CRISPR-Cas9-baseret genom Engineering til at generere Jurkat Reporter modeller for HIV-1 infektion med udvalgte Proviral Integration websteder

* These authors contributed equally
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Vi præsenterer en genom engineering arbejdsgang for generation af nye in vitro-modeller for HIV-1 infektion, at sammenfatte proviral integration på udvalgte genomisk lokaliteter. Målretning af HIV-Afledte reportere lettes ved CRISPR-Cas9-medieret, lokationsspecifikke genom manipulation. Der findes detaljerede protokoller for encellede klon generation, screening og korrekte målretning verifikation.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Bialek, J. K., Walther, T., Hauber, J., Lange, U. C. CRISPR-Cas9-based Genome Engineering to Generate Jurkat Reporter Models for HIV-1 Infection with Selected Proviral Integration Sites. J. Vis. Exp. (141), e58572, doi:10.3791/58572 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Human immundefekt virus (HIV) integrerer sin proviral DNA ikke tilfældigt i vært celle genom på tilbagevendende sites og genomisk hotspots. Her præsenterer vi en detaljeret protokol for generation af nye in vitro-modeller for HIV-smitte med valgte genomisk integration websteder ved hjælp af CRISPR-Cas9-baseret genom engineering technology. Med denne metode, kan en reporter sekvens af valget integreres i en målrettet, valgte genomisk locus, reflekterende klinisk relevante integration websteder.

I protokollen, er design af en HIV-afledte reporter og valg af en destination site og gRNA sekvens beskrevet. En målretning vektor med homologi våben er bygget og transfekteret i Jurkat T-celler. Reporter sekvens er målrettet til den valgte genomisk site af homologe rekombination lettes ved en Cas9-medieret dobbelt-strenget pause på destinationsstedet. Encellede kloner er genereret og screenes for målretning begivenheder ved flowcytometri og PCR. Udvalgte kloner er derefter udvidet, og korrekte målretning bekræftes ved PCR, sekventering og sydlige blotting. Potentielle off target begivenhederne i CRISPR-Cas9-medieret genom engineering er analyseret.

Denne model hivinfektion på klinisk relevante integration websteder kan genereres ved hjælp af denne protokol, Roman celle kultur systemer. Selv om generation af encellede kloner og verifikation af korrekte reporter sekvens integration er tidskrævende, er de resulterende klonede linjer kraftfulde værktøjer til funktionelt analysere proviral integration site valg.

Introduction

Integration af proviral DNA i vært genom ved infektion er et kritisk skridt i livscyklus af human immundefekt virus (HIV). Efter integrationen fortsætter HIV ved at etablere ventetid i langlivede CD4 + T celle subsets som memory CD4 + T-celler. HIV integration synes at være ikke-tilfældige1,2. En række af genomisk hotspots med jævne integreret proviral DNA er blevet påvist i flere undersøgelser gennem sekventering af integration websteder i akut og kronisk smittede personer2,3,4 ,5,6,7,8. Interessant, på nogle af disse websteder, integration, blev den samme locus fundet i en stor del af inficerede celler, fører til tanken om, at integration på tilbagevendende steder positivt kan påvirke klonal ekspansion1.

For at fremme vores forståelse af betydningen af tilbagevendende integration websteder, skal proviral integration site valg udforskes. Dog flere tekniske aspekter hæmme studere HIV integration site valg og konsekvenserne. Generelt anvendes celle kultur modeller for HIV latency gerne JLat cellelinjer ikke afspejler klinisk relevante tilbagevendende integration websteder9. Undersøgelser på primære patient-afledte celler, på den ene side aktiverer beskrivelse af integration site landskab af sekventering men tillader ikke for funktionelle analyser. Til vores viden er ingen passende eksperimentel model tilgængelig for funktionelt analysere udvalgte klinisk relevante integration lokaliteter.

Her præsenterer vi en detaljeret arbejdsproces for at generere nye modeller for HIV-smitte ved hjælp af CRISPR-Cas9-baseret genom engineering technology. Arbejdsprocessen beskrevet heri kan bruges til at generere T-celle-afledte reporter cellelinjer, der model hivinfektion, transporterer gentisk integreret proviral reporter på en valgte integration site. De dermed tjener som nye værktøjer til at undersøge hvordan webstedet proviral integration kan påvirke HIV biologi og hvordan provirus reagerer på forskellige behandling strategier (f.eks., inducibility af latency baglænskørsel agenter). Vores metode bruger fordelene ved CRISPR-Cas9-baseret genom engineering, som integrationen af journalisten sekvens af homologe rekombination lettes ved en Cas9 nukleasen-induceret dobbelt-strenget pause på destinationsstedet. Målwebsteder for integration er udvalgt efter nærhed til de beskrevne tilbagevendende integration websteder fra undersøgelser af HIV-smittede individer og tilstedeværelsen af egnet PAM motiver for Cas9-medieret genom engineering.

I vores eksemplarisk resultater, har vi fokuseret på BACH2 gen locus, som koder for BTB og CNC homologi transcriptional regulator 2. I kronisk HIV-smittede personer på antiretroviral behandling er BACH2 en af de loci viser berigelse af integrerede HIV-1 sekvenser3,6,7,8,10. Vi har valgt en minimal HIV-afledte reporter bestående af HIV-1-afledt lange terminal Gentag (LTR), tdTomato kodende sekvens og kvæg væksthormon (BGH) polyadenylation signal (PA), som vi har rettet mod to specifikke websteder i BACH2 intron 5. Præsenteres protokollen er optimeret til Jurkat celler, en menneskelig CD4 + T-celle-afledte suspension cellelinie, men andre celle linjer kan bruges og protokollen tilpasset i overensstemmelse hermed. Vi præsenterer en detaljeret arbejdsproces for udvælgelse af mål-webstedet, opførelsen af target vektor med homologi arme, CRISPR-Cas9-medieret målretning af reporter i den valgte genomisk site, generation og udvælgelse af klonede linjer, og omfattende kontrol af nyligt genererede, målrettet reporter cellelinjer.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. målretning strategi for genom Engineering og målretning vektor (tv) Design

Bemærk: Det første trin i genom engineering involverer udvælgelse og generation de nødvendige værktøjer for CRISPR-Cas9-medieret målretning. Valg af en genomisk integration site locus, valg af celletype for målretning og design af en HIV-afledte reporter for integration bør gå forud for dette trin. Denne protokol beskriver målretning af en HIV-LTR_tdTomato_BGH-PA minimal reporter i Jurkat target-cellerne. Et flowdiagram for CRISPR-Cas9-baseret målretning, generation, screening og kontrol af klonede linjer arbejdsgang er afbildet i figur 1. Den beskrevne målretning strategi bruger S. pyogenes Cas9 (SpCas9) til at generere gRNA-instrueret dsDNA pauser på et websted for valgte integration. Journalisten er så målrettet til den valgte genomisk locus gennem homologe rekombination ved at give en ikke-lineariseret målretning vektor (tv) der indeholder reporter flankeret af såkaldte 5' og 3' homologi arme (HA)11.

  1. Valg af målrettede locus, gRNA og målretning vektor design
    1. Vælg thegenomic locus være målrettet baseret på den enkelte videnskabelige spørgsmål. Brug offentliggjorte lister over tilbagevendende integration af HIV fundet i patienter i forskellige undersøgelser2,3,4,5,6,7,8 som en retningslinje. I siliciummangan ekstrakt genomisk rækkefølgen af de ønskede genomisk locus at være målrettet (sekvens af komplet gen) eller mindst 5 kb af genomisk sekvens bruger UCSC genom browser (http:// genome.edu.ucsc.edu).
    2. Vælg guide RNA'er (gRNAs) af 20 nt for målretning af den valgte genomisk locus ved hjælp af E-sprød webtool (http://www.e-crisp.org).
      1. Vælg "Homo sapiens GRCh38" som organismen. Input 2.000 bp af genomisk sekvensen der dækker de ønskede genomisk locus har udtrukket i trin 1.1.1.
      2. Starte en gRNA søgning ved hjælp af medium programindstillinger (enhver PAM, enhver 5' base, off-mål tolerere uoverensstemmelser, og introner/CPG øer er udelukket). En liste med mulige gRNA designs vises, ranking fra højeste til lavere scores for specificitet og effektivitet.
      3. Vælg en gRNA, der helst viser en høj score for specificitet og effektivitet og er så tæt som muligt til den ønskede genomisk locus skal målrettes.
        Bemærk: Et kompromis mellem nærhed til den ønskede genomisk locus og design af konkrete og effektive gRNA der skal findes.
    3. Blast valgte gRNA sekvens mod reference genom ved hjælp af NCBI blast browser (https://blast.ncbi.nlm.nih.gov) skal kontrolleres for entydighed af gRNA bindingssted.
      1. Vælg "menneskelige" som genomet. Input gRNA sekvens som forespørgslen sekvens. Vælg "meget lignende sekvenser" (megablast) som programmet. Sikre at gRNA sekvens er unikke. Hvis ikke, valgte en anden gRNA fra trin 1.1.2.3 og blast igen.
    4. Når gRNA sekvens er valgt, skal du vælge i siliciummangan 1.000 bp opstrøms og nedstrøms for gRNA sekvens fra genomisk sekvens udtrukket i trin 1.1.1 som 5' og 3' HA i overensstemmelse hermed.
      Bemærk: GRNAs bør være homologe til valgte genomisk integration site locus og beliggende støder op til en protospacer tilstødende motiv (PAM, fx, NGG for SpCas9) (figur 2a). TV'et indeholder reporter sekvens, der er 5' og 3' flankeret af HAs. Har dækning 1000 bp opstrøms og nedstrøms gRNA sekvens11. Fuld gRNA rækkefølgen bør ikke indgå i HA. En overlapning i op til 5 nt er acceptabel (figur 2a).
  2. Generation af gRNA og målretning vektorer
    Bemærk: For vektor ordninger, se figur 2b.
    1. For at generere en vektor for udtryk for SpCas9 og gRNA, skal du bruge pX330-U6-Chimeric_BB-CVH-hSpCas9 som rygraden som både SpCas9 og den fælles vejledning RNA (sgRNA) kan samtidig udtrykkes. For at klone gRNA sekvens i rygraden, skal du bruge BbsI begrænsning websteder12.
    2. For at generere tv'et, skal du vælge en høj-kopi plasmid som rygrad (f.eks., pMK eller cDNA3.1).
      1. Først, samle reporter (i denne protokol: LTR_tdTomato_BGH-PA) til konstruere rygraden af Gibson forsamling clong13 ved hjælp af en kommerciel forsamling kloning kit, og indføre 5' og 3' flankerende begrænsning websteder (f.eks., 5' PacI og 3' SmaI) for efterfølgende begrænsning fordøjelsen kloning af har.
      2. Forstærke 1000 bp HA fragmenter valgt i trin 1.1.4 fra genomisk DNA (gDNA) af typen celle skal målrettes (i denne protokol: Jurkat celler) ved hjælp af en DNA-polymerase med korrekturlæsning aktivitet (Se tabel 1 og 2 for PCR ingredienser og cykling betingelser). Derefter, indføre reporter flankerende begrænsning websteder på 5' og 3' enderne af hver HA (PacI på 5' HA i begge ender, SmaI på 3' HA i begge ender).
      3. Sekventielt har klon i konstruere rygraden med allerede indhold reporter (genereret i trin 1.2.2.1) softwarebegrænsning enzym kloning14,15. Første, klone i 5' HA bruger PacI begrænsning sites, derefter klon i 3' HA med SmaI begrænsning websteder.
        Bemærk: Hvis tv rygraden indeholder en yderligere fluorescerende reporter, uønskede rygraden integration kan vurderes ved flowcytometri (Se trin 3.2.2 og 3.2.3). Hvis tv rygraden indeholder ingen fluorescerende reporter, rygraden integration skal vurderes ved hjælp af PCR (Se trin 3.2.8).

Figure 1
Figur 1: arbejdsgang for CRISPR-Cas9-medieret målretning, generation, og udvælgelse af klonede reporter linjer med definerede integration websted. (A) generere target vektor og transduce Jurkat T celler med target vektor og Cas9/gRNA udtryk plasmid. (B) Enrich transfekteret celler 72 h post Transfektion af FACS. (C) Lad celler vokse i 10 til 14 dage og bekræfte forekomsten af målretning begivenheder ved PCR og flow flowcytometri. (D) Generer encellede kloner ved at begrænse fortynding og lad kloner vokse til 3 uger. (E) skærm kloner for korrekte målretning af PCR og flow flowcytometri i 96-brønds format. Udvide udvalgte kloner. (F) Kontroller korrekt målretning i udvalgte kloner af sydlige skamplet, PCR, sekventering og analyse af off-target begivenheder i Cas9 liv1975 aktivitet. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: målretning strategi og vektor design. (en) gRNA og valg af homologi våben. 20 nt gRNA er homologe til den valgte genomisk målwebsted og beliggende støder op til en PAM. homologi arme er komplementær til 1.000 bp op- og nedstrøms for gRNA og bør ikke omfatte gRNA sekvens. (b) skemaer af målretning vektor og gRNA/Cas9 vektor. Målretning vektoren består af den valgte reporter sekvens, der er 5' og 3' flankeret af homologi arme. GRNA/Cas9 vektor er baseret på pX330-U6-Chimeric_BB-CVH-hSpCas9 rygrad. (c) skematisk af målretning af homologe rekombination. Target vektor og guideRNA/Cas9 vektor er transfekteret i Jurkat celler. Cas9 formidler en dobbeltstrenget pause på genomisk målwebstedet (angivet af *) og letter homologe rekombination og integration af reporter sekvens i genomisk target locus. Venligst klik her for at se en større version af dette tal.

2. CRISPR-Cas9-baseret målretning af Jurkat celler

  1. Transfektion af Jurkat celler
    1. 24 timer før Transfektion, plade 1.25 x 106 Jurkat T-celler i 2,5 mL af RPMI 1640 suppleret med 10% (v/v) føtalt kalveserum (FCS) og 4 mM L-glutamin [refereret til som "RPMI w.o. antibiotika (AB)"] pr. brønd af et 6-godt celle kultur plade. For en enkelt målretning eksperiment, udarbejder en komplet 6-godt plade (dvs., 6 brønde hver med 2,5 mL cellesuspension).
    2. Den følgende dag, co transfect celler med cirkulær tv og pX330-U6-Chimeric_BB-CVH-hSpCas9/gRNA ved hjælp af en Transfektion reagens specifikt for Jurkat celler.
      1. Tilføje 2 µg af cirkulære tv og 2 µg for pX330-U6-Chimeric_BB-CVH-hSpCas9/gRNA pr. brønd til 250 µL af kommercielle RPMI medium med nedsat serum koncentration optimeret til Transfektion (RPMI med 50% reduktion i serum) i en reaktion tube og bland godt.
      2. Tilføje 12 µL Transfektion reagens langsomt til DNA/medium uden at røre mur af røret og slyng. Lad blandingen inkuberes i 15 min og tilsæt dråbevis til én brønd af celler. Inkuber cellerne ved 37 ° C og 5% CO2.
        Bemærk: Udarbejdelse af Transfektion reaktion kan skaleres. Der kræves ingen medium ændring efter Transfektion.
  2. Berigelse af transfekteret celler ved fluorescens-aktiveret celle sortering (FACS)
    1. 72 h efter Transfektion, pool transfected cellerne, tælle dem, og forberede berigelse af FACS. Indsamle cellerne i en 50 mL konisk slange, centrifuge på 300 x g og stuetemperatur (RT) for 4 min, vaske cellerne en gang i PBS, centrifugeres igen, suspendere pellet i en passende mængde af FACS buffer (PBS suppleret med 1% FCS + 1 mM EDTA) på 1 x 10 7 celler/mL, og endelig overførsel til et FACS rør.
    2. Forbehold FACS cellerne og sortere dem, der udtrykker den fluorescerende reporter på tv (f.eks., tdTomato i denne protokol). Indsamle cellerne i RPMI 1640 suppleret med 10% FCS, 4 mM L-glutamin, og 50 U/mL penicillin og streptomycin (omtales som "RPMI m / AB").
    3. Efter FACS sortering, vaske cellerne en gang ved at tilføje 20 mL af RPMI m / AB til sorterede celler og centrifugeres ved 300 x g i 4 min på RT. Resuspend celle pellet i en passende mængde af RPMI m / AB og plade celler i en godt af en celle kultur plade med den passende mængde efter celle nummer post-FACS.
      Bemærk: Kultur sortere cellerne i en lille mængde (fx, 24-godt), som betydelige niveauer af celledød er blevet observeret i den første uge efter målretning (op til 80-90%).
    4. Udvide befolkningens blandet målrettede celle op til en tæthed af 1 x 106 celler/mL i en 75 cm² celle kultur kolbe. Dette vil tage omkring 10 – 14 dage post-FACS sortering.
  3. Bekræftelse af målretning begivenheder ved flowcytometri i befolkningens blandet målrettede celle
    1. Efter 10-14 dage af ekspansion (når celler har nået en tæthed af 1 x 106 celler/mL i en 75 cm2 celle kultur kolbe), målrettet plade to brønde med 1 x 106 celler af den blandede celle population i 1 mL RPMI m / AB i en 12-godt cellekultur plade.
    2. Fremkalde HIV LTR af journalisten (generation af tv er beskrevet i trin 1.2.2.1.) i en af brøndene ved at tilføje 50 ng/mL phorbol 12-myristate 13-acetat (PMA) og 1 µM Ionomycin (benævnt PMA-Iono). Bruge celler i den anden godt som kontrolelementet ikke-induceret. Kultur både induceret og ikke-induceret celler i 24 timer.
    3. Tage 0,5 mL cellesuspension af ikke-induceret og induceret celler, (hver), vask dem engang i PBS og suspendere hver i 200 µL af FACS buffer.
    4. Analysere 100.000 celler ved flowcytometri. Gate levedygtige single-cellerne baseret på størrelse i frem og sidelæns scatter, og analysere fluorescerende reporter gen expression.
      Bemærk: På dette trin (10-14 dage post-FACS sortering), forbigående udtryk af fluorescerende reporter ved Transfektion ikke længere bør detectable. Fluorescerende udtryk for dette tidspunkt angiver genomisk integration af reporter sekvens.
  4. Påvisning af målretning begivenheder ved PCR på genomisk DNA med befolkningens blandet målrettede celle
    Bemærk: Til at registrere målretning begivenheder via PCR, design to primer par specifikke for 5' integration (int.) krydset og 3' int. junction. For 5' int. junction PCR, den forreste primer bør binde opstrøms af 5' HA og den omvendte primer i LTR af reporter (primere P1 og P2 i figur 3a). Primer parret til 3' int. krydset PCR bør spænder fra PA af journalisten til 100 – 200 bp nedstrøms af 3' HA (primere P3 og P4 i figur 3a). Primere P1 og P4 vil også tjene til forstærkning af den ikke-øremærket allel i blandet målgruppen. For en skematisk, se figur 3a.
    1. Forberede gDNA fra 2 mL cellesuspension af blandet målrettede cellen befolkningen fra trin 2.2.4. Bruge en gDNA udvinding kit efter producentens protokol. Derefter forberede gDNA af ikke-målrettede celler som kontrol.
    2. Udføre int. junction PCR'er (primere P1/P2 og P3/P4 for 5' og 3' int. junction, henholdsvis) og ikke-øremærket allel PCR (primere P1/P4) ved hjælp af en high-fidelity DNA polymerase (Se tabel 3 og 4 for PCR ingredienser og cykling betingelser) . Analysere 5 µL PCR produkter på en 1,5% Agarosen/TAE gel.
      Bemærk: Hvis blandet målgruppen indeholder celler, der har undergået genom engineering, en specifik PCR produkt bør overholdes, ikke kan spores i gDNA af ikke-målrettede celler (negativ kontrol). For den ikke-øremærket allel PCR, skal man iagttage et produkt af samme størrelse for både målrettet og ikke-målrettede celler (positiv kontrol for genomisk P1 og P4 primere). Hvis ingen bands er observeret, overveje at ændre PCR cykling betingelser ved at øge antallet af cyklusser eller ændre PCR-buffer (for eksempel gennem tilsætning af DMSO eller øgede mængder af Mg2 +) eller ved at ændre polymerasen.

3. generation af klonede linjer og Screening for korrekte målretning

Bemærk: Efter bekræftelse af målretning begivenhederne i den blandede målrettede celle befolkning ved flowcytometri og PCR (afsnit 2.2-2.4), generere encellede kloner (varighed: 28-35 dage), og skærmen for korrekt integration af reporter sekvens.

  1. Generation af encellede kloner gennem fortynding plating
    1. Forberede Jurkat-aircondition medium på forhånd: take off RPMI m / AB medium fra sund, ubehandlet Jurkat T celler dyrkes til 1 x 106 celler/mL, centrifugeres i 5 min. ved 300 x g, og filtrere supernatanten ved hjælp af et 0,22 µm sprøjte filterenhed.
      Bemærk: Holde konditioneret medium ved 4 ° C for kortvarig oplagring eller ved-20 ° C til oplagring længere end 1 uge. Forberede 20 til 30 mL af konditioneret medium før fortynding plating.
    2. Tælle de målrettede celler fra trin 2.2.4 efter 10-14 dage af ekspansion og fortyndes dem i RPMI m / AB til en koncentration på 1 x 105 celler/mL. Tage 100 µL 1 x 105 celler/mL opløsning og fortyndes med 9,9 mL medium til at opnå en koncentration af 1000 celler/mL. 1 ml af 1000 celler/mL opløsning og fortyndet med 9 mL medium til at opnå en koncentration på 100 celler/mL.
    3. Plade 96-brønd plader der indeholder 1 celle pr. brønd og 2 celler pr. brønd. For 1 celle pr. brønd, tag 1 mL 100 celler/mL opløsning og bland forsigtigt med 5 mL af konditioneret medium og 4 mL frisk medium i en steril reagens reservoir.
    4. For 2 celler pr. brønd, udtages 2 mL af 100 celler/mL opløsning og bland forsigtigt med 5 mL af konditioneret medium og 3 mL frisk medium. Plade 96-brønd runde-nederste plader med 100 µL af den respektive celle fortynding pr. brønd med en multikanal pipette.
      Bemærk: 5 til 10 96-brønd plader pr. målretning konstruktion er tilstrækkelig til at opnå kloner for screening.
    5. Stable 96-brønd plader, dækker hver stak med en 6-godt plade der indeholder 3 mL PBS i hvert hul, og Inkuber plader ved 37 ° C i en fugtig celle kultur kuvøse med 5% CO2 til 3 uger.
      Bemærk: Ændrer ikke cellekulturmedium i løbet af denne tid. Må ikke åbne rugemaskinen mere end én eller to gange om ugen. De bedste resultater er observeret i væksthuse med åbent vandreservoir.
    6. Efter 3 uger til inkubation, visuelt bekræfte tilstedeværelsen af dyrkede kolonier ved hjælp af lysmikroskopi (4 X forstørrelse) og markere brønde med dyrkede kolonier, så de kan ses som punkter på bunden af brøndene.
    7. Forberede en 96-brønd runde-nederste plade med 100 µL af RPMI m / AB pr. brønd. Forsigtigt resuspend celler af en markant godt af pipettering. Overføres 100 µL af cellesuspension til et godt af den nye 96-brønd plade allerede indeholdende 100 µL af RPMI m / AB, derefter blandes forsigtigt af pipettering. Overføres 100 µL af denne cellesuspension til en anden tom 96-brønd runde-bundplade at kopiere pladen.
    8. Fortsæt med alle markerede brønde med dyrkede kolonier. Udfylde alle de tomme brønde med 200 µL af RPMI m / AB medium. Inkuber plader ved 37° C og 5% CO2.
      Bemærk: En af disse plader vil tjene for udvidelse af encellede kloner ("stock plade") og den anden som en "dublerede plade" for screening.
  2. Screening af encellede kloner ved flowcytometri og PCR
    Bemærk: Mens encellede kloner udvider, bruge den dublerede plade fra trin 3.1.8 til skærmen encellede kloner for tilstedeværelsen af reporter sekvens af PCR (trin 3.2.4–3.2.12) og angivelse af fluorescerende reporter ved flowcytometri (trin 3.2.2–3.2.3) (Figur 3 c).
    1. Lad dublerede pladen inkuberes i 24 til 48 timer og kopiere pladen igen. Tilsæt 100 µL af RPMI m / AB til hver brønd for at gøre dette, bland forsigtigt af pipettering, og overføres 100 µL til en ny 96-brønd runde-bunden plade ved hjælp af en multikanals pipette. Bruge en trykplade for flow flowcytometri screening og den anden til PCR-baseret screening.
    2. For flow flowcytometri screening, stimulere cellerne med PMA-Iono. Forberede en mastermix af 0,1 µL af Ionomocin (1 mM stock), 0,1 µL af PMA (50 µg/µL lager), og 4,8 µL af RPMI m / AB pr. antal brønde, derefter tilsættes 5 µL af mastermix pr. brønd.
      Bemærk: Induktion er nødvendige for at med held identificere kloner, hvor LTR muligvis transcriptionally tavs og derfor den fluorescerende reporter er ikke udtrykt.
    3. Lad cellerne inkuberes i 24 timer og forberede flowcytometri som beskrevet i trin 2.3.3 celler. Gate nogen levedygtig single-celler baseret på størrelse i frem og sidelæns scatter og analysere fluorescerende reporter gen expression ved flowcytometri (for eksempel resultater, se figur 3 c). Hvis tv rygraden indeholder en anden fluorescerende reporter med promotor (f.eks., normal god landbrugspraksis), skærm enhver kloner til rygraden reporter udtryk også (Se trin 1.2.2 og følgende note til forklaring).
      Bemærk: Rygrad reporter udtryk angiver uønsket integration af rygraden sekvenser.
    4. Når kloner i den anden dublerede plade er vokset tilstrækkeligt (normalt 24 til 48 h efter duplikering af 96-brønd plade), forberede cellelysater indeholdende gDNA for PCR screening. Centrifuge pladen i 10 minutter ved 300 x g på RT. omhyggeligt tage supernatanten uden at forstyrre den celle pellet.
      Bemærk: Alle trin til forberedelse af lysates og PCR-reaktionerne kan udføres med multikanal pipetter.
    5. Vaske cellerne med 100 µL af PBS af blid pipettering og centrifugering plade i 5 min på 300 x g på RT. Tage PBS og tilføje 200 µL af lysisbuffer [200 mM NaCl, 100 mM Tris-HCl pH 8-8,5, 5 mM EDTA, 0,1% SDS; derefter tilføje 250-1000 µg/mL af proteinase K (frysetørret pulver, vejer i frisk)] pr. brønd. Bland forsigtigt af pipettering, og overføre suspension til en ny PCR-plade.
    6. Forsegle pladen med paraffin film og Inkuber i 1 time ved 55 ° C i en thermocycler. Der centrifugeres ved maksimal hastighed for 10 min (3.000 x g) at spin ned celle debris, og overføre supernatanten til en ny PCR-plade.
      Bemærk: Cellelysater i pladerne kan opbevares på dette stadium ved 4 ° C indtil videre anvendelse.
    7. Forberede en 96-brønd PCR plade med 110 µL af dH2O og tilsæt 10 µL af celle lysate (1:12 fortynding). Cellelysater kan være tyktflydende og vanskeligt at pipette. Brug mindst 20 µL pipette tips.
    8. Inaktivere proteinase K ved inkubation i 10 min på 99 ° C i en thermocycler. Efterfølgende brug det inaktiverede og fortyndet cellelysater til PCR screening.
    9. Design primere for screening PCR (P5 og P6) baseret på den valgte reporter sekvens for at forstærke 500-800 bp af reporter sekvens. Positiv kontrol PCR, bruger primere P7 og P8, at forstærke 630 bp af et wild-type, ikke-øremærket genomisk locus (NUP188 gen) (figur 3 c og tabel 5). Designe en tredje primer par, der forstærker 500 – 600 bp tv rygrad som en kontrol for uspecifik integration af tv rygraden sekvenser (backbone PCR).
    10. Til screening, kontrol og rygraden PCR, bruge en kommerciel PCR-mastermix (Se tabel 6 og 7 for PCR ingredienser og cykling betingelser). Bruge 2 µL af de fortyndede og inaktiverede lysate udarbejdet i trin 3.2.8 som en skabelon og køre PCR for 38-40 cyklusser af PCR-amplifikation i 96-brønds format.
    11. Analysere 5 µL PCR produkter på en 1,5% Agarosen/TAE gel.
      Bemærk: For kontrol PCR, en specifik band af 630 bp bør observeres for hver prøve, bekræfter, at kvaliteten af cellelysater er passende for PCR. En bestemt frekvensbånd i screening PCR (500-800 bp afhængigt af primer design) angiver integration af reporter sekvens. En bestemt frekvensbånd til rygraden PCR (500 – 600 bp, afhængigt af primer design) angiver uønsket integration af tv rygraden sekvenser (for eksempel resultater, se figur 3 c).
    12. Kombinere resultaterne af PCR-baseret screening (trin 3.2.12) og flowcytometri (trin 3.2.3). Vælg kloner, som viser korrekt størrelser af PCR produkter i screening PCR og positiv kontrol PCR og angivelse af fluorescerende reporter efter induktion med PMA-Iono i flowcytometri. Udelukke kloner, der viser alle PCR produkt i rygraden PCR eller udtryk for tv backbone-kodet fluorescerende proteiner, der angiver uspecifik integration af tv rygraden sekvens.
    13. Gradvist at udvide udvalgte kloner fra 96-brønd stock pladen til større godt formater (48/24/12/6-godt) indtil at opnå en T75 celle kultur kolbe format ved at tilføje friske medium hver 2-3 dage. Opretholde en celle tæthed mellem 1 x 105 og 1 x 106 celler/mL.
    14. Sørg for at forberede celle bestande af kloner under udvidelsen: tælle cellerne, centrifugeres ved 300 x g i 5 min på RT, supernatanten fjernes, og suspendere celler forsigtigt i FCS + 10% DMSO på 5 x 106 celler/mL. Alikvot i kryogene hætteglas og brug en cryo-frysning container til at fryse celler til 80 ° C i 1 ° C/min.. For lang sigt opbevaring, overføre dem til flydende Nielsen2.
      Bemærk: Det er tilrådeligt at fastholde en T75 celle kultur kolbe (dvs., omkring 1 x 107 celler) under udvidelsen af gDNA med henblik på verifikation af målretning af sydlige blotting (Se afsnit 3.4).
  3. Verifikation af integration websteder af PCR-sekventering i udvalgte kloner
    Bemærk: 5' og 3' int. knudepunkter af udvalgte kloner er PCR forstærket og indsendt til Sanger korrekte rækkefølge for at kontrollere målretning på DNA sekvens plan.
    1. Forberede gDNA af udvalgte kloner og Jurkat wild-type celler ved hjælp af en kommerciel gDNA udvinding kit.
    2. Bruge primer par bindende 5' enden af reporter og opstrøms af 5' HA til 5' int. junction (primere P1 og P2) og 3' enden af reporter og downstream af 3' HA for 3' int. junction (primere P3 og P4) som beskrevet i trin 2.4. Bruge primere P1 og P4 til at forstærke den målrettede integration site på allel uden reporter integrant (figur 4a).
    3. Forberede PCR reaktioner med 100 – 200 ng af gDNA som en skabelon og udføre PCR ved hjælp af en polymerase med korrekturlæsning aktivitet (Se tabel 1 og 2 for PCR ingredienser og cykling betingelser).
      Bemærk: Hvis ingen bands er observeret, overveje at ændre PCR cykling betingelser ved at øge antallet af cyklusser eller ændre PCR-buffer (for eksempel ved at tilføje DMSO eller øgede mængder af Mg2 +), eller ved at ændre polymerasen.
    4. Analysere 5 µL PCR produkter på en 1,5% Agarosen/TAE gel. Hvis korrekte band størrelser er observeret, rense den resterende PCR produkt ved hjælp af en kommerciel kit og underkaste det Sanger sekvensering. Kontrollere sekvenser af 5' int. junction, 3' int. junction og målrettede site af allel uden reporter integrant ved at tilpasse dem med forventede sekvenser.
      Bemærk: Den homologe allel, hvor journalisten ikke har integreret vil sandsynligvis vise Cas9-medieret ændringer på mål-webstedet som nukleotid indsættelser og sletninger (figur 4a).
    5. Udfør en PCR forstærke den hele målrettede reporter for kloner, der viser korrekt int. junction sekvenser efter justering, og underkaste det Sanger rækkefølge for at kontrollere den korrekte sekvens af den integrant.
  4. Sydlige skamplet analyse for verifikation af målretning i udvalgte kloner
    Bemærk: Sydlige skamplet analyse af udvalgte kloner er forpligtet til at kontrollere korrekte målretning og udelukke Cas9-medieret rekombination begivenheder, der kan være opstået på målrettet integration site.
    1. Udvikle en strategi for passende gDNA fordøjelsen og sonde design før du starter eksperimentet.
      1. Vælg en begrænsning enzym til gDNA restriktion, der genererer passende fragmenter af 2-10 kb længde på den målrettede websted. Visse restriktionsenzymer, såsom Asp718, BamHI, BglI, BglII, EcoRV, HindIII, underofficerI, PstI, PvuII, ScaI, Stu, og SST Jeg har med held brugt til fordøje høj molekylvægt gDNA.
      2. Designe to forskellige sydlige sonder: en reporter-specifikke sonde og genomisk sonde. Reporter-specifikke sonden hybridiserer til en sekvens i reporter (dvs., tdTomato-specifikke sonde). Genomisk sonden hybridiserer til en genomisk region tæt på (men ikke overlappende) en HA.
      3. Vælg genomisk sonden, så fragmentet genereret af gDNA fordøjelse, som vil blive opdaget af genomisk sonde bindende varierer i længde (mere end 2 kb) fra de målrettede og ikke-øremærket alleler (figur 4b). En sonde længde af 400 til 1.000 bp anbefales.
      4. Design PCR primere til at forstærke de to krævede sonder. Forstærke reporter-specifikke sonden fra tv skabelon ved hjælp af en high-fidelity DNA polymerase (Se tabel 3 og 4 for PCR ingredienser og cykling betingelser).
      5. Forstærke genomisk sonden fra vildtype Jurkat gDNA forberedt med en kommerciel gDNA udvinding kit ved hjælp af en DNA-polymerase med korrekturlæsning aktivitet (Se tabel 1 og 2 for PCR ingredienser og cykling betingelser). Rense PCR-produkter på en Agarosen/TAE gel og udtrække fragmenter ved hjælp af en kommerciel gel udvinding kit ifølge producentens anvisninger.
    2. Uddrag høj molekylvægt gDNA fra 1 x 107 celler i wild-type Jurkat celler og udvalgte kloner fra trin 3.2.14.
      1. Sammenpresse cellerne ved centrifugering ved 300 x g i 5 min på RT, vaske det engang med PBS og suspendere pellet i 4 mL af lysisbuffer [200 mM NaCL, 100 mM Tris-HCl pH 8, 5 mM EDTA, 0,1% SDS; derefter tilføje 250-1000 µg/mL proteinase K (frysetørret pulver vejer frisk)]. Inkuber o/n på 55 ° C, rysten på 350 rpm i en bordplade thermomixer.
      2. Der tilsættes 4 mL isopropanol og blandes ved inversion 10 til 20 gange. GDNA bør blive synlig som hvide bundfald. Spole det udfældede gDNA på den fine spids af glas pipette, vask af dukker op i 750 µL af 70% EtOH, og lad tørre på RT (5-10 min).
      3. Kaste bundfald ind i en 1,5 mL reaktion rør indeholdende 500 µL 1 x TE buffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA) og lad det opløse o/n ved 4 ° C, rysten på 350 rpm. Enhver Pipettering af gDNA fra denne fase bør ske med wide-bore tips til at undgå klipning.
        Bemærk: Udarbejdelse af høj molekylvægt gDNA er afgørende for det sydlige skamplet analyse, og kommercielt tilgængelige gDNA forberedelse kits er ikke egnede.
    3. Digest (to gange) 15 µg af gDNA af udvalgte kloner og vildtype Jurkat celler med udvalgte begrænsning enzym (Se trin 3.4.1.1) i en 60 µL reaktion med 6 µL af enzymet (20 enheder/µL): først tilføje DNA, fordøjelsen buffer, og Hedeselskabet2O, inkuberes o/n ved 37 ° C , derefter tilsættes enzymet og der inkuberes o/n ved enzym-specifikke fordøjelsen temperatur. der kræves 15 ug af fordøjet gDNA pr. sydlige sonde.
    4. Bruge 7 µL af 60 µL begrænsning digest for analytisk gelelektroforese på en 1% Agarosen/TAE gel. En smear angiver komplet fordøjelse og god DNA kvalitet for sydlige skamplet analyse.
    5. Udfælde den resterende begrænsning digest ved at tilføje 1:10 3 M natriumacetat og 2 bind 100% EtOH, derefter inkuberes i 1 time ved-80 ° C og centrifugeres i 30 min. ved 15,600 x g ved 4 ° C.
    6. Supernatanten og vaske pellet med 70% EtOH. Der centrifugeres i 15 min. ved 15,600 x g ved 4 ° C, supernatanten, lad pellet tørre kort på RT, og opløses i 20 µL af Hedeselskabet2O.
    7. Køre 1% Agarosen/TAE blotting gel, lastning 20 uL af fordøjet gDNA pr. vognbane. Kør gelen i 2 timer på 60 V, 400 mA.
      Bemærk: Procentdelen af Agarosen gel og kører tid/spænding kan justeres efter forventede fragment størrelse til det sydlige skamplet påvisning beregnet i trin 3.4.1.1. De følgende trin i sydlige skamplet analyse er beskrevet i detaljer i en supplerende protokol (trin 1-18). Disse trin består af: vask af blotting gel, duppe på et nylon membran, radioaktive sonde generation, sonde hybridisering og udvikling af autoradiograph film. Sammenligne de opnåede banding mønster efter autoradiograph udvikling i trin 18 (supplerende protokol) med det forventede mønster efter sydlige strategi (for eksempel resultater, se figur 4b).
  5. Analyse af off-target begivenheder
    Bemærk: Da CRISPR-Cas9-medieret genom engineering kan generere off target effekter, PCR-forstærke 10 højest rangerede i siliciummangan-forudsagt off målwebsteder i udvalgte kloner og underkaste dem Sanger sekvensering.
    1. Brug CCTop16 (http://crispr.cos.uni-heidelberg.de) til at generere en liste over de ti højest rangerede i siliciummangan forudsagt off target sekvenser.
      1. Input gRNA sekvensen herunder PAM som bruges til at målrette som forespørgslen sekvens. Vælg "NGG" som PAM og "Menneskelige genom" som reference til off-target forudsigelse.
      2. Angive maksimal samlede uoverensstemmelser til "4" og målet site længde til længden af gRNA uden PAM. Outputfilen vil give en klassificeret liste over genomisk off-målwebsteder for respektive gRNA.
    2. I siliciummangan ekstrakt genomisk sekvens 500 bp opstrøms og nedstrøms for hver af de ti højeste rangerede off target hits bruge UCSC genom Browser (http://genome.edu.ucsc.edu) og placeringen af den off-target hit fra CCTop resultatlisten.
    3. For hver off målwebsteder analyse, design en PCR primer parre der forstærker et fragment af 600 til 700 bp i længde herunder forudsagte off-mål-webstedet.
    4. Uddrag gDNA fra udvalgte kloner og Jurkat wild-type celler ved hjælp af en kommerciel gDNA udvinding kit. For hver off mål site, udføre en PCR ved hjælp af en DNA-polymerase med korrekturlæsning aktivitet (Se tabel 1 og 2 for PCR ingredienser og cykling betingelser) på wild-type og de respektive klon-afledte gDNA.
    5. Analysere 5 µL PCR produkter på en 1,5% Agarosen/TAE gel. Hvis korrekte band størrelser er observeret, rense den resterende PCR produkt ved hjælp af en kommerciel PCR rensning kit og underkaste det Sanger sekvensering. Sammenlign sekvenser af off-target websteder i Jurkat celler og de målrettede kloner.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

I denne repræsentative eksperiment har vi valgt at målrette en minimal HIV-1-afledt reporter bestående af en LTR, tdTomato-kodende sekvens, og polyA-signal sekvensen til to loci i intron 5 af BACH2 gen17. Loci for målretning blev udvalgt efter nærhed til offentliggjorte tilbagevendende integration steder fundet i forskellige undersøgelser på primære T celler fra HIV-inficerede patienter2,4,5,6, 7,8 og tilstedeværelsen af en PAM motiv NGG nødvendige for Cas9-medieret induktion af dobbelt-strenget pauser. Target vektorer blev konstrueret og transfekteret efter de beskrevne protokol. Arbejdsgangen for Transfektion, kontrol for målretning begivenheder, generation af encellede kloner, og screening og udvælgelse af kloner er skematisk vist i figur 1.

To uger efter FACS-berigelse af transfekteret celler, var vi købedygtig opdager reporter gen expression efter PMA-Iono induktion ved flowcytometri i 4 til 12% af celler, afhængigt af integration websted (data ikke vist) og PCR produkter på genomisk DNA der spænder over hele 5' og 3' integration krydset fra opstrøms af 5' HA i reporter sekvens og nedstrøms af 3' HA i reporter sekvens, henholdsvis (figur 3a og 3b). At have bekræftet, at målrette begivenheder fandt sted, gik vi at generere encellede kloner ved at begrænse fortynding plating. I vores hænder var plating 5 til 10 96-brønd plader pr. målretning konstruktion tilstrækkelig til at opnå tilstrækkelig kloner for en vellykket skærm. I protokollen (punkt 3.2), er det beskrevet, hvordan man udfører en screening af encellede kloner i duplikerede 96-brønde. I denne forbindelse skal kun positive kloner udvides, hvilket sparer både tid og kræfter. I figur 3 cvises eksempeldata i FACS-screening efter PMA-Iono induktion og PCR screening. Vi observeret en række kloner med høj, lav og ikke fluorescerende reporter gen expression (figur 3 c). For PCR-screening er det vigtigt at medtage en kontrol PCR, som forstærker en genomisk locus af valg til at afgøre, om kvaliteten af cellelysater er passende for PCR. I vores tilfælde, har vi valgt en 630 bp sekvens i NUP188 gen locus for kontrol PCR (for primer sekvenser, se tabel 5). Primere for screening PCR blev derefter designet til at forstærke en kortere sekvens beliggende i journalisten. Derudover blev PCR for en sekvens på target vektor rygraden udført for at udelukke enhver kloner, som havde unspecifically integreret target vektor rygraden sekvenser (backbone PCR, data ikke vist).

Forhånd udvalgte kloner var så udvidet og yderligere analyseret for korrekte målretning af sydlige skamplet og PCR og sekventering. Sydlige skamplet blev udført ved hjælp af en reporter-specifikke sonde og en sonde, der er specifikke for genomisk locus bindende uden for journalisten, men ikke inden for homologi armene af den målretning vektor. Interessant, alle klonerne, der blev testet af det sydlige skamplet var positive i screening PCR på forhånd, men kun en del viste korrekte band størrelser i det sydlige skamplet analyse og heterozygously havde integreret reporter (figur 4b). Det er derfor nødvendigt at ikke kun stole på screening PCR resultater men også kontrollere korrekte målretning af sydlige blotting. For at bekræfte korrekte målretning på DNA sekvens niveau, integration vejkryds blev forstærket af PCR og produkter blev udsat for Sanger sekventering (figur 4a). Navnlig, afslørede sekventering af målet site homologe allel, hvor journalisten ikke havde integreret, Cas9-medieret ændringer. I figur 4a, eksempler til en Cas9-medieret sletning er vist. For at teste for Cas9-medieret off target effekter, var en liste over de højeste rangerede off target sites genereret som beskrevet i afsnit 3.5. Ti højest rangerede off-målwebsteder var PCR-amplificeret fra genomisk DNA af kloner, og produkterne underkastes Sanger sekvensering. I de målrettede encellede kloner vi genereret, blev ingen variationer fra Jurkat vildtype sekvenser observeret på de ti højest rangerede off-målwebsteder.

Figure 3
Figur 3: Screening af encellede kloner til at målrette begivenheder. (en) skematisk af primer design til påvisning af målretning begivenheder ved PCR i blandet målrettede celle population. Primer par til påvisning af 5' integration junction (P1, P2) og 3' integration junction (P3, P4) er angivet som pile. Primer P1 og P4 også tjene til at forstærke målrettede locus af allel uden reporter integrant (b) genomisk DNA af blandet målrettede celle befolkning blev udarbejdet 10 dage efter FACS berigelse af transfekteret celler og analyseret for 5' integration junction (P1, P2 ), 3' integration junction (P3, P4, data ikke vist) og vildtypeallelen af den målrettede locus (P1, P4). Wild-type Jurkat celler (wt) fungerede som kontrol. (c) første skærmbillede af encellede kloner i 96-brønd plader. 96-brønd plader med enkelt-celle kloner blev screenet for korrekte målretning ved flowcytometri efter PMA-Iono induktion og PCR analyse. Resultater for eksempel kloner er vist. PCR blev udført på cellelysater med reporter-specifikke primere (screening PCR; P5, P6) og primere forstærke en genomisk locus (styre PCR, her: NUP188 locus; P7, P8). Cell lysates af vildtype Jurkat celler (wt) og genomisk DNA fra HIVisB2 klon (B2)18 tilberedt med kommercielt tilgængeligt kit fungerede som en negativ kontrol for screening PCR og positiv kontrol til kontrol PCR, henholdsvis. Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4: analyse af udvalgte encellede kloner for korrekte reporter integration. (en) Sekvensanalyse integration vejkryds og målrettede locus på allel uden reporter integrant. Primer par til påvisning af 5' integration junction (P1, P2), 3' integration junction (P3, P4) og målrettede locus af allel uden reporter integrant (P1, P4) blev brugt. PCR produkter blev forstærket fra genomisk DNA af encellede kloner og underkastes Sanger sekvensering. Sekventering resultater blev justeret for forventede sekvenser. Vist er eksempeldata af en klon. Sekvens kromatogrammer fra genom/HA junction og HA/reporter junction er vist for både 5' og 3' integration junction. Kampe er angivet som prikker. Bindingssted af gRNA er markeret med en boks. Cas9-induceret mutationer er fremhævet med rødt. Skematisk af primer design er vist nedenfor. Pilene angiver primer positioner anvendes til forstærkning. (b) det sydlige skamplet analyse af udvalgte målrettede encellede kloner og Jurkat wild-type celler. Sydlige skamplet analyse blev udført om genomisk DNA med en reporter-specifikke sonde og en sonde anerkende en genomisk sekvens i både målrettet og vildtype allel (genomisk sonde). Data af 7 eksempel kloner er vist. Kloner med korrekte band størrelser er markeret med kasser. Fortyndet target vektor plasmid fungerede som positiv kontrol (+). Skematisk for sydlige skamplet analyse er vist nedenfor. Venligst klik her for at se en større version af dette tal.

Reagens Tilføj per reaktion
Videresende Primer (20 µM) 1 ΜL
Vende Primer (20 µM) 1 ΜL
10 x Taq buffer 5 ΜL
1 µL dNTP'er (2,5 mM) 1 ΜL
MgCl (50 mM) 1 ΜL
DMSO 1,5 ΜL
gDNA (50-100 ng/µL) 2 ΜL
Nukleasen-frit vand Fyld op til 49,5 µL
Taq DNA polymerase (5 U/mL) 0,5 ΜL
reaktion volumen 50 ΜL

Tabel 1: opskrift på PCR ved hjælp af en polymerase med korrekturlæsning aktivitet. Mængden af hver reagens skal tilføjes pr. PCR reaktion er indiceret. PCR er beregnet til forstærkning med genomisk DNA som skabelon. Opskriften bruges i trin 1.2.2.2 (forstærkning af homologi våben), trin 3.3.3 (kontrol af integration sites), trin 3.4.1.5 (generation af genomisk sonde til sydlige skamplet) og trin 3.5.4 (analyse af off-target begivenheder).

Trin Temperatur Tid Cykler
Indledende denaturering 95 ° C 2 min 1
Denaturering 95 ° C 40 Sørensen 30-35
Udglødning 58 ° C 45 s
Udvidelse 72 ° C 1 min/kb
Endelige udvidelse 72 ° C 10 min 1

Tabel 2: cykling betingelser for PCR ved hjælp af en polymerase med korrekturlæsning aktivitet. Cykling betingelser svarer til PCR opskrift der er anført i tabel 1.

Reagens Tilføj per reaktion
Videresende Primer (20 µM) 1 ΜL
Vende Primer (20 µM) 1 ΜL
5 x Hi-Fi-buffer 5 ΜL
1 µL dNTP'er (2,5 mM) 1 ΜL
gDNA (50-100 ng/µL) eller plasmid DNA (50 ng/µL) 2 µL gDNA eller
1 µL plasmid DNA
Nukleasen-frit vand Fyld op til 49,5 µL
High-Fidelity DNA polymerase 0,5 ΜL
reaktion volumen 50 ΜL

Tabel 3: opskrift på PCR ved hjælp af en high-fidelity polymerase. Mængden af hver reagens skal tilføjes pr. PCR reaktion er indiceret. PCR er beregnet til robust forstærkning af DNA skabeloner. Opskriften bruges i trin 2.4.2 (påvisning af målretning begivenheder) og trin 3.4.1.4 (generation af reporter-specifikke sonde til sydlige skamplet).

Trin Temperatur Tid Cykler
Indledende denaturering 98 ° C 30 s 1
Denaturering 98 ° C 10 s 30 - 35
Udglødning 58 ° C 30 s
Udvidelse 72 ° C 30 s/kb
Endelige udvidelse 72 ° C 10 min 1

Tabel 4: cykling betingelser for PCR ved hjælp af en high-fidelity polymerase. Cykling betingelser svarer til PCR opskrift der er anført i tabel 3.

Primer Rækkefølge (5'-3')
P7 kontrol PCR F CTTTGTTGGGTAAGCATGGAGGTC
P8 kontrol PCR Rasmussen CAGTTACTCACCTTTGCACATAGG

Tabel 5: oligonukleotid sekvenser for kontrol PCR. Frem og bak primere for forstærkning af en 630 bp fragment af NUP188 locus er angivet.

Reagens Tilføj per reaktion
klar-til-brug PCR Master Mix 8 ΜL
Videresende Primer (20 µM) 1 ΜL
Vende Primer (20 µM) 1 ΜL
Nukleasen-frit vand 8 µl
Cell lysate (1:12 fortynding) 2 ΜL
samlede reaktion volumen 20 ΜL

Tabel 6: opskrift på screening-PCR. Mængden af hver reagens skal tilføjes pr. PCR reaktion er indiceret. PCR opskrift er beregnet til screening PCR taktfast 3.2.11.

Trin Temperatur Tid Cykler
Pre-PCR Denaturering 94 ° C 2 min 1
Udglødning 58 ° C 1 min
Udvidelse 72 ° C 1 min
Denaturering 94 ° C 30 s 38
Udglødning 58 ° C 30 s
Udvidelse 72 ° C 1 min
Endelige udvidelse 72 ° C 10 min 1

Tabel 7: cykling betingelser for screening-PCR. Cykling betingelser svarer til PCR opskrift der er anført i tabel 6.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Her, beskriver vi en protokol til at generere HIV-1-afledt Jurkat reporter modeller med valgte proviral integration websteder anvender CRISPR-Cas9-baseret genom engineering.

Flere punkter i protokollen kræver omhyggelig opmærksomhed i planlægningsfasen. Først, locus skal målrettes skal vælges omhyggeligt, som kan være lettere at målrette end andre, nogle loci (f.eks., afhængigt af regionen og målet kromatin status sekvens sig selv). Gentagne sekvenser er svært at klone i den målretning vektor og ofte ikke entydigt i genomet. Regioner af repressive kromatin er sværere at målrette med CRISPR-Cas9 system19,20.

Det andet er valg af gRNA afgørende for CRISPR-Cas9-medieret målretning. Med henblik på at generere modeller for hivinfektion med repræsentative integration websteder, ville man ønsker gRNA at binde så tæt som muligt til en integration hotspot. Men dette websted kan ikke være ideel til Cas9 ansættelse; et kompromis skal derfor foretages mellem nærhed af gRNA sekvens til webstedet integration af valg og gRNA kvalitet. Vi har fundet E-sprød webtool pålidelige til at forudsige funktionelle gRNAs. Det er også muligt at foretage en gRNA pre-test af forbigående udtrykker flere gRNAs sammen med Cas9 i celletype skal være målrettet, efterfulgt af en screening for mutationer. En egnet gRNA direkte effektivt Cas9 til mål-webstedet og gRNA supplerende site vil vise mutationer. Længden af har (1,000 bp opstrøms og nedstrøms for webstedet integration) blev udvalgt efter tidligere offentliggjorte undersøgelser11. Generelt vil at reducere længden af homologi våben resultere i reducerede målretning frekvens. En længde af 1000 bp af homologi arm præsenterer et godt kompromis mellem tilstrækkelig målretning frekvens og lethed af target vektor konstruktion.

For det tredje skal nok tid bruges på et godt design af journalist konstruere. Minimal reporter bruges i denne protokol, som indeholder en HIV-1 NL4-3 afledt LTR og en tdTomato kodende sekvens, blev designet baseret på følgende princip: enkelt LTRs er blevet beskrevet som udelukkende resterende proviral fragmenter i flere tilfælde af klonede ekspansion i kronisk HIV-1-inficerede individer21. Det forventes at LTR er stærkt påvirkninger kromatin status på integration websteder og organiserer rekrutteringen af cellulære komplekser. Vi har valgt en minimal HIV reporter med fokus på HIV LTR som vigtigste regulerende genetiske element og derefter indført tdTomato som fluorescerende LTR aktivitet markør i stedet for yderligere HIV-1 gener, som genom engineering frekvens blev rapporteret at være højere med mindre målretning indsætter11. I betragtning af de tidskrævende trin af tv kloning, klonudvalg, screening og kontrol af kloner anbefales det at nøje overveje udformningen af HIV reporter i forbindelse med funktionelle studier, der i sidste ende vil blive gennemført på målrettet cellelinjer. Man overveje eksempelvis optagelse af gag leder sekvens, 3' HIV LTR, og/eller andre virale gensekvenser i journalisten. Protokollen kan tilpasses let til sådanne forskellige reporter konstruktioner.

Generelt, er det vigtigt at overveje valg af celletype målrettet som encellede klon generation kan være svært med visse cellelinjer. Vi fandt, at Jurkat celler ikke er meget effektive i enkelt klon generation; dog besluttede vi at vælge denne celletype til sin tidligere kendte brug i latent HIV infektion modeller9. Vi opnået de bedste resultater i Jurkat klonede fortynding plettering med 50% konditioneret medium, når pladerne blev efterladt uforstyrret i en inkubator, der blev åbnet ikke mere end 3 gange om ugen. Hvis bruger en anden cellelinie ønskes, anbefales det at pre test mulighed for at generere encellede kloner ved at udføre en fortynding plating eksperiment. Et andet punkt at huske er variationen af Transfektion satser for forskellige cellelinjer. Hvis Transfektion ikke er muligt for den valgte cellelinie, electroporating celler til at målrette kan være nødvendigt. Bemærk, at valget af cellelinje bruges til at målrette ikke kan fastlægges af tekniske aspekter kun, såsom effektivitet for Transfektion eller enkelt klon generation. Også kan betragtes som funktionelle aspekter, såsom transcriptional aktivitet eller inducibility af målrettede gen locus. Dette kræver muligvis screening af forskellige cellelinjer før målretning arbejdsprocessen.

Det skal understreges, at den beskrevne protokol er tidskrævende. Det bør forventes at tage 3-6 måneder fra det første skridt til endelige klonede cellelinjer. Sydlige skamplet analyse, der bruges til at kontrollere for lokationsspecifikke enkelt integration begivenheder, kan virke besværligt, men vores erfaring er det meget vigtigt - som kun en delmængde af encellede kloner, der viste den forventede integration vejkryds pr. PCR viste en rette mønstre i den sydlige skamplet. Ideelt set eksperimentatorer skal generere en række kloner med den samme indsats målrettet til den samme integration websted til kontrol for klonede effekter i nogen efterfølgende eksperimenter, der gør brug af kloner. Det er muligt at gøre heterozygous og homozygot målretning. I heterozygous reporter cellelinjer er allel uden en integrant tilbøjelige til at vise ændringer på Cas9 målretning websted, som kan blive screenet ved PCR (figur 4a). For homozygote målretning foreslår vi, at begge alleler være målrettet fortløbende.

Under hensyntagen til disse overvejelser, indeholder denne arbejdsproces et middel til at skabe kraftfulde cellulære modeller, der kan bruges til at øge forståelsen af kronisk HIV-infektion. For eksempel, kan proviral aktivitet i svar på latency-vende agenter afprøves i forbindelse med tilbagevendende integration websteder. Dette kan være af særlig interesse for forskere i feltet, da holdning effekter har været postuleret for at påvirke HIV ventetid og tilbageførsel22.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ikke noget at oplyse.

Acknowledgments

Vi takker Britta Weseloh og Bettina Abel for teknisk bistand. Vi takker også Arne Düsedau og Jana Hennesen (flow flowcytometri teknologiplatform, Heinrich Pette Institut) for teknisk support.

Materials

Name Company Catalog Number Comments
pX330-U6-Chimeric_BB-cBh-hSpCas9 Addgene 42230 vector for expression of SpCas9 and gRNA
pMK GeneArt mammalian expression vector for cloning
cDNA3.1 Invitrogen V79020 mammalian expression vector for cloning
BbsI New England Biolabs R0539S restriction enzyme
NEBuilder Hifi DNA Assembly Cloning Kit New England Biolabs E5520S Assembly cloning kit used for target vector generation
TaqPlus Precision PCR System Agilent Technologies 600210 DNA polymerase with proofreading activity used for amplification of homology arms (step 1.2.2.2), verification of integration site and reporter sequence (step 3.3.3 and 3.3.5), generation of genomic probe for Southern blot (step 3.4.1.5) and analysis of off-target events (step 3.5.4)
96-well tissue culture plate (round-bottom) TPP 92097 tissue culture plates for dilution plating
Phusion High-Fidelity DNA polymerase New England Biolabs M0530 L DNA polymerase used for detection of targeting events (step 2.4.2) and generation ofreporter-specific probe for Southern blot (step 3.4.1.4)
Dimethyl sulfoxide (DMSO) Sigma-Aldrich D9170 dimethyl sulfoxide as PCR additive
Magnesium Chloride (MgCl2) Solution New England Biolabs B9021S MgCl2 solution as PCR additive
Deoxynucleotide (dNTP) Solution Mix New England Biolabs N0447S dNTP mixture with 10 mM of each nt for PCR reactions
5PRIME HotMasterMix 5PRIME 2200400 ready-to-use PCR mix used for screening PCR (step 3.2.11)
QIAamp DNA blood mini kit Qiagen 51106 DNA isolation and purification kit
QIAquick PCR Purification Kit Qiagen 28106 PCR Purification Kit
RPMI 1640 without glutamine Lonza BE12-167F cell culture medium
Fetal Bovine Serum South Africa Charge PAN Biotech P123002 cell culture medium supplement
L-glutamine Biochrom K 0282 cell culture medium supplement
Penicillin/Streptomycin 10.000 U/mL/ 10.000 µg/mL Biochrom A 2212 cell culture medium supplement
Gibco Opti-MEM Reduced Serum Media Thermo Fisher Scientific 31985062 cell culture medium with reduced serum concentration optimized for transfection
TransIT-Jurkat Mirus Bio MIR2125 transfection reagent
phorbol 12-myristate 13-acetate Sigma-Aldrich P8139-1MG cell culture reagent
Ionomycin Sigma-Aldrich I0634-1MG cell culture reagent
Syringe-driven filter unit, PES membrane, 0,22 µm Millex SLGP033RB filter unit for sterile filtration
Heracell 150i incubator Thermo Fisher Scientific 51026280 tissue culture incubator
Amershan Hybond-N+ GE Healthcare RPN1520B positively charged nylon membrane for DNA and RNA blotting
Stratalinker 1800 Stratagene 400072 UV crosslinker
High Prime Roche 11585592001 kit for labeling of DNA with radioactive dCTP using random oligonucleotides as primers
illustra ProbeQuant G-50 Micro Columns GE Healthcare 28-9034-08 chromatography spin-columns for purification of labeled DNA

DOWNLOAD MATERIALS LIST

References

  1. Hughes, S. H., Coffin, J. M. What Integration Sites Tell Us about HIV Persistence. Cell Host and Microbe. 19, (5), 588-598 (2016).
  2. Marini, B., Kertesz-Farkas, A., et al. Nuclear architecture dictates HIV-1 integration site selection. Nature. 521, (7551), 227-231 (2015).
  3. Cesana, D., Santoni de Sio, F. R., et al. HIV-1-mediated insertional activation of STAT5B and BACH2 trigger viral reservoir in T regulatory cells. Nature Communications. 8, (1), 498 (2017).
  4. Cohn, L. B., Silva, I. T., et al. HIV-1 Integration Landscape during Latent and Active Infection. Cell. 160, (3), 420-432 (2015).
  5. Han, Y., Lassen, K., et al. Resting CD4+ T cells from human immunodeficiency virus type 1 (HIV-1)-infected individuals carry integrated HIV-1 genomes within actively transcribed host genes. Journal of Virology. 78, (12), 6122-6133 (2004).
  6. Ikeda, T., Shibata, J., Yoshimura, K., Koito, A., Matsushita, S. Recurrent HIV-1 integration at the BACH2 locus in resting CD4+ T cell populations during effective highly active antiretroviral therapy. The Journal of Infectious Diseases. 195, (5), 716-725 (2007).
  7. Wagner, T. A., Mclaughlin, S., et al. Proliferation of cells with HIV integrated into cancer genes contributes to persistent infection. Science. 345, (6196), 570-573 (2014).
  8. Maldarelli, F., Wu, X., et al. Specific HIV integration sites are linked to clonal expansion and persistence of infected cells. Science. 345, (6193), 179-183 (2014).
  9. Jordan, A., Bisgrove, D., Verdin, E. HIV reproducibly establishes a latent infection after acute infection of T cells in vitro. The EMBO Journal. 22, (8), 1868-1877 (2003).
  10. Mack, K. D., Jin, X., et al. HIV insertions within and proximal to host cell genes are a common finding in tissues containing high levels of HIV DNA and macrophage-associated p24 antigen expression. Journal of Acquired Immune Deficiency Syndromes. 33, (3), 308-320 (2003).
  11. Byrne, S. M., Ortiz, L., Mali, P., Aach, J., Church, G. M. Multi-kilobase homozygous targeted gene replacement in human induced pluripotent stem cells. Nucleic Acids Research. 43, (3), 1-12 (2014).
  12. ZhangLab. CRISPR Genome Engineering Toolbox: Target Sequence Cloning Protocol. Addgene website. Available from: https://www.addgene.org/static/cms/filer_public/e6/5a/e65a9ef8-c8ac-4f88-98da-3b7d7960394c/zhang-lab-general-cloning-protocol.pdf (2013).
  13. Moser, F. Addgene. Gibson Assembly Protocol. Addgene website. Available from: https://www.addgene.org/protocols/gibson-assembly/ (2009).
  14. Addgene Plasmid Cloning by PCR. Addgene website. Available from: https://www.addgene.org/protocols/pcr-cloning/ (2014).
  15. Addgene Plasmid Cloning by Restriction Enzyme Digest (aka Subcloning). Addgene website. Available from: https://www.addgene.org/protocols/subcloning/ (2013).
  16. Stemmer, M., Thumberger, T., Del Sol Keyer, M., Wittbrodt, J., Mateo, J. L. CCTop: An intuitive, flexible and reliable CRISPR-Cas9 target prediction tool. Public Library of Science (PLoS) ONE. 10, (4), (2015).
  17. Lange, U. C., Bialek, J. K., Walther, T., Hauber, J. Pinpointing recurrent proviral integration sites in new models for latent HIV-1 infection. Virus Research. 249, (2018).
  18. Bialek, J. K., Dunay, G. A., et al. Targeted HIV-1 Latency Reversal Using CRISPR-Cas9-Derived Transcriptional Activator Systems. PloS ONE. 11, (6), e0158294 (2016).
  19. Lee, C. M., Davis, T. H., Bao, G. Examination of CRISPR-Cas9 design tools and the effect of target site accessibility on Cas9 activity. Experimental Physiology. 103, (4), 456-460 (2018).
  20. Jensen, K. T., Fløe, L., et al. Chromatin accessibility and guide sequence secondary structure affect CRISPR-Cas9 gene editing efficiency. FEBS Letters. 591, (13), 1892-1901 (2017).
  21. Simonetti, F. R., Sobolewski, M. D., et al. Clonally expanded CD4 + T cells can produce infectious HIV-1 in vivo. Proceedings of the National Academy of Sciences. 113, (7), 1883-1888 (2016).
  22. Chen, H. C., Martinez, J. P., Zorita, E., Meyerhans, A., Filion, G. J. Position effects influence HIV latency reversal. Nature Structural and Molecular Biology. 24, (1), 47-54 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics