेल्सियस और 5% सह 2 पर प्लेटें मशीन
      नोट: इन प्लेटों में से एक एकल सेल क्लोन ("स्टॉक प्लेट") और स्क्रीनिंग के लिए एक "डुप्लिकेट प्लेट" के रूप में दूसरे के विस्तार के लिए सेवा करेंगे ।
  2. फ्लोर cytometry और पीसीआर ने की सिंगल सेल क्लोनों की स्क्रीनिंग
    नोट: जबकि एकल सेल क्लोनों का विस्तार कर रहे हैं, चरण 3.1.8 से डुप्लिकेट प्लेट का उपयोग करें पीसीआर द्वारा रिपोर्टर अनुक्रम की उपस्थिति के लिए स्क्रीन एकल सेल क्लोन (कदम 3.2.4-3.2.12) और प्रवाह cytometry द्वारा फ्लोरोसेंट रिपोर्टर की अभिव्यक्ति (स्टेप्स 3.2.2 – 3.2.3) (चित्र 3सी) ।
    1. डुप्लिकेट प्लेट 24 से ४८ घंटे के लिए मशीन चलो और प्लेट फिर से डुप्लिकेट । ऐसा करने के लिए, जोड़ें १०० µ एल RPMI w/AB के हर अच्छी तरह से, pipetting द्वारा धीरे मिश्रण, और एक नया ९६ के लिए १०० µ l हस्तांतरण-अच्छी तरह से गोल नीचे थाली एक मल्टीचैनल प्लास्टिक का उपयोग कर । फ्लो cytometry स्क्रीनिंग के लिए एक थाली का प्रयोग करें और पीसीआर आधारित स्क्रीनिंग के लिए दूसरे ।
    2. प्रवाह cytometry स्क्रीनिंग के लिए, पमा-िोनो के साथ कोशिकाओं को उत्तेजित करें । Ionomocin के ०.१ µ l का एक mastermix तैयार करें (1 mM stock), ०.१ µ l of पमा (५० µ g/µ l stock), र ४.८ µ l के RPMI w/एबी के कुओं की संख्या के अनुसार, उसके बाद प्रति कुआं µ के 5 mastermix एल जोड़ें ।
      नोट: प्रेरण सफलतापूर्वक क्लोन, जहां transcriptionally चुप हो सकता है और इसलिए फ्लोरोसेंट रिपोर्टर व्यक्त नहीं है की पहचान करने के लिए आवश्यक है ।
    3. कोशिकाओं को 24 घंटे के लिए तैयार करने और कदम 2.3.3 में वर्णित के रूप में प्रवाह cytometry के लिए कोशिकाओं की तैयारी करते हैं । गेट किसी भी व्यवहार्य एकल आगे और sideward तितर बितर और प्रवाह cytometry द्वारा फ्लोरोसेंट रिपोर्टर जीन अभिव्यक्ति का विश्लेषण में आकार पर आधारित कोशिकाओं (उदाहरण के परिणाम के लिए, चित्र 3सी देखें) । यदि टीवी रीढ़ प्रमोटर के साथ एक दूसरे फ्लोरोसेंट रिपोर्टर होता है (जैसे, GFP), स्क्रीन रीढ़ रिपोर्टर अभिव्यक्ति के लिए किसी भी क्लोन (कदम 1.2.2 और विवरण के लिए निंनलिखित नोट देखें) ।
      नोट: रीढ़ रिपोर्टर अभिव्यक्ति रीढ़ अनुक्रम के अवांछित एकीकरण इंगित करता है ।
    4. एक बार दूसरे डुप्लिकेट प्लेट में क्लोन पर्याप्त रूप से बड़े हो गए है (आमतौर पर 24 के लिए ४८ एच ९६-अच्छी तरह से प्लेट के दोहराव के बाद), सेल पीसीआर स्क्रीनिंग के लिए gDNA युक्त lysates तैयार करते हैं । 10 मिनट के लिए आर टी में ३०० x g पर थाली केंद्रापसारक ध्यान से सेल गोली परेशान बिना supernatant दूर ले ।
      नोट: lysates और पीसीआर प्रतिक्रियाओं की तैयारी के लिए सभी कदम मल्टीचैनल पिपेट के साथ प्रदर्शन किया जा सकता है ।
    5. कोमल pipetting द्वारा पंजाब के १०० µ एल के साथ धो कोशिकाओं और 5 मिनट के लिए ३०० x g पर आर टी में प्लेट केंद्रापसारक बंद करो पंजाबियों ले लो और lysis बफर के २०० µ एल जोड़ने [२०० mm NaCl, १०० mm Tris-एचसीएल पीएच 8-8.5, 5 मिमी EDTA, ०.१% एसडीएस; फिर जोड़ें 250 – 1000 µ g/एमएल के proteinase K (lyophilized पाउडर, ताजा में तौलना)] प्रति अच्छा है । pipetting करके धीरे से मिलाएं, और सस्पेंशन को एक नई पीसीआर प्लेट में ट्रांसफर कर दें ।
    6. तेल फिल्म के साथ प्लेट सील और एक thermocycler में ५५ डिग्री सेल्सियस पर 1 ज के लिए मशीन । 10 मिनट के लिए अधिकतम गति पर केंद्रापसारक (३,००० x g) नीचे स्पिन सेल मलबे के लिए, और एक नई पीसीआर प्लेट को supernatant हस्तांतरण ।
      नोट: प्लेटों में सेल lysates 4 डिग्री सेल्सियस पर इस स्तर पर आगे उपयोग तक संग्रहित किया जा सकता है ।
    7. डीएच2O के ११० µ l के साथ एक ९६-well पीसीआर प्लेट तैयार करें और सेल lysate (1:12 कमजोर पड़ने) के 10 µ l को जोड़ें । सेल lysates चिपचिपा और प्लास्टिक के लिए मुश्किल हो सकता है । न्यूनतम 20-µ l प्लास्टिक युक्तियों का प्रयोग करें ।
    8. एक thermocycler में ९९ डिग्री सेल्सियस पर 10 मिनट के लिए मशीन द्वारा proteinase कश्मीर को निष्क्रिय । इसके बाद पीसीआर स्क्रीनिंग के लिए निष्क्रिय और पतला सेल lysates का इस्तेमाल करें ।
    9. स्क्रीनिंग के लिए डिजाइन प्राइमरों पीसीआर (P5 और P6) चुना रिपोर्टर अनुक्रम के आधार पर 500-800 रिपोर्टर अनुक्रम के बीपी बढ़ाना । सकारात्मक नियंत्रण पीसीआर के लिए, का प्रयोग करें प्राइमरों P7 और P8 कि बढ़ाना ६३० एक जंगली-प्रकार के बीपी, गैर लक्षित जीनोमिक लोकस (NUP188 जीन) (चित्रा 3 सी और तालिका 5) । डिजाइन एक तिहाई प्राइमरी जोड़ी है कि एम्पलीफायरों टीवी रीढ़ की एक विशिष्ट एकीकरण के लिए एक नियंत्रण के रूप में 500-600 टी वी रीढ़ की बीपी-जुगाड़ (रीढ़ पीसीआर) ।
    10. जांच, नियंत्रण, और रीढ़ पीसीआर के लिए, एक वाणिज्यिक पीसीआर mastermix का उपयोग करें (देखें टेबल 6 और 7 पीसीआर सामग्री और सायक्लिंग शर्तों के लिए) । एक टेम्पलेट के रूप में कदम 3.2.8 में तैयार पतला और निष्क्रिय lysate के 2 µ एल का उपयोग करें और ९६ अच्छी तरह से प्रारूप में पीसीआर प्रवर्धन के ३८ से ४० चक्र के लिए पीसीआर चलाते हैं ।
    11. एक १.५% agarose/ताे जेल पर पीसीआर प्रॉडक्ट्स के 5 µ एल का विश्लेषण करें ।
      नोट: नियंत्रण पीसीआर के लिए, ६३० बीपी के एक विशिष्ट बैंड हर नमूने के लिए मनाया जाना चाहिए, पुष्टि है कि सेल lysates की गुणवत्ता पीसीआर के लिए पर्याप्त है । स्क्रीनिंग पीसीआर में एक विशिष्ट बैंड (500-800 बीपी प्राइमर डिजाइन के आधार पर) रिपोर्टर अनुक्रम के एकीकरण इंगित करता है । रीढ़ पीसीआर के लिए एक विशिष्ट बैंड (500 – 600 बीपी, प्राइमरी डिजाइन पर निर्भर करता है) टीवी रीढ़ अनुक्रम के अवांछित एकीकरण इंगित करता है (उदाहरण के परिणाम के लिए, चित्र 3सी देखें) ।
    12. फ्लो cytometry (स्टेप 3.2.3) और पीसीआर आधारित स्क्रीनिंग (step 3.2.12) के नतीजों को संयोजित करें । चुनें क्लोन जो पीसीआर उत्पादों की स्क्रीनिंग पीसीआर और सकारात्मक नियंत्रण में सही आकार दिखाने पीसीआर और cytometry के प्रवाह में पमा-िोनो के साथ प्रेरण के बाद फ्लोरोसेंट रिपोर्टर की अभिव्यक्ति । कि रीढ़ पीसीआर या टीवी रीढ़ की अभिव्यक्ति में किसी भी पीसीआर उत्पाद दिखाने के क्लोन बाहर-इनकोडिंग फ्लोरोसेंट प्रोटीन, टीवी रीढ़ अनुक्रम के विशिष्ट एकीकरण का संकेत है ।
    13. धीरे से चयनित क्लोनों का विस्तार करें ९६-अच्छी तरह से स्टॉक प्लेट से बड़े अच्छे प्रारूपों के लिए (48/24/12/6-अच्छी तरह से) ताजा माध्यम हर 2 से 3 दिन जोड़कर एक T75 सेल संस्कृति कुप्पी स्वरूप प्राप्त करने तक । 1 x 105 और 1 x 106 कोशिकाओं/एमएल के बीच एक सेल घनत्व बनाए रखें ।
    14. विस्तार के दौरान क्लोन के सेल स्टॉक तैयार करने के लिए सुनिश्चित करें: कोशिकाओं की गणना, आरटी में 5 मिनट के लिए ३०० x g पर केंद्रापसारक, supernatant त्यागें, और FCS में धीरे कोशिकाओं को निलंबित + 10% DMSO 5 x 106 कोशिकाओं/ क्रायोजेनिक शीशियों में Aliquot और एक क्रायो-फ्रीज कंटेनर का उपयोग करने के लिए कोशिकाओं को फ्रीज करने के लिए ८० ° c पर 1 डिग्री सेल्सियस/ दीर्घकालिक भंडारण के लिए, उंहें तरल एन2के लिए स्थानांतरण ।
      नोट: यह एक T75 कोशिका संस्कृति कुप्पी (यानी, लगभग 1 x 107 कोशिकाओं) बनाए रखने के लिए सलाह दी जाती है दक्षिणी सोख्ता द्वारा लक्ष्यीकरण के सत्यापन के लिए gDNA की तैयारी में विस्तार के दौरान (३.४ अनुभाग देखें) ।
  3. चयनित क्लोनों में पीसीआर/अनुक्रमण द्वारा एकीकरण स्थलों का सत्यापन
    नोट: चयनित क्लोनों के 5 ' और 3 ' int जंक्शनों पीसीआर परिवर्धित और डीएनए अनुक्रम स्तर पर सही लक्ष्यीकरण की पुष्टि करने के लिए सैंज अनुक्रमण करने के लिए प्रस्तुत कर रहे हैं ।
    1. एक वाणिज्यिक gDNA निष्कर्षण किट का उपयोग करके चयनित क्लोनों और Jurkat वाइल्ड-टाइप कोशिकाओं के gDNA तैयार करें ।
    2. ' 5 ' int के लिए 5 ' हा रिपोर्टर और ऊपर के ऊपर के 5 ' अंत बाध्यकारी प्राइमरी जोड़े का उपयोग करें । जंक्शन (प्राइमरों P1 और P2) और 3 ' के लिए 3 ' हा के रिपोर्टर और बहाव के ' 4 ' int. जंक्शन (प्राइमर पी 4 और p) के रूप में चरण २.४ में वर्णित के अंत । का प्रयोग करें प्राइमर P1 और पी 4 के लिए रिपोर्टर integrant (चित्रा 4a) के बिना एलील पर लक्षित एकीकरण साइट बढ़ाना ।
    3. एक टेम्पलेट के रूप में gDNA के 100-200 एनजी के साथ पीसीआर प्रतिक्रियाओं को तैयार करने और पीसीआर गतिविधि को ठीक करने के साथ एक पोलीमरेज़ का उपयोग कर (देखें टेबल 1 और पीसीआर सामग्री और सायक्लिंग शर्तों के लिए 2 ) ।
      नोट: यदि कोई बैंड मनाया जाता है, चक्र की संख्या में वृद्धि या पीसीआर बफर (उदाहरण के लिए, मिलीग्राम2 +के DMSO या वृद्धि की मात्रा को जोड़कर), या पोलीमरेज़ बदलकर पीसीआर सायक्लिंग शर्तों फेरबदल पर विचार करें ।
    4. एक १.५% agarose/ताे जेल पर पीसीआर प्रॉडक्ट्स के 5 µ एल का विश्लेषण करें । सही बैंड आकार मनाया जाता है, तो एक वाणिज्यिक किट का उपयोग कर शेष पीसीआर उत्पाद शुद्ध और यह सैंज अनुक्रमण करने के लिए विषय । 5 ' int. जंक्शन, 3 ' int. जंक्शन, और रिपोर्टर integrant बिना एलील के लक्षित साइट के अनुक्रम की जाँच करें उन्हें उम्मीद दृश्यों के साथ संरेखित करके.
      नोट: मुताबिक़ एलील जहां रिपोर्टर को एकीकृत नहीं किया गया है, इस तरह के न्यूक्लियोटाइड सम्मिलन या विलोपन (चित्रा 4a) के रूप में लक्ष्य साइट पर Cas9 मध्यस्थता परिवर्तन दिखाने की संभावना होगी.
    5. क्लोन के लिए कि सही int. जंक्शन अनुक्रम संरेखण के बाद दिखाने के लिए, एक पूरी लक्षित रिपोर्टर बढ़ाना पीसीआर प्रदर्शन और यह integrant के सही अनुक्रम को सत्यापित करने के लिए सैंज अनुक्रमण के अधीन ।
  4. चयनित क्लोनों में लक्ष्यीकरण के सत्यापन के लिए दक्षिणी ब्लाट विश्लेषण
    नोट: दक्षिणी दाग चयनित क्लोनों के विश्लेषण के लिए सही लक्ष्यीकरण की पुष्टि और Cas9-मध्यस्थता पुनर्संयोजन घटनाओं है कि लक्षित एकीकरण साइट पर हुई हो सकता है बाहर की आवश्यकता है ।
    1. उपयुक्त gDNA पाचन के लिए एक रणनीति विकसित करने और प्रयोग शुरू करने से पहले डिजाइन की जांच ।
      1. लक्षित साइट पर 2 से 10 kb लंबाई के उपयुक्त अंशों जनरेट करता है जो gDNA प्रतिबंध के लिए कोई प्रतिबंध एंजाइम का चयन करें । कुछ प्रतिबंध एंजाइमों, जैसे Asp७१८, BamHI, बीजीएलI, BglII, पारिस्थितिकीRV, हिंदIII, Ncoमैं, पीएसटीमैं, Pvuद्वितीय, Scaमैं, स्टु, और एसएसटी मैं सफलतापूर्वक उच्च आणविक वजन gDNA को पचाने के लिए इस्तेमाल किया गया है ।
      2. डिजाइन दो अलग दक्षिणी जांच: एक रिपोर्टर विशेष जांच और जीनोमिक जांच । रिपोर्टर-विशिष्ट जांच रिपोर्टर के भीतर एक अनुक्रम को hybridizes (यानी, tdTomato-विशिष्ट जांच) । जीनोमिक जांच hybridizes एक जीनोमिक क्षेत्र के करीब (लेकिन अतिव्यापी नहीं) एक हा ।
      3. जीनोमिक जांच का चयन करें ताकि जीनोमिक जांच बाइंडिंग द्वारा पता लगाया जाएगा कि gDNA पाचन द्वारा जनरेट किया गया अंश लक्षित और गैर-लक्षित alleles (चित्र 4b) से लंबाई (2 kb से अधिक) में भिंन है । एक जांच की लंबाई ४०० से १,००० बीपी की सिफारिश की है ।
      4. डिजाइन पीसीआर प्राइमरों दो आवश्यक जांच बढ़ाना । रिपोर्टर-टीवी टेम्पलेट से विशेष जांच बढ़ाना एक उच्च निष्ठा डीएनए पोलीमरेज़ का उपयोग ( टेबल 3 और पीसीआर सामग्री और साइकिल चालन की स्थिति के लिए 4 देखें) ।
      5. जीनोमिक जांच को बढ़ाना जंगली-प्रकार Jurkat gDNA से तैयार एक वाणिज्यिक gDNA निष्कर्षण किट के साथ एक डीएनए पोलीमरेज़ का उपयोग कर गतिविधि को ठीक करने के साथ (देखें टेबल 1 और 2 पीसीआर सामग्री और सायक्लिंग शर्तों के लिए) । एक agarose/ताे जेल पर पीसीआर उत्पादों को शुद्ध करें और निर्माता के निर्देशों के अनुसार एक वाणिज्यिक जेल निष्कर्षण किट का उपयोग करके अंशों को निकालें ।
    2. जंगली प्रकार Jurkat कोशिकाओं और कदम 3.2.14 से चयनित क्लोन के 1 एक्स 107 कोशिकाओं से उच्च आणविक वजन gDNA निकालें ।
      1. आर टी पर 5 मिनट के लिए ३०० x g पर केंद्रापसारक द्वारा कोशिकाओं गोली, यह एक बार पंजाबियों के साथ धोने, और lysis बफर के 4 मिलीलीटर में गोली निलंबित [२०० mm NaCL, १०० mm Tris-HCl pH 8, 5 mm EDTA, ०.१% एसडीएस; फिर जोड़ें 250 – 1000 µ g/मब proteinase K (lyophilized powder , हौसले में तौलना)]. /५५ डिग्री सेल्सियस, एक तालिका के thermomixer में ३५० rpm पर मिलाते में ओ एन/
      2. isopropanol के 4 मिलीलीटर जोड़ें और 10 से 20 बार उलटा करके मिश्रण । gDNA को सफेद हाला के रूप में दिखाई देना चाहिए । स्पूल gDNA एक गिलास पिपेट के ठीक टिप पर, ७०% ेतोः के ७५० µ एल में उभर कर धो, और आर टी पर शुष्क (5 से 10 मिनट) ।
      3. एक १.५ मिलीलीटर प्रतिक्रिया 1x ते बफर के ५०० µ l युक्त ट्यूब (10 मिमी Tris-एचसीएल पीएच ८.०, 1 मिमी EDTA) और 4 डिग्री सेल्सियस पर ओ/एन भंग करने के लिए छोड़, ३५० rpm पर मिलाते में तेज बहाया । इस अवस्था से gDNA के किसी भी pipetting को कतरने से बचने के लिए चौड़े बोर के नुस्खे के साथ किया जाना चाहिए ।
        नोट: उच्च आणविक भार gDNA की तैयारी दक्षिणी दाग विश्लेषण के लिए आवश्यक है, और व्यावसायिक रूप से उपलब्ध gDNA तैयारी किट उपयुक्त नहीं हैं ।
    3. डाइजेस्ट (दो बार) चयनित क्लोनों के gDNA के 15 µ g और चयनित प्रतिबंध एंजाइम के साथ जंगली प्रकार Jurkat कोशिकाओं (चरण 3.4.1.1 देखें) में एक ६० µ एल प्रतिक्रिया के साथ 6 µ एल एंजाइम के (20 इकाइयों/µ l): सबसे पहले, डीएनए, पाचन बफर, और ddH2हे जोड़ें, ३७ डिग्री सेल्सियस पर मशीन ओ/ , तो एंजाइम को जोड़ने और एंजाइम विशेष पाचन तापमान पर मशीन ओ/ दक्षिणी जांच के अनुसार पच gDNA की 15 यूजी की आवश्यकता है ।
    4. का उपयोग करें 7 µ l के ६० µ l प्रतिबन्ध डाइजेस्ट के लिए विश्लेषणात्मक जेल ट्रो पर 1% agarose/ताे जेल. एक धब्बा पूरा पाचन और अच्छा डीएनए गुणवत्ता के लिए दक्षिणी दाग विश्लेषण इंगित करता है ।
    5. 1:10 3 मीटर सोडियम एसीटेट और 2 खंड १००% ेतोः जोड़कर शेष प्रतिबंध डाइजेस्ट हाला, फिर 1 ज पर-८० ° c के लिए मशीन और 4 डिग्री सेल्सियस पर १५,६०० x g पर 30 मिनट के लिए केंद्रापसारक ।
    6. supernatant त्यागें और ७०% ेतोः के साथ गोली धोने । 4 ° c पर १५,६०० x g में 15 मिनट के लिए केंद्रापसारक, त्याग supernatant, चलो गोली सूखी आरटी पर संक्षेप में, और भंग 20 ddH2ओ के µ एल में ।
    7. रन 1% agarose/ताे सोख्ता जेल, लोड 20 उल के प्रति लेन पच gDNA. ६० V, ४०० mA पर 2 ज के लिए जेल चलाते हैं ।
      नोट: agarose जेल का प्रतिशत और रनिंग समय/वोल्टेज चरण 3.4.1.1 में परिकलित दक्षिणी दाग का पता लगाने के लिए अपेक्षित अंश आकार के अनुसार समायोजित किया जा सकता है । दक्षिणी दाग विश्लेषण के निंनलिखित कदम एक अनुपूरक प्रोटोकॉल में विस्तार से वर्णित है (1 से 18 कदम) । इन कदमों के शामिल हैं: सोख्ता जेल की धुलाई, एक नायलॉन झिल्ली पर सोख्ता, रेडियोधर्मी जांच पीढ़ी, जांच संकरण, और autoradiograph फिल्म के विकास । प्राप्त बैंडिंग पैटर्न की तुलना चरण 18 (अनुपूरक प्रोटोकॉल) में autoradiograph विकास के बाद दक्षिणी रणनीति के अनुसार अपेक्षित पैटर्न के साथ (उदाहरण के लिए परिणाम, चित्रा 4bदेखें) ।
  5. ऑफ-टारगेट इवेंट का विश्लेषण
    नोट: चूंकि CRISPR-Cas9-मध्यस्थता जीनोम इंजीनियरिंग बंद लक्ष्य प्रभाव उत्पन्न कर सकते हैं, पीसीआर-चयनित क्लोनों में silico-अनुमानित बंद लक्ष्य साइटों मेंदस उच्चतम स्थान बढ़ाना और उन्हें सैंज अनुक्रमण करने के लिए विषय.
    1. का प्रयोग करें CCTop16 (http://crispr.cos.uni-heidelberg.de) की एक सूची उत्पंन करने के लिए silico में दस सर्वोच्च स्थान की भविष्यवाणी की बंद लक्ष्य अनुक्रम ।
      1. इनपुट क्वेरी अनुक्रम के रूप में लक्ष्यीकरण के लिए इस्तेमाल के रूप में पाम सहित gRNA अनुक्रम । का चयन करें "NGG" पाम के रूप में और "मानव जीनोम" बंद लक्ष्य भविष्यवाणी के लिए संदर्भ के रूप में ।
      2. "4" करने के लिए अधिकतम कुल बेमेल सेट और पाम के बिना gRNA की लंबाई के लिए लक्ष्य साइट लंबाई । आउटपुट फ़ाइल जीनोमिक की एक रैंक सूची प्रदान करेगा-संबंधित gRNA के लिए लक्ष्य साइटों ।
    2. silico में जीनोमिक अनुक्रम ५०० बीपी ऊपर और दस सर्वोच्च में से प्रत्येक के बहाव को निकालने-लक्ष्य हिट UCSC जीनोम ब्राउज़र (http://genome.edu.ucsc.edu) और ऑफ लक्ष्य CCTop परिणाम सूची से हिट की स्थिति का उपयोग कर स्थान ।
    3. लक्ष्य साइटों से प्रत्येक के लिए विश्लेषण किया जा करने के लिए, एक पीसीआर प्राइमरी जोड़ी डिजाइन कि ६०० की लंबाई में ७०० bp के एक टुकड़े को प्रवर्धक से भविष्यवाणी की बंद लक्ष्य साइट सहित ।
    4. चयनित क्लोनों और Jurkat जंगली-प्रकार कोशिकाओं एक वाणिज्यिक gDNA निष्कर्षण किट का उपयोग करने से gDNA निकालें । हर बंद लक्ष्य साइट के लिए, एक पीसीआर गतिविधि को ठीक करने के साथ एक डीएनए पोलीमरेज़ का उपयोग कर ( 1 तालिकाओं और पीसीआर सामग्री और सायक्लिंग शर्तों के लिए 2 देखें) जंगली प्रकार पर और संबंधित क्लोन-gDNA व्युत्पंन ।
    5. एक १.५% agarose/ताे जेल पर पीसीआर प्रॉडक्ट्स के 5 µ एल का विश्लेषण करें । सही बैंड आकार मनाया जाता है, तो एक वाणिज्यिक पीसीआर शोधन किट का उपयोग कर शेष पीसीआर उत्पाद शुद्ध और यह सैंज अनुक्रमण करने के लिए विषय । Jurkat कोशिकाओं और लक्षित क्लोनों में बंद लक्ष्य साइटों के दृश्यों की तुलना करें ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

इस प्रतिनिधि प्रयोग में हम एक ंयूनतम एचआईवी-1-एक लीटर, tdTomato-कोडन अनुक्रम से मिलकर रिपोर्ट व्युत्पंन, और polyA-संकेत अनुक्रम BACH2 जीन17के 5 intron में दो loci को लक्षित करने के लिए चुना है । लक्ष्यीकरण के लिए loci को प्रकाशित आवर्तक एकीकरण एचआईवी से प्राथमिक टी कोशिकाओं पर विभिंन अध्ययनों में पाया साइटों के लिए निकटता के अनुसार चुना गया संक्रमित रोगियों2,4,5,6, 7,8 और एक पाम आकृति की उपस्थिति Cas9 के लिए आवश्यक NGG डबल-किनारा टूटता के मध्यस्थ प्रेरण । लक्ष्य वैक्टर निर्माण किया गया और transfected वर्णित प्रोटोकॉल के अनुसार । अभिकर्मक के लिए कार्यप्रवाह, लक्ष्यीकरण घटनाओं के लिए जांच, एकल-सेल क्लोन की पीढ़ी, और क्लोनों की स्क्रीनिंग और चयन योजनाबद्ध रूप से चित्र 1में दिखाया गया है ।

दो सप्ताह के बाद FACS-transfected कोशिकाओं के संवर्धन, हम रिपोर्टर जीन अभिव्यक्ति का पता लगाने के बाद पमा-िोनो प्रेरण कोशिकाओं के 4 से 12% में प्रवाह cytometry द्वारा, एकीकरण साइट पर निर्भर करता है (डेटा नहीं दिखाया गया है) और जीनोमिक डीएनए पर पीसीआर उत्पादों फैले पूरे 5 ' और रिपोर्टर अनुक्रम में 5 ' हा के ऊपर के ऊपर से ' 3 एकीकरण जंक्शन और 3 ' ha के बाद में रिपोर्टर अनुक्रम में, क्रमशः (1, 3 और 2 बी) । होने की पुष्टि की है कि लक्ष्यीकरण घटनाओं हुई, हम कमजोर पड़ने चढ़ाना सीमित द्वारा एकल सेल क्लोन उत्पंन पर चला गया । हमारे हाथों में, चढ़ाना 5 को १० ९६-अच्छी तरह से लक्ष्यीकरण प्रति प्लेटें एक सफल स्क्रीन के लिए पर्याप्त क्लोनों को प्राप्त करने के लिए पर्याप्त था । प्रोटोकॉल में (धारा ३.२), यह कैसे डुप्लिकेट ९६-कुओं में एकल सेल क्लोन की एक स्क्रीनिंग करने के लिए वर्णन किया गया है । इस संबंध में, केवल सकारात्मक क्लोनों का विस्तार किया जाना चाहिए, जो समय और प्रयास दोनों बचाता है. चित्रा 3सी में, पमा-िोनो प्रेरण और पीसीआर स्क्रीनिंग के बाद FACS-स्क्रीनिंग का उदाहरण डेटा दिखाया गया है । हम उच्च, कम, और कोई फ्लोरोसेंट रिपोर्टर जीन अभिव्यक्ति (आंकड़ा 3सी) के साथ क्लोन के एक नंबर मनाया । पीसीआर-स्क्रीनिंग के लिए यह जरूरी है कि एक कंट्रोल पीसीआर शामिल की जाए जो चॉइस की एक जीनोमिक लोकस को प्रवर्धित करे ताकि यह पता चल सके कि सेल lysates की क्वालिटी पीसीआर के लिए पर्याप्त है या नहीं । हमारे मामले में, हम नियंत्रण पीसीआर के लिए NUP188 जीन लोकस में एक ६३० बीपी अनुक्रम चुना है (प्राइमरी दृश्यों के लिए, तालिका 5देखें) । स्क्रीनिंग पीसीआर के लिए प्राइमरी तो रिपोर्ट में स्थित एक छोटे अनुक्रम बढ़ाना डिजाइन किए गए थे । इसके अतिरिक्त, लक्ष्य वेक्टर रीढ़ पर एक अनुक्रम के लिए पीसीआर किसी भी क्लोन जो विशिष्ट रूप से एकीकृत लक्ष्य वेक्टर रीढ़ अनुक्रम था (रीढ़ पीसीआर, नहीं दिखाया डेटा) को बाहर करने के लिए प्रदर्शन किया गया था ।

पूर्व चयनित क्लोन तो विस्तार और आगे दक्षिणी दाग और पीसीआर और अनुक्रमण द्वारा सही लक्ष्यीकरण के लिए विश्लेषण किया गया । दक्षिणी ब्लाट एक रिपोर्टर विशेष जांच और रिपोर्टर के बाहर जीनोमिक लोकस बाध्यकारी के लिए एक विशिष्ट जांच का उपयोग कर प्रदर्शन किया था, लेकिन नहीं लक्ष्यीकरण वेक्टर के समरूपता हथियारों के भीतर । दिलचस्प है, सभी क्लोन है कि दक्षिणी ब्लाट द्वारा परीक्षण किया गया पीसीआर पहले से जांच में सकारात्मक थे, लेकिन केवल एक भाग दक्षिणी दाग विश्लेषण में सही बैंड आकार दिखाया और heterozygously था रिपोर्टर एकीकृत (चित्रा 4b) । इसलिए यह केवल जांच पीसीआर परिणामों पर भरोसा नहीं है, लेकिन यह भी दक्षिणी सोख्ता द्वारा सही लक्ष्यीकरण सत्यापित करने के लिए आवश्यक है । डीएनए अनुक्रम स्तर पर सही लक्ष्यीकरण की पुष्टि करने के लिए, एकीकरण जंक्शनों पीसीआर द्वारा परिलक्षित किया गया था और उत्पादों के लिए सैंज अनुक्रमण (चित्रा 4a) के अधीन थे. विशेष रूप से, लक्ष्य साइट मुताबिक़ एलील, जहां रिपोर्टर एकीकृत नहीं किया था के अनुक्रमण, Cas9 मध्यस्थता परिवर्तन का पता चला. चित्रा 4aमें, एक Cas9-मध्यस्थता हटाने के लिए उदाहरण दिखाया गया है. Cas9-मध्यस्थता बंद-लक्ष्य प्रभावों के लिए परीक्षण करने के लिए, अनुभाग ३.५ में वर्णित के रूप में उच्चतम-स्थान ऑफ़-टारगेट साइट्स की एक सूची जनरेट की गई थी । दस सर्वोच्च रैंक-लक्ष्य साइटों पीसीआर-क्लोन के जीनोमिक डीएनए से परिवर्धित थे, और उत्पादों के लिए गाया sequencing के अधीन । लक्षित एकल सेल क्लोन में हम उत्पंन, Jurkat जंगली प्रकार के दृश्यों से कोई बदलाव नहीं दस सर्वोच्च पर मनाया गया-लक्ष्य साइटों के स्थान पर रहीं ।

Figure 3
चित्र 3: लक्ष्यीकरण ईवेंट्स के लिए एकल-कक्ष क्लोनों की स्क्रीनिंग. () मिश्रित लक्षित सेल जनसंख्या में पीसीआर द्वारा लक्ष्यीकरण घटनाओं का पता लगाने के लिए प्राइमर डिजाइन की योजनाबद्ध । ' 5 एकीकरण जंक्शन का पता लगाने के लिए प्राइमर जोड़े (P1, P2) और 3 ' एकीकरण जंक्शन (p, पी 4) तीर के रूप में संकेत दिया जाता है । प्राइमर P1 और पी 4 भी एलील रिपोर्टर integrant के बिना लक्षित लोकस बढ़ाना की सेवा () मिश्रित लक्षित सेल जनसंख्या के जीनोमिक डीएनए 10 दिन FACS कोशिकाओं के transfected संवर्धन के बाद तैयार किया गया था और 5 ' एकीकरण जंक्शन के लिए विश्लेषण (P1, P2 ), 3 ' एकता जंक्शन (पी 1, 4; डेटा नहीं दिखाया गया है) और लक्षित लोकस (P1, पी 4) के जंगली-प्रकार एलील । वंय-प्रकार Jurkat कोशिकाओं (wt) नियंत्रण के रूप में कार्य किया । () ९६ में एकल सेल क्लोनों की पहली स्क्रीन-अच्छी तरह से प्लेटें । ९६-एकल सेल क्लोन के साथ अच्छी तरह से प्लेटों के लिए प्रवाह cytometry द्वारा सही लक्ष्यीकरण के लिए जांच की गई पमा-िोनो प्रेरण और पीसीआर विश्लेषण के बाद । उदाहरण के क्लोन के लिए परिणाम दिखाए जाते हैं । पीसीआर ने रिपोर्टर-विशिष्ट प्राइमरी (स्क्रीनिंग पीसीआर के साथ सेल lysates पर प्रदर्शन किया था; P5, P6) और प्राइमर एक जीनोमिक लोकस (नियंत्रण पीसीआर, यहां बढ़ाना: NUP188 लोकस; P7, P8) । सेल lysates जंगली प्रकार Jurkat कोशिकाओं (wt) और जीनोमिक डीएनए से HIVisB2 क्लोन (B2)18 वाणिज्यिक उपलब्ध किट के साथ तैयार की स्क्रीनिंग पीसीआर और नियंत्रण पीसीआर के लिए सकारात्मक नियंत्रण के लिए एक नकारात्मक नियंत्रण के रूप में कार्य किया, क्रमशः । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 4
चित्रा 4: सही रिपोर्टर एकीकरण के लिए चयनित एकल सेल क्लोन का विश्लेषण । () एलील पर बिना रिपोर्टर integrant के एकीकरण जंक्शनों का अनुक्रम विश्लेषण और लक्षित लोकस. ' 5 एकीकरण जंक्शन का पता लगाने के लिए प्राइमरी जोड़े (p1, P2), 3 ' एकीकरण जंक्शन (पी 4, p) और रिपोर्टर integrant (p1, पी 4) के बिना एलील के लक्षित लोकस का इस्तेमाल किया गया । पीसीआर उत्पादों एकल सेल क्लोन के जीनोमिक डीएनए से परिलक्षित और सैंज अनुक्रमण के अधीन थे । sequencing परिणाम अपेक्षित अनुक्रम के लिए संरेखित थे । दिखाया एक क्लोन के उदाहरण डेटा हैं । जीनोम/हा जंक्शन से अनुक्रम chromatograms और हा/रिपोर्टर जंक्शन दोनों 5 ' और 3 ' एकीकरण जंक्शन के लिए दिखाए जाते हैं । मैच डॉट्स के रूप में संकेत कर रहे हैं । gRNA के बंधन साइट एक बॉक्स के साथ चिह्नित है । Cas9-प्रेरित उत्परिवर्तनों लाल रंग में प्रकाश डाला जाता है । प्राइमर डिजाइन के योजनाबद्ध नीचे दिखाया गया है । तीर प्राइमर पदों प्रवर्धन के लिए इस्तेमाल किया संकेत मिलता है । () चयनित लक्षित एकल सेल क्लोन और Jurkat जंगली प्रकार की कोशिकाओं के दक्षिणी दाग विश्लेषण । दक्षिणी ब्लाट विश्लेषण जीनोमिक डीएनए पर एक रिपोर्टर विशेष जांच और दोनों को लक्षित और जंगली प्रकार एलील (जीनोमिक जांच) में एक जीनोमिक अनुक्रम पहचानने की जांच के साथ किया गया । 7 उदाहरण क्लोन का डेटा दिखाया गया है । सही बैंड आकार के साथ क्लोन बक्से के साथ चिह्नित कर रहे हैं । पतला लक्ष्य वेक्टर प्लाज्मिड सकारात्मक नियंत्रण के रूप में कार्य किया (+) । दक्षिणी दाग विश्लेषण के लिए योजनाबद्ध नीचे दिखाया गया है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

अभिकर्मक प्रति प्रतिक्रिया जोड़ें
फॉरवर्ड प्राइमर (20 µ मीटर) 1 µ l
रिवर्स प्राइमर (20 µ एम) 1 µ l
10x Taq बफर 5 µ l
1 µ l dNTPs (२.५ मिमी प्रत्येक) 1 µ l
MgCl (५० मिमी) 1 µ l
DMSO १.५ µ l
gDNA (५०-१०० एनजी/µ एल) 2 µ l
Nuclease-मुफ्त पानी ४९.५ तक भरें µ l
Taq डीएनए पोलीमरेज़ (5 यू एमएल/ ०.५ µ l
प्रतिक्रिया मात्रा ५० µ l

तालिका 1: पीसीआर के लिए नुस्खा ठीक गतिविधि के साथ एक पोलीमरेज़ का उपयोग कर । प्रति पीसीआर रिएक्शन जोड़ी जाने वाली प्रत्येक रिएजेंट की राशि दर्शाई गई है । पीसीआर टेंपलेट के रूप में जीनोमिक डीएनए का उपयोग प्रवर्धन के लिए करना है । नुस्खा कदम 1.2.2.2 में प्रयोग किया जाता है (समरूपता हथियारों के प्रवर्धन), कदम 3.3.3 (एकीकरण स्थलों का सत्यापन), कदम 3.4.1.5 (दक्षिणी दाग के लिए जीनोमिक जांच की पीढ़ी), और कदम 3.5.4 (ऑफ लक्ष्य घटनाओं का विश्लेषण) ।

चरणों तापमान समय चक्र
प्रारंभिक विकार ९५ ° c 2 min 1
विकार ९५ ° c ४० s 30 -35
एनीलिंग ५८ ° c ४५ s
एक्सटेंशन ७२ ° c 1 min/kb
अंतिम विस्तार ७२ ° c 10 min 1

तालिका 2: पीसीआर के लिए साइकलिंग शर्तें गतिविधि को ठीक करने के साथ एक पोलीमरेज़ का उपयोग करना । सायक्लिंग शर्तों पीसीआर 1 तालिकामें सूचीबद्ध नुस्खा के अनुरूप हैं ।

अभिकर्मक प्रति प्रतिक्रिया जोड़ें
फॉरवर्ड प्राइमर (20 µ मीटर) 1 µ l
रिवर्स प्राइमर (20 µ एम) 1 µ l
5x उच्च निष्ठा बफर 5 µ l
1 µ l dNTPs (२.५ मिमी प्रत्येक) 1 µ l
gDNA (50 – 100 एनजी/µ एल) या प्लाज्मिड डीएनए (५० एनजी/µ एल) 2 µ l gDNA या
1 µ l प्लाज्मिड डीएनए
Nuclease-मुफ्त पानी ४९.५ तक भरें µ l
उच्च निष्ठा डीएनए पोलीमरेज़ ०.५ µ l
प्रतिक्रिया मात्रा ५० µ l

तालिका 3: पीसीआर के लिए नुस्खा एक उच्च निष्ठा पोलीमरेज़ का उपयोग कर । प्रति पीसीआर रिएक्शन जोड़ी जाने वाली प्रत्येक रिएजेंट की राशि दर्शाई गई है । पीसीआर डीएनए के मजबूत प्रवर्धन के लिए करना है टेंपलेट्स । नुस्खा कदम 2.4.2 में प्रयोग किया जाता है (लक्ष्यीकरण घटनाओं का पता लगाने) और कदम 3.4.1.4 (दक्षिणी दाग के लिए रिपोर्टर विशेष जांच की पीढ़ी) ।

चरणों तापमान समय चक्र
प्रारंभिक विकार ९८ ° c 30 एस 1
विकार ९८ ° c 10 एस 30-35
एनीलिंग ५८ ° c 30 एस
एक्सटेंशन ७२ ° c 30 एस केबी/
अंतिम विस्तार ७२ ° c 10 min 1

तालिका 4: पीसीआर के लिए सायक्लिंग शर्तों एक उच्च निष्ठा पोलीमरेज़ का उपयोग कर । सायक्लिंग शर्तों पीसीआर 3 तालिकामें सूचीबद्ध नुस्खा के अनुरूप हैं ।

प्राइमर अनुक्रम (5 ' – 3 ')
P7 कंट्रोल पीसीआर एफ CTTTGTTGGGTAAGCATGGAGGTC
P8 कंट्रोल पीसीआर आर CAGTTACTCACCTTTGCACATAGG

तालिका 5: नियंत्रण पीसीआर के लिए Oligonucleotide अनुक्रम। आगे और रिवर्स प्राइमरों के प्रवर्धन के लिए एक ६३० NUP188 लोकस के बीपी टुकड़ा संकेत कर रहे हैं ।

अभिकर्मक प्रति प्रतिक्रिया जोड़ें
रेडी-टू-फीमेल पीसीआर मास्टर मिक्स 8 µ l
फॉरवर्ड प्राइमर (20 µ मीटर) 1 µ l
रिवर्स प्राइमर (20 µ एम) 1 µ l
Nuclease-मुफ्त पानी 8 µ l
सेल lysate (1:12 कमजोर पड़ने) 2 µ l
कुल प्रतिक्रिया की मात्रा 20 µ l

तालिका 6: स्क्रीनिंग के लिए नुस्खा-पीसीआर । प्रति पीसीआर रिएक्शन जोड़ी जाने वाली प्रत्येक रिएजेंट की राशि दर्शाई गई है । पीसीआर नुस्खा चरण 3.2.11 में पीसीआर स्क्रीनिंग के लिए करना है ।

चरणों तापमान समय चक्र
प्री-पीसीआर विकार ९४ ° c 2 min 1
एनीलिंग ५८ ° c 1 min
एक्सटेंशन ७२ ° c 1 min
विकार ९४ ° c 30 एस ३८
एनीलिंग ५८ ° c 30 एस
एक्सटेंशन ७२ ° c 1 min
अंतिम विस्तार ७२ ° c 10 min 1

तालिका 7: स्क्रीनिंग के लिए सायक्लिंग शर्तें-पीसीआर । साइकल चलाना शर्तों 6 तालिका में सूचीबद्ध पीसीआर नुस्खा के अनुरूप है ।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

यहां, हम एक प्रोटोकॉल का वर्णन करने के लिए एचआईवी उत्पंन-1-चुना वायरल एकीकरण CRISPR लागू करने साइटों-Cas9 आधारित जीनोम इंजीनियरिंग के साथ Jurkat रिपोर्टर मॉडल व्युत्पंन ।

प्रोटोकॉल के कई बिंदुओं की योजना बना चरण के दौरान सावधान ध्यान देने की आवश्यकता है । पहले, लोकस को लक्षित किया जाना चाहिए ध्यान से चुना जाना चाहिए, के रूप में कुछ loci आसान हो सकता है दूसरों की तुलना में लक्ष्य (जैसे, क्षेत्र और लक्ष्य अनुक्रम ही क्रोमेटिन स्थिति पर निर्भर करता है) । दोहराव अनुक्रम लक्ष्यीकरण वेक्टर में क्लोन करने के लिए कठिन है और जीनोम के भीतर अक्सर अद्वितीय नहीं हैं । दमित क्रोमेटिन के क्षेत्र CRISPR-Cas9 प्रणाली19,20के साथ लक्षित करने के लिए कठिन हैं ।

दूसरा, gRNA की पसंद CRISPR-Cas9-मध्यस्थता लक्ष्यीकरण के लिए महत्वपूर्ण है । प्रतिनिधि एकीकरण साइटों के साथ एचआईवी संक्रमण के लिए मॉडल पैदा करने के प्रयोजन के लिए, एक gRNA एक एकीकरण हॉटस्पॉट के लिए संभव के रूप में बंद के रूप में बाइंड करने के लिए चाहते हैं । हालांकि, इस साइट Cas9 भर्ती के लिए आदर्श नहीं हो सकता है; इसलिए, एक समझौता gRNA अनुक्रम की निकटता के बीच पसंद और gRNA गुणवत्ता के एकीकरण साइट के लिए किया जाना चाहिए । हम कार्यात्मक gRNAs की भविष्यवाणी में ई कुरकुरा webtool विश्वसनीय मिल गया है । यह भी एक gRNA से बाहर ले जाने के लिए संभव है क्षणिक एक साथ कई gRNAs व्यक्त द्वारा सेल प्रकार में Cas9 के साथ, लक्षित किया जा करने के लिए, उत्परिवर्तनों के लिए एक स्क्रीनिंग के बाद । एक उपयुक्त gRNA लक्ष्य साइट और gRNA पूरक साइट के लिए कुशलतापूर्वक Cas9 प्रत्यक्ष होगा उत्परिवर्तनों दिखाएगा । की लंबाई है (१,००० बीपी ऊपर और एकीकरण साइट के बहाव) पहले प्रकाशित अध्ययन11के अनुसार चुना गया था । आम तौर पर, समरूपता हथियारों की लंबाई कम लक्ष्यीकरण आवृत्ति में परिणाम होगा । समरूपता बांह की १,००० बीपी की लंबाई पर्याप्त लक्ष्यीकरण आवृत्ति और लक्ष्य वेक्टर निर्माण में आसानी के बीच एक अच्छा समझौता प्रस्तुत करता है ।

तीसरा, पर्याप्त समय रिपोर्टर के एक अच्छे डिजाइन पर खर्च किया जाना चाहिए का निर्माण । इस प्रोटोकॉल है, जो एक एचआईवी-1 NL4-3 प्राप्त लीटर और एक tdTomato कोडन अनुक्रम, निंनलिखित सिद्धांत के आधार पर डिजाइन किया गया है में इस्तेमाल किया ंयूनतम रिपोर्टर: एकल लटर्स क्लोनल के कई मामलों में केवल शेष वायरल टुकड़े के रूप में वर्णित किया गया है जीर्ण एचआईवी में विस्तार-1-संक्रमित व्यक्तियों21। यह आशा की जाती है कि बाएं से दाएं क्रोमेटिन स्थिति को एकीकरण स्थलों पर प्रभावित करता है और सेलुलर परिसरों की भर्ती का आयोजन करती है । हम एक ंयूनतम एचआईवी मुख्य विनियामक आनुवंशिक तत्व के रूप में लीटर पर ध्यान देने वाले एचआईवी रिपोर्टर चुना है, तो आगे एचआईवी के बजाय एक फ्लोरोसेंट लीटर गतिविधि मार्कर के रूप में शुरू tdTomato-1 जीन, जीनोम इंजीनियरिंग आवृत्ति के रूप में सूचित किया गया था छोटे के साथ उच्च लक्ष्यीकरण सम्मिलित करता है11. समय-टीवी क्लोनिंग, क्लोनी चयन, स्क्रीनिंग, और क्लोन के सत्यापन के कदम उठाने पर विचार, यह ध्यान से कार्यात्मक अध्ययन के संदर्भ में एचआईवी रिपोर्टर के डिजाइन पर विचार करने की सलाह दी है कि अंततः लक्षित पर किया जाएगा कक्ष पंक्तियां । एक उदाहरण के लिए, झूठ नेता अनुक्रम के शामिल किए जाने पर विचार, 3 ' एचआईवी लीटर, और/या अंय रिपोर्टर में वायरल जीन अनुक्रम । प्रोटोकॉल आसानी से ऐसे अलग रिपोर्टर के निर्माण के लिए अनुकूलित किया जा सकता है ।

आम तौर पर, यह एक सेल क्लोन पीढ़ी के रूप में लक्षित किया जा करने के लिए सेल प्रकार के विकल्प पर विचार महत्वपूर्ण है कुछ सेल लाइनों के साथ मुश्किल हो सकता है । हमने पाया है कि Jurkat कोशिकाओं को एक क्लोन पीढ़ी में बहुत कुशल नहीं हैं; हालांकि, हम अव्यक्त एचआईवी संक्रमण मॉडल9में इसके पहले ज्ञात उपयोग के लिए इस सेल प्रकार का चयन करने का फैसला किया । हम ५०% वातानुकूलित माध्यम है, जब प्लेटें एक मशीन है कि कोई अधिक से अधिक 3 बार एक सप्ताह खोला गया था में परेशान छोड़ दिया गया था के साथ Jurkat क्लोनिंग कमजोर पड़ने चढ़ाना में सबसे अच्छा परिणाम प्राप्त की । यदि एक अलग सेल लाइन का उपयोग कर वांछित है, यह एक कमजोर पड़ने चढ़ाना प्रयोग बाहर ले जाकर एकल सेल क्लोन पैदा करने की संभावना पूर्व परीक्षण की सलाह दी है । एक और बात को ध्यान में रखने के विभिंन सेल लाइनों के अभिकर्मक दरों की भिंनता है । यदि अभिकर्मक चुनी गई कक्ष पंक्ति के लिए व्यवहार्य नहीं है, तो electroporating लक्ष्यीकरण के लिए कक्ष आवश्यक हो सकते हैं. ध्यान रखें कि लक्ष्यीकरण के लिए उपयोग की जाने वाली सेल लाइन का चुनाव केवल तकनीकी पहलुओं द्वारा निर्धारित नहीं किया जा सकता, जैसे अभिकर्मक या एकल क्लोन पीढ़ी के लिए दक्षता. कार्यात्मक पहलुओं पर भी विचार किया जा सकता है, जैसे transcriptional गतिविधि या लक्षित जीन लोकस के inducibility. इसके लिए लक्ष्यीकरण वर्कफ़्लो से पहले विभिंन कक्ष पंक्तियों की स्क्रीनिंग की आवश्यकता हो सकती है ।

इस बात पर जोर दिया जाना चाहिए कि वर्णित प्रोटोकॉल का समय सघन हो. यह उंमीद की जानी चाहिए 3 से 6 महीने पहले कदम से अंतिम क्लोनिंग सेल लाइनों के लिए ले । दक्षिणी दाग विश्लेषण, जो साइट के लिए जांच विशिष्ट एकल एकीकरण की घटनाओं के लिए इस्तेमाल किया जाता है, बोझिल लग सकता है, लेकिन हमारे अनुभव में यह बेहद महत्वपूर्ण है-केवल एकल सेल क्लोन कि पीसीआर के प्रति अपेक्षित एकीकरण जंक्शनों दिखाया का एक सबसेट के रूप में दिखाया एक दक्षिणी दाग में सही स्वरूप । आदर्श रूप में, प्रयोगकर्ता एक ही एकीकरण साइट के लिए लक्षित किसी भी बाद के प्रयोगों में क्लोनिंग प्रभाव है कि क्लोन का उपयोग करने के लिए नियंत्रित करने के लिए एक ही डालने के साथ क्लोन के एक नंबर उत्पंन करना चाहिए । heterozygous के साथ-साथ homozygous टार्गेटिंग करना संभव है । heterozygous रिपोर्टर सेल लाइंस में, एक integrant के बिना एलील को Cas9 लक्ष्यीकरण साइट पर संशोधन दिखाने की संभावना है, जो पीसीआर (चित्रा 4a) द्वारा जांच की जा सकती है । homozygous लक्ष्यीकरण के लिए, हमारा सुझाव है कि दोनों alleles को लगातार निशाना बनाया जाए.

खाते में इन बातों को ध्यान में रखते हुए, इस कार्यप्रवाह एक शक्तिशाली सेलुलर मॉडल है कि पुराने एचआईवी संक्रमण की समझ बढ़ाने के लिए इस्तेमाल किया जा सकता उत्पंन करने का साधन प्रदान करता है । उदाहरण के लिए, लेटेंसी-पलटना एजेंट्स के प्रत्युत्तर में वायरल गतिविधि आवर्तक एकीकरण साइट्स के संदर्भ में परीक्षण किया जा सकता है । इस क्षेत्र में शोधकर्ताओं के लिए विशेष रूप से ब्याज की हो सकती है, के बाद से स्थिति प्रभाव एचआईवी विलंबता और उलटा22प्रभाव माने गया है ।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों का खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

हम तकनीकी सहायता के लिए Britta Weseloh और Bettina हाबिल धंयवाद । हम तकनीकी सहायता के लिए आऩने Düsedau और जना Hennesen (फ्लो cytometry टेक्नोलॉजी प्लेटफार्म, हेनरिक पेटते Institut) का भी धन्यवाद करते हैं ।

Materials

Name Company Catalog Number Comments
pX330-U6-Chimeric_BB-cBh-hSpCas9 Addgene 42230 vector for expression of SpCas9 and gRNA
pMK GeneArt mammalian expression vector for cloning
cDNA3.1 Invitrogen V79020 mammalian expression vector for cloning
BbsI New England Biolabs R0539S restriction enzyme
NEBuilder Hifi DNA Assembly Cloning Kit New England Biolabs E5520S Assembly cloning kit used for target vector generation
TaqPlus Precision PCR System Agilent Technologies 600210 DNA polymerase with proofreading activity used for amplification of homology arms (step 1.2.2.2), verification of integration site and reporter sequence (step 3.3.3 and 3.3.5), generation of genomic probe for Southern blot (step 3.4.1.5) and analysis of off-target events (step 3.5.4)
96-well tissue culture plate (round-bottom) TPP 92097 tissue culture plates for dilution plating
Phusion High-Fidelity DNA polymerase New England Biolabs M0530 L DNA polymerase used for detection of targeting events (step 2.4.2) and generation ofreporter-specific probe for Southern blot (step 3.4.1.4)
Dimethyl sulfoxide (DMSO) Sigma-Aldrich D9170 dimethyl sulfoxide as PCR additive
Magnesium Chloride (MgCl2) Solution New England Biolabs B9021S MgCl2 solution as PCR additive
Deoxynucleotide (dNTP) Solution Mix New England Biolabs N0447S dNTP mixture with 10 mM of each nt for PCR reactions
5PRIME HotMasterMix 5PRIME 2200400 ready-to-use PCR mix used for screening PCR (step 3.2.11)
QIAamp DNA blood mini kit Qiagen 51106 DNA isolation and purification kit
QIAquick PCR Purification Kit Qiagen 28106 PCR Purification Kit
RPMI 1640 without glutamine Lonza BE12-167F cell culture medium
Fetal Bovine Serum South Africa Charge PAN Biotech P123002 cell culture medium supplement
L-glutamine Biochrom K 0282 cell culture medium supplement
Penicillin/Streptomycin 10.000 U/mL/ 10.000 µg/mL Biochrom A 2212 cell culture medium supplement
Gibco Opti-MEM Reduced Serum Media Thermo Fisher Scientific 31985062 cell culture medium with reduced serum concentration optimized for transfection
TransIT-Jurkat Mirus Bio MIR2125 transfection reagent
phorbol 12-myristate 13-acetate Sigma-Aldrich P8139-1MG cell culture reagent
Ionomycin Sigma-Aldrich I0634-1MG cell culture reagent
Syringe-driven filter unit, PES membrane, 0,22 µm Millex SLGP033RB filter unit for sterile filtration
Heracell 150i incubator Thermo Fisher Scientific 51026280 tissue culture incubator
Amershan Hybond-N+ GE Healthcare RPN1520B positively charged nylon membrane for DNA and RNA blotting
Stratalinker 1800 Stratagene 400072 UV crosslinker
High Prime Roche 11585592001 kit for labeling of DNA with radioactive dCTP using random oligonucleotides as primers
illustra ProbeQuant G-50 Micro Columns GE Healthcare 28-9034-08 chromatography spin-columns for purification of labeled DNA

DOWNLOAD MATERIALS LIST

References

  1. Hughes, S. H., Coffin, J. M. What Integration Sites Tell Us about HIV Persistence. Cell Host and Microbe. 19, (5), 588-598 (2016).
  2. Marini, B., Kertesz-Farkas, A., et al. Nuclear architecture dictates HIV-1 integration site selection. Nature. 521, (7551), 227-231 (2015).
  3. Cesana, D., Santoni de Sio, F. R., et al. HIV-1-mediated insertional activation of STAT5B and BACH2 trigger viral reservoir in T regulatory cells. Nature Communications. 8, (1), 498 (2017).
  4. Cohn, L. B., Silva, I. T., et al. HIV-1 Integration Landscape during Latent and Active Infection. Cell. 160, (3), 420-432 (2015).
  5. Han, Y., Lassen, K., et al. Resting CD4+ T cells from human immunodeficiency virus type 1 (HIV-1)-infected individuals carry integrated HIV-1 genomes within actively transcribed host genes. Journal of Virology. 78, (12), 6122-6133 (2004).
  6. Ikeda, T., Shibata, J., Yoshimura, K., Koito, A., Matsushita, S. Recurrent HIV-1 integration at the BACH2 locus in resting CD4+ T cell populations during effective highly active antiretroviral therapy. The Journal of Infectious Diseases. 195, (5), 716-725 (2007).
  7. Wagner, T. A., Mclaughlin, S., et al. Proliferation of cells with HIV integrated into cancer genes contributes to persistent infection. Science. 345, (6196), 570-573 (2014).
  8. Maldarelli, F., Wu, X., et al. Specific HIV integration sites are linked to clonal expansion and persistence of infected cells. Science. 345, (6193), 179-183 (2014).
  9. Jordan, A., Bisgrove, D., Verdin, E. HIV reproducibly establishes a latent infection after acute infection of T cells in vitro. The EMBO Journal. 22, (8), 1868-1877 (2003).
  10. Mack, K. D., Jin, X., et al. HIV insertions within and proximal to host cell genes are a common finding in tissues containing high levels of HIV DNA and macrophage-associated p24 antigen expression. Journal of Acquired Immune Deficiency Syndromes. 33, (3), 308-320 (2003).
  11. Byrne, S. M., Ortiz, L., Mali, P., Aach, J., Church, G. M. Multi-kilobase homozygous targeted gene replacement in human induced pluripotent stem cells. Nucleic Acids Research. 43, (3), 1-12 (2014).
  12. ZhangLab. CRISPR Genome Engineering Toolbox: Target Sequence Cloning Protocol. Addgene website. Available from: https://www.addgene.org/static/cms/filer_public/e6/5a/e65a9ef8-c8ac-4f88-98da-3b7d7960394c/zhang-lab-general-cloning-protocol.pdf (2013).
  13. Moser, F. Addgene. Gibson Assembly Protocol. Addgene website. Available from: https://www.addgene.org/protocols/gibson-assembly/ (2009).
  14. Addgene Plasmid Cloning by PCR. Addgene website. Available from: https://www.addgene.org/protocols/pcr-cloning/ (2014).
  15. Addgene Plasmid Cloning by Restriction Enzyme Digest (aka Subcloning). Addgene website. Available from: https://www.addgene.org/protocols/subcloning/ (2013).
  16. Stemmer, M., Thumberger, T., Del Sol Keyer, M., Wittbrodt, J., Mateo, J. L. CCTop: An intuitive, flexible and reliable CRISPR-Cas9 target prediction tool. Public Library of Science (PLoS) ONE. 10, (4), (2015).
  17. Lange, U. C., Bialek, J. K., Walther, T., Hauber, J. Pinpointing recurrent proviral integration sites in new models for latent HIV-1 infection. Virus Research. 249, (2018).
  18. Bialek, J. K., Dunay, G. A., et al. Targeted HIV-1 Latency Reversal Using CRISPR-Cas9-Derived Transcriptional Activator Systems. PloS ONE. 11, (6), e0158294 (2016).
  19. Lee, C. M., Davis, T. H., Bao, G. Examination of CRISPR-Cas9 design tools and the effect of target site accessibility on Cas9 activity. Experimental Physiology. 103, (4), 456-460 (2018).
  20. Jensen, K. T., Fløe, L., et al. Chromatin accessibility and guide sequence secondary structure affect CRISPR-Cas9 gene editing efficiency. FEBS Letters. 591, (13), 1892-1901 (2017).
  21. Simonetti, F. R., Sobolewski, M. D., et al. Clonally expanded CD4 + T cells can produce infectious HIV-1 in vivo. Proceedings of the National Academy of Sciences. 113, (7), 1883-1888 (2016).
  22. Chen, H. C., Martinez, J. P., Zorita, E., Meyerhans, A., Filion, G. J. Position effects influence HIV latency reversal. Nature Structural and Molecular Biology. 24, (1), 47-54 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics