CRISPR-Cas9-baserte genomet Engineering generere Jurkat Reporter modeller for HIV-1 smitte med valgte Proviral integrasjon nettsteder

* These authors contributed equally
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Vi presenterer en genomet engineering arbeidsflyt for generering av nye i vitro modeller for HIV-1 smitte som recapitulate proviral integrering på utvalgte genomisk områder. Målretting av HIV-avledet journalister er tilrettelagt av CRISPR-Cas9-mediert, områdespesifikke genomet manipulasjon. Detaljert protokoller for encellede klone generasjon, screening og riktig målretting verifisering tilbys.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Bialek, J. K., Walther, T., Hauber, J., Lange, U. C. CRISPR-Cas9-based Genome Engineering to Generate Jurkat Reporter Models for HIV-1 Infection with Selected Proviral Integration Sites. J. Vis. Exp. (141), e58572, doi:10.3791/58572 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Humant immunsviktvirus (HIV) integrerer sin proviral DNA ikke-tilfeldig i verten celle genomet tilbakevendende nettsteder og genomisk hotspots. Her presenterer vi en detaljert protokoll for generering av romanen i vitro modeller for HIV-infeksjon med valgte genomisk integrering webområder ved hjelp av CRISPR-Cas9-baserte genomet engineering-teknologi. Med denne metoden kan en reporter rekke valg integreres i et målrettet, valgte genomisk locus, reflekterer klinisk relevante integrering nettsteder.

I protokollen, er utformingen av en HIV-avledet reporter og velge av et mål sted og gRNA beskrevet. En målretting vektor med homologi våpen er konstruert og transfekterte i Jurkat T celler. Reporter sekvensen er målrettet genomisk området av homologe rekombinasjon tilrettelagt av en Cas9-mediert dobbel-strand pause på målområdet. Encellede kloner er generert og vist for målretting hendelser av flowcytometri og PCR. Valgte kloner deretter utvides, og riktig målgruppe er bekreftet av PCR, sekvensering og Southern blotting. Potensielle off-målet hendelser av CRISPR-Cas9-mediert genomet engineering analyseres.

At modellen HIV-smitte på klinisk relevante integrering nettsteder kan genereres ved hjelp av denne protokollen, romanen celle kultur systemer. Selv om generering av encellede kloner og verifisering av riktig reporter sekvens integrering er tidkrevende, er resulterende klonal linjene kraftige verktøy for å analysere funksjonelt proviral integrasjon området valg.

Introduction

Integrering av proviral DNA i vert genomet på infeksjon er en avgjørende skritt i livet syklus av humant immunsviktvirus (HIV). Etter integrasjon, HIV vedvarer ved å etablere ventetid i varige CD4 + T celle undergrupper som minne CD4 + T celler. HIV integrering synes å være ikke tilfeldig1,2. En rekke genomisk hotspots med recurrently integrerte proviral DNA påvist i flere studier gjennom sekvensering av integrering i akutt og kronisk infiserte individer2,3,4 ,5,6,7,8. Interessant, på noen av disse integrasjon, ble samme locus oppdaget i en stor andel av infiserte celler, fører til ideen at integrering på tilbakevendende nettsteder kan positivt påvirke klonal ekspansjon1.

For å fremme vår forståelse av betydningen av tilbakevendende integrering nettsteder, må proviral integrasjon området valg utforskes. Imidlertid flere tekniske aspekter hemme studere HIV integrering valg og konsekvensene. Bredt brukt celle kultur modeller for HIV ventetid som JLat cellelinjer ikke reflekterer klinisk relevante tilbakevendende integrering nettsteder9. Studier på primære pasient-avledede celler, på den ene siden, aktiverer beskrivelse av integrasjon området landskap av sekvensering men tillater ikke for funksjonell analyser. Til vår kunnskap er ingen tilstrekkelig eksperimentell modell tilgjengelig funksjonelt analysere valgte klinisk relevante integrering nettsteder.

Her presenterer vi en detaljert arbeidsflyt for å generere nye modeller for HIV-smitte ved hjelp av CRISPR-Cas9-baserte genomet engineering teknologi. Arbeidsflyten beskrevet her kan brukes til å generere T celle-avledet reporter linjer som modell HIV-smitte, bærer genomically integrert proviral reporter på et valgt integrering område. De er dermed fungerer som nye verktøy for å utforske hvordan webområdet proviral integrering kan påvirke HIV biologi og hvordan provirus reagerer på ulike behandling strategier (f.eks, inducibility av ventetid snu agenter). Vår metode bruker fordelene av CRISPR-Cas9-baserte genomet engineering, i hvilken integrering av reporteren sekvensen homologe rekombinasjon er tilrettelagt av en Cas9 nuclease-indusert dobbel-strand pause på målområdet. Målområder for integrering er valgt etter avstand til beskrevet tilbakevendende integrering nettsteder fra studier på HIV-infiserte individer og tilstedeværelsen av egnet PAM motiver Cas9-mediert genomet engineering.

I våre eksemplarisk resultater, har vi fokusert på BACH2 gene locus, hvilke koder for BTB og CNC homologi transcriptional regulator 2. Kronisk HIV-infiserte individer på antiretroviral behandling er BACH2 en av loci viser berikelse av integrert HIV-1 sekvenser3,6,7,8,10. Vi har valgt en minimal HIV-avledet reporter bestående av HIV-1-derivert lang terminal gjenta (VTH), tdTomato koding sekvens og storfe veksthormon (BGH) polyadenylation signal (PA), som vi har rettet mot to bestemte områder i BACH2 intron 5. Presentert protokollen er optimalisert for Jurkat celler, en menneskelig CD4 + T celle-avledet suspensjon cellen linje, men andre cellen linjer kan brukes og protokollen tilpasset deretter. Vi presenterer en detaljert arbeidsflyt for valg av målområdet, bygging av målet vektor med homologi armer, CRISPR-Cas9-mediert målretting av reporteren i valgt genomisk område, generasjon og valg av klonal linjer og omfattende bekreftelse nyopprettede, målrettet reporter cellen linjer.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. målretting strategi for genomet Engineering og målretting vektor (tv) Design

Merk: Det første trinnet i genomet engineering innebærer utvalg og generering av de nødvendige verktøyene for CRISPR-Cas9-mediert målretting. Utvalg av et genomisk integrering området locus, valg av celle type for målretting og design av en HIV-avledet reporter for integrasjon bør foran dette trinnet. Denne protokollen beskriver målretting av en HIV-LTR_tdTomato_BGH-PA minimal reporter i Jurkat målcellene. Et flytskjema for arbeidsflyten for CRISPR-Cas9-baserte målretting, generasjon, screening og verifisering av klonal linjer er avbildet i figur 1. Den beskrevet målretting bruker S. pyogenes -Cas9 (SpCas9) til å generere gRNA-rettet dsDNA bryter hos en valgte integrering. Reporteren skal deretter inn valgte genomisk locus gjennom homologe rekombinasjon ved å gi en ikke-linearized målretting vektor (tv) som inneholder reporter sekvensen flankert av såkalte homologi armene (HA)11-med 5' og 3.

  1. Valg av målrettet locus, gRNA og målretting vektor design
    1. Velg thegenomic locus bli målrettet basert på personlige vitenskapelige spørsmålet. Bruk publiserte lister av tilbakevendende integrering av HIV funnet hos pasienter i ulike studier2,3,4,5,6,7,8 som en retningslinje. I sili ekstra genomisk sekvensen av ønsket genomisk locus målrettet (sekvens av komplett genet) eller minst 5 kb av genomic UCSC genomet webleser (http:// genome.edu.ucsc.edu).
    2. Velge guide RNAs (gRNAs) på 20 nt for målretting av valgte genomisk locus bruker E-skarp webtool (http://www.e-crisp.org).
      1. Velg "Homo sapiens GRCh38" som organismen. Input 2000 bp av genomisk sekvensen dekker ønsket genomisk locus pakket ut i trinn 1.1.1.
      2. Starte et gRNA søk med middels programinnstillinger (alle PAM, en 5' base av mål tolerere uoverensstemmelser og introns/CPG øyene er ekskludert). Vises en liste med mulige gRNA design, ranking fra høyeste til lavere score for spesifisitet og effektivitet.
      3. Velg en gRNA som helst viser en høy poengsum for spesifisitet og effektivitet og er så nær som mulig til ønsket genomisk locus bli målrettet.
        Merk: Et kompromiss mellom nærhet til ønsket genomisk locus og utformingen av bestemte og effektiv gRNA har funnet.
    3. Blast valgte gRNA sekvensen mot referanse genomet ved hjelp av NCBI eksplosjon leseren (https://blast.ncbi.nlm.nih.gov) etter unike gRNA binding området.
      1. Velg "menneskelige" som genomet. Input gRNA sekvensen som spørringen sekvensen. Velg "ligner sekvenser" (megablast) som programmet. Kontroller at gRNA sekvensen er unik. Hvis ikke, valgte en annen gRNA fra trinn 1.1.2.3 og blast igjen.
    4. Når gRNA sekvensen er valgt, velger du i sili 1000 bp oppstrøms og nedstrøms av gRNA fra genomisk sekvens pakket ut i trinn 1.1.1 som 5' og 3' HA tilsvarende.
      Merk: GRNAs skal homologe til valgte genomisk integrering området locus og beliggenhet ved siden av en protospacer tilstøtende motiv (PAM, for eksempel, NGG for SpCas9) (figur 2a). Tv inneholder reporter sekvensen som er 5' og 3' flankert av har. Har dekker 1000 bp oppstrøms og nedstrøms gRNA sekvens11. Full gRNA sekvensen skal ikke inkluderes i HA. Overlapp opptil 5 nt er akseptabel (figur 2a).
  2. Generering av gRNA og målretting vektorer
    Merk: Vektor ordninger, se figur 2b.
    1. Vil generere en vektor uttrykk for SpCas9 og gRNA, bruk den pX330-U6-Chimeric_BB-cBh-hSpCas9 som ryggraden som både SpCas9 og enkel guide RNA (sgRNA) kan samtidig uttrykkes. For å klone gRNA sekvensen i ryggraden, bruk BbsI begrensning nettsteder12.
    2. Vil generere TVen, velger du en høy-kopi plasmider som ryggraden (f.eks, pMK eller cDNA3.1).
      1. Først montere reporteren (i denne protokollen: LTR_tdTomato_BGH-PA) i konstruere ryggraden av Gibson montering clong13 med en kommersiell forsamling kloning kit og introdusere 5' og 3' flankert begrensning områder (f.eks, 5' PacI og 3 SmaI) for påfølgende begrensning fordøyelsen kloning av har.
      2. Forsterke 1000 bp av HA fragmenter valgt i trinn 1.1.4 fra genomisk DNA (gDNA) av celle type bli målrettet (i denne protokollen: Jurkat celler) bruker en DNA polymerase med korrekturlesing aktiviteten (se tabell 1 og 2 for PCR ingredienser og Sykling forhold). Deretter introdusere reporter flankert begrensning nettsteder på 5' og 3 endene av hver HA (PacI på 5' HA på begge ender, SmaI på 3' HA i begge ender).
      3. Sekvensielt har klone i konstruere ryggraden allerede inneholder reporteren (generert i trinn 1.2.2.1) av begrensning enzymet kloning14,15. Først klone i 5' HA bruker PacI begrensning områder, deretter klone i 3' HA bruker SmaI begrensning nettsteder.
        Merk: Hvis tv ryggraden inneholder en ekstra fluorescerende reporter, uønskede ryggraden integrering kan vurderes av flowcytometri (se trinn 3.2.2 og 3.2.3). Hvis tv ryggraden inneholder ingen fluorescerende reporter, ryggraden integrasjon må vurderes bruker PCR (se trinn 3.2.8).

Figure 1
Figur 1: arbeidsflyt for CRISPR-Cas9-mediert målretting generasjon og valg av klonal reporter linjer med definerte integrering området. (A) generere målet vektoren og transduce Jurkat T-celler med målet vektor og Cas9/gRNA uttrykk plasmider. (B) rikere transfekterte celler 72 h innlegget transfection av FACS. (C) la cellene vokse for 10 til 14 dager og bekrefte forekomsten av målretting hendelser etter PCR og flow cytometri. (D) Generer encellede kloner ved å begrense fortynning og la kloner vokse i 3 uker. (E) skjermen kloner for riktig målretting av PCR og flow cytometri i 96-brønnen format. Utvid valgte kloner. (F) kontrollere riktig målgruppe i valgte kloner av sørlige blot, PCR og sekvensering og analyse av off-målet hendelser Cas9 endonuclease aktivitet. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: målretting strategi og vektor. (en) gRNA og valg av homologi våpen. 20 nt gRNA er homologe til valgte genomisk målområdet og ved siden av en PAM. homologi er utfyllende til 1000 bp-opp- og nedstrøms i gRNA og kan ikke inkludere gRNA sekvensen. (b) skjematisk av vektor og gRNA/Cas9 vektor. Målretting vektoren består av valgte reporter sekvensen som er 5' og 3' flankert av homologi armene. GRNA/Cas9 vektoren er basert på pX330-U6-Chimeric_BB-cBh-hSpCas9 ryggraden. (c) skjematisk av målretting av homologe rekombinasjon. Målet vektor og guideRNA/Cas9 vektor er transfekterte i Jurkat celler. Cas9 formidler en dobbel strand pause på genomisk målområdet (angitt av *) og forenkler homologe rekombinasjon og integrering av reporteren i genomisk målet locus. Klikk her for å se en større versjon av dette tallet.

2. CRISPR-Cas9-basert målretting av Jurkat celler

  1. Hva Jurkat celler
    1. 24 timer før transfection, plate 1,25 x 106 Jurkat T celler i 2,5 mL av RPMI 1640 supplert med 10% (v/v) fetal kalv serum (FCS) og 4 mM L-glutamin [referert til som "RPMI w.o. antibiotika (AB)"] per brønn av en 6-vel celle kultur plate. For et enkelt målretting eksperiment, forberede en komplett 6-vel plate (dvs., 6 brønner med 2,5 mL av cellen suspensjon).
    2. Dagen, co transfect cellene med sirkulær tv og pX330-U6-Chimeric_BB-cBh-hSpCas9/gRNA bruker en transfection reagens bestemt Jurkat celler.
      1. Legge 2 µg sirkulær TV og 2 µg av pX330-U6-Chimeric_BB-cBh-hSpCas9/gRNA per brønn til 250 µL av kommersielle RPMI medium med redusert serum konsentrasjonen optimalisert for hva (RPMI med 50% reduksjon i serum) i en reaksjon rør og bland godt.
      2. Legge til 12 µL av transfection reagensen sakte til DNA/medium uten å berøre veggen av røret og virvel. La blandingen ruge i 15 min og legge dropwise til en brønn av celler. Inkuber cellene på 37 ° C og 5% CO2.
        Merk: Utarbeidelse av hva reaksjon kan besteget. Ingen medium endring er nødvendig etter hva.
  2. Anriking av transfekterte celler av fluorescens-aktivert celle sortering (FACS)
    1. 72 h etter transfection, basseng transfekterte cellene, telle dem og forberede for anriking av FACS. Samle cellene i en 50 mL konisk tube, sentrifuger på 300 x g og romtemperatur (RT) for 4 min, vaske cellene i PBS, sentrifuge igjen, utsette pellets i en passende mengde FACS buffer (PBS med 1% FCS + 1 mM EDTA) på 1 x 10 7 celler/mL, og til slutt overføre i en FACS rør.
    2. Underlagt cellene FACS og sortere de som uttrykker fluorescerende reporteren TV (f.eks, tdTomato i denne protokollen). Samle cellene i RPMI 1640 supplert med 10% FCS, 4 mM L-glutamin, og 50 U/mL penicillin og streptomycin (referert til som "RPMI med AB").
    3. Etter FACS sortering, vaske cellene gang ved å legge til 20 mL RPMI med AB sorterte celler og sentrifuge 300 x g for 4 min på RT. Resuspend celle pellet i en passende mengde RPMI med AB og plate cellene i en brønn av en celle kultur plate med den riktig volum etter celle nummer innlegg-FACS.
      Merk: Kultur sortere cellene i et lite volum (f.eks, 24-vel), som betydelige nivåer av celledød er observert i den første uken etter målretting (opp til 80-90%).
    4. Utvid befolkningen blandet målrettet cellen til en tetthet på 1 x 106 celler/mL i en 75 cm ² celle kultur kolbe. Dette vil ta rundt 10-14 dager innlegg-FACS sortering.
  3. Bekreftelse av målretting hendelser av flowcytometri i befolkningen blandet målrettet celle
    1. Etter 10-14 dager med utvidelse (når celler har nådd en tetthet på 1 x 106 celler/mL i en 75 cm2 celle kultur kolbe), målrettet plate to brønner med 1 x 106 celler i den blandede celle befolkningen i 1 mL av RPMI med AB i en 12-vel cellekultur plate.
    2. Indusere av HIV LTR reporteren (generasjonen av tv er beskrevet i trinn 1.2.2.1.) i en av brønnene ved å legge til 50 ng/mL phorbol 12-myristate 13-acetate (PMA) og 1 µM Ionomycin (referert til som PMA-Iono). Bruke celler i andre brønnen som kontrollen ikke-indusert. Kultur både den indusert og ikke-indusert celler for 24 timer.
    3. Ta 0,5 mL av cellen suspensjon av ikke-indusert og indusert celler (hver), vaske dem en gang i PBS og suspendere hver i 200 µL FACS bufferen.
    4. Analysere 100.000 celler av flowcytometri. Gate levedyktig single-cellene basert på størrelsen i fremover og sidelengs scatter og analysere fluorescerende reporter genuttrykk.
      Merk: På dette trinnet (10-14 dager innlegg-FACS sortering), forbigående uttrykk for fluorescerende reporter av hva bør ikke lenger være synlig. Fluorescerende uttrykk på dette tidspunkt angir genomisk integrering av reporteren sekvens.
  4. Påvisning av målretting hendelser etter PCR på genomisk DNA av befolkningen blandet målrettet celle
    Merk: å oppdage målretting arrangementer via PCR, design to primer par spesifikke for integrering (int.) krysset 5' og 3 int. junction. For 5' int. krysset PCR, frem primer skal bindes oppstrøms av de 5' HA og omvendt primer i LTR av reporteren (primere P1 og P2 i figur 3a). Primer paret for 3 int. krysset PCR bør omfatte fra PA av reporteren til 100-200 bp nedstrøms av de 3' HA (primere P3 og 4 vr figur 3a). Primere P1 og P4 vil også tjene for forsterkning av det ikke-målrettede allelet i befolkningen blandet målrettet. Hvis en skjematisk, se figur 3a.
    1. Forberede gDNA fra 2 mL celle suspensjon av befolkningen blandet målrettet celle fra trinn 2.2.4. Bruk en gDNA utvinning utstyr i henhold til produsentens protokollen. Deretter forberede gDNA av ikke-målrettede celler som en kontroll.
    2. Utføre int. krysset PCRene (primere P1/P2 og P3/P4 for 5' og 3 int. junction, henholdsvis) og ikke-målrettede allelet PCR (primere P1/4) bruker en høy-troskapen DNA polymerase (se 3 og 4 for PCR ingredienser og sykling betingelser) . Analysere 5 µL av PCR-produkter på en 1,5% agarose/TAE gel.
      Merk: Hvis befolkningen blandet målrettet inneholder celler som har gjennomgått genomet engineering, PCR enkeltprodukter bør være observert som ikke er i gDNA av ikke-målrettede celler (negativ kontroll). For de ikke-målrettede allelet PCR, bør man merke et produkt av samme størrelse for både målrettet og ikke-målrettede cellene (positiv kontroll for genomisk P1 og P4 primere). Hvis ingen band er observert, kan du vurdere å endre PCR sykling betingelser ved å øke antall sykluser eller endre PCR bufferen (for eksempel gjennom tillegg av DMSO eller økte mengder Mg2 +) eller ved å endre utvalg.

3. generasjon klonal linjer og Screening for riktig målgruppe

Merk: Etter bekreftelse av målretting hendelsene i befolkningen blandet målrettet cellen ved flowcytometri og PCR (deler 2.2-2,4), generere encellede kloner (varighet: 28 til 35 dager) og for riktig integrering av reporteren sekvensen.

  1. Generasjon av encellede kloner gjennom fortynning plating
    1. Forberede Jurkat-conditioned medium på forhånd: ta av RPMI med AB medium fra sunne, ubehandlet Jurkat T-celler vokst til 1 x 106 celler/mL, sentrifuge for 5 min på 300 x g, og filtrere nedbryting bruker en 0.22 µm sprøyte filter enhet.
      Merk: Holde betinget mediet på 4 ° C for kortsiktige lagring eller på 20 ° C for lagring lengre enn 1 uke. Forberede 20 til 30 mL av betinget medium før fortynning plating.
    2. Telle målrettet celler fra trinn 2.2.4 etter 10-14 dager i ekspansjon og fortynne dem i RPMI med AB til en konsentrasjon av 1 x 105 celler/mL. Ta 100 µL av 1 x 105 celler/mL løsning og fortynn med 9,9 mL medium for å oppnå en konsentrasjon av 1000 celler/mL. Ta 1 mL av 1000 celler/mL løsning og fortynn med 9 mL medium for å oppnå en konsentrasjon av 100 celler/mL.
    3. Plate 96-brønns plater som inneholder 1 celler per brønn og 2 celler per brønn. For 1 celle per brønn, ta 1 mL av 100 celler/mL løsning og bland forsiktig med 5 mL av betinget medium og 4 mL frisk medium i et sterilt reagens reservoar.
    4. For 2 celler per brønn, ta 2 mL av 100 celler/mL løsning og bland forsiktig med 5 mL betinget middels og 3 mL frisk medium. Plate 96-brønns runde bunn plater med 100 µL av respektive celle fortynning per godt med en flerkanals pipetter.
      Merk: 5 til 10 96-brønns plater per målretting konstruksjon er tilstrekkelig for å oppnå kloner for screening.
    5. Stable de 96-brønns platene dekke hver bunke med en 6-vel plate inneholder 3 mL PBS i hver brønn og ruge platene på 37 ° C i en fuktet celle kultur inkubator med 5% CO2 i 3 uker.
      Merk: Endrer ikke celle kultur medium i denne perioden. Ikke åpne inkubator mer enn én eller to ganger i uka. De beste resultatene er observert i inkubatorer med åpent vann reservoaret.
    6. Etter 3 uker med inkubering, visuelt påvise vokst kolonier bruker * lys (4 X forstørrelse) og merke brønner med voksen kolonier slik de vises som punkter på bunnen av brønnene.
    7. Forberede en 96-brønns runde bunn plate med 100 µL av RPMI med AB per brønn. Forsiktig resuspend cellene i en merket godt av pipettering. Overføre 100 µL av cellen suspensjon i en brønn av nye 96-brønns platen allerede inneholder 100 µL av RPMI med AB, og bland forsiktig av pipettering. Overføre 100 µL av denne cellen suspensjon til en andre tomme 96-brønns runde-bunnplaten kopiere platen.
    8. Fortsett med alle merkede brønner med voksen kolonier. Fylle alle tomme brønnene med 200 µL av RPMI med AB medium. Inkuber platene på 37° C og 5% CO2.
      Merk: En av disse platene vil tjene for utvidelse av encellede kloner ("lager plate") og den andre som en "like plate" for screening.
  2. Screening av encellede kloner av flowcytometri og PCR
    Merk: Mens encellede kloner utvider, bruker like platen fra trinn 3.1.8 til skjermen encellede kloner for tilstedeværelsen av reporteren sekvensen PCR (trinn 3.2.4–3.2.12) og uttrykk for fluorescerende reporter av flowcytometri (trinn 3.2.2–3.2.3) (Figur 3 c).
    1. La like platen ruge 24 til 48 h og kopiere platen igjen. Vil legge 100 µL av RPMI med AB i hver brønn, bland forsiktig av pipettering og overføre 100 µL til en ny runde 96-brønns bunn plate ved hjelp av en flerkanals pipetter. Bruke en plate for flyt cytometri screening og den andre for PCR-basert screening.
    2. For flyt cytometri screening, stimulere cellene med PMA-Iono. Forberede en mastermix av 0,1 µL av Ionomocin (1 mM lager), 0.1 µL av PMA (50 µg/µL lager), og 4,8 µL av RPMI med AB per antall brønner, deretter legge 5 µL av mastermix per brønn.
      Merk: Induksjon er nødvendig for å kunne identifisere kloner, der LTR kan være transcriptionally stille og derfor fluorescerende reporteren ikke er uttrykt.
    3. La cellene ruge 24 h og forberede celler flowcytometri som beskrevet i trinn 2.3.3. Gate levedyktig single-celler basert på størrelsen i fremover og sidelengs scatter og analysere fluorescerende reporter genuttrykk av flowcytometri (for eksempel resultater, se Figur 3 c). Hvis tv ryggraden inneholder andre fluorescerende reporter med arrangøren (f.eks, GFP), skjermen noen kloner ryggraden reporter uttrykk også (se trinn 1.2.2 og følgende merknad for forklaring).
      Merk: Ryggraden reporter uttrykket indikerer uønskede integrering av ryggraden sekvenser.
    4. Når kloner i like platen har vokst nok (vanligvis 24 til 48 h etter duplisering av 96-brønns plate), forberede celle lysates som inneholder gDNA for PCR screening. Sentrifuger platen i 10 min på 300 x g ved RT. nøye ta av nedbryting uten å forstyrre det cellen pellet.
      Merk: Alle trinnene for utarbeidelsen av lysates og PCR reaksjoner kan utføres med flerkanals pipetter.
    5. Vask celler med 100 µL av PBS av mild pipettering og sentrifugering platen i 5 min på 300 x g ved RT. Ta av PBS og legge 200 µL av lyseringsbuffer [200 mM NaCl, 100 mM Tris-HCl pH 8-8.5, 5 mM EDTA, 0,1% SDS, legg deretter til 250-1000 µg/mL av proteinasen K (lyofiliserte pulveret, veie i fersk)] per brønn. Bland forsiktig av pipettering og overføre suspensjon til en ny PCR-plate.
    6. Seal platen med parafin film og ruge 1t ved 55 ° C i en thermocycler. Sentrifuge med maksimal hastighet i 10 min (3000 x g) å spinne ned celle rusk og overføre nedbryting til en ny PCR-plate.
      Merk: Celle lysates i plater kan lagres på dette stadiet i 4 ° C til fremme bruk.
    7. Forberede en 96-brønns PCR plate med 110 µL av dH2O og legge til 10 µL av celle lysate (1:12 fortynning). Celle lysates kan være flytende og vanskelig å pipetter. Bruke minst 20 µL Pipetter tips.
    8. Deaktiver proteinasen K av inkubasjonstiden for 10 min på 99 ° C i en thermocycler. Deretter bruke deaktivert og utvannet celle lysates for PCR screening.
    9. Utforme primere for screening PCR (P5 og P6) basert på valgte reporter rekkefølgen til forsterke 500-800 bp av reporteren sekvensen. Positiv kontroll PCR, bruke grunning P7 og P8 som utdyper 630 bp av en vill-type, ikke-målrettede genomisk locus (NUP188 gen) (Figur 3 c og tabell 5). Utforme et tredje primer par som forsterker 500-600 bp av tv ryggraden som en kontroll for uspesifikke integrering av tv ryggraden sekvenser (backbone PCR).
    10. Screening, kontroll og ryggraden PCR, bruke en kommersiell PCR-mastermix (se tabellene 6 og 7 for PCR ingredienser og sykling forhold). Bruk 2 µL av utvannet og deaktivert lysate forberedt i trinn 3.2.8 som mal og kjøre PCR for 38-40 sykluser PCR forsterkning i 96-brønnen format.
    11. Analysere 5 µL av PCR-produkter på en 1,5% agarose/TAE gel.
      Merk: For kontrollen PCR, en bestemt gjeng 630 bp observeres for hver prøve, bekrefter at kvaliteten på cellen lysates er tilstrekkelig for PCR. Et bestemt band i screening PCR (500-800 bp avhengig av primer design) angir integrering av reporteren sekvensen. Et bestemt band for ryggraden PCR (500-600 bp, avhengig av primer design) angir uønskede integrering av tv ryggraden sekvenser (for eksempel resultater, se Figur 3 c).
    12. Kombinere resultatet av flowcytometri (trinn 3.2.3) og PCR-basert screening (trinn 3.2.12). Velg kloner som viser riktig størrelser PCR produkter i screening PCR og positiv kontroll PCR og uttrykk for fluorescerende reporter etter induksjon med PMA-Iono i flowcytometri. Ekskludere kloner som viser PCR produkter i ryggraden PCR eller uttrykk tv ryggraden-kodet fluorescerende protein, indikerer uspesifikke integrering av tv ryggraden.
    13. Gradvis utvide valgte kloner fra 96-brønns lager platen til større godt formater (48/24/12/6-vel) til å oppnå en MT75 kultur kolbe celleformatet ved å legge friske medium hver 2-3 dager. Opprettholde en celle tetthet mellom 1 x 105 og 1 x 106 celler/mL.
    14. Sørg for å forberede cellen kloner lagerfører under utvidelse: telle celler, sentrifuge 300 x g i 5 min på RT, forkaste nedbryting og suspendere cellene forsiktig i FCS + 10% DMSO på 5 x 106 celler/mL. Aliquot i Kryogenisk ampuller og bruke en cryo-Underkjølt container fryse cellene til 80 ° C på 1 ° C/min. For langtidslagring, overføre dem til flytende N2.
      Merk: Det anbefales å beholde en MT75 celle kultur kolbe (dvs., rundt 1 x 107 celler) under utvidelse i utarbeidelsen av gDNA for bekreftelse av målretting av Southern blotting (se avsnitt 3.4).
  3. Bekreftelse av integrering av PCR/sekvensering valgte kloner
    Merk: 5' og 3 int. veikryss valgte kloner er PCR forsterket og sendt til Sanger sekvensering å bekrefte riktig målgruppe på DNA sekvensen nivå.
    1. Forberede gDNA valgte kloner og Jurkat vill-type celler ved hjelp av en kommersiell gDNA utvinning kit.
    2. Bruk primer par bindende 5' slutten av reporteren og over 5' HA for 5' int. krysset (primere P1 og P2) og 3 slutten av reporteren og nedstrøms 3' HA for 3 int. krysset (primere P3 og P4) som beskrevet i trinn 2.4. Bruk primere P1 og P4 for å forsterke området målrettet integrering på allelet uten reporter integrant (figur 4a).
    3. Forberede PCR reaksjoner med 100-200 ng gDNA som en mal og utføre PCR med et utvalg med korrekturlesing aktiviteten (se tabell 1 og 2 for PCR ingredienser og sykling forhold).
      Merk: Hvis ingen band er observert, kan du vurdere å endre PCR sykling betingelsene ved å øke antall sykluser eller endre PCR bufferen (for eksempel ved å legge DMSO eller økte mengder Mg2 +), eller ved å endre utvalg.
    4. Analysere 5 µL av PCR-produkter på en 1,5% agarose/TAE gel. Hvis riktig bandet størrelser er observert, rense gjenværende PCR produktet ved hjelp av en kommersiell kit og utsett den for Sanger sekvensering. Kontrollere sekvenser av 5' int. junction, 3 int. junction og målrettede området av allelet uten reporter integrant ved å samkjøre med forventet sekvenser.
      Merk: Det homologe allelet der reporteren ikke har integrert vil trolig vise Cas9-mediert endringer på webområdet, for eksempel nukleotid innsettinger eller slettinger (figur 4a).
    5. Kloner som viser riktig int. krysset sekvenser etter justering, utføre en PCR forsterke hele målrettet reporteren og utsett den for Sanger sekvensering å kontrollere riktig sekvens i den integrant.
  4. Sørlige blot analyse for bekreftelse av målretting i valgte kloner
    Merk: Sørlige blot analyse av valgte kloner er nødvendig for å bekrefte riktig målgruppe og utelukke Cas9-mediert rekombinasjon hendelser som har oppstått på webområdet målrettet integrering.
    1. Utvikle en strategi for aktuelle gDNA fordøyelsen og undersøke utformingen før du starter eksperimentet.
      1. Velg en begrensning enzymet for gDNA begrensning som genererer passende fragmenter av 2 til 10 kb lengden på målrettede området. Visse restriksjoner enzymer, for eksempel Asp718 BamHei, Bgljeg, BglII, EcoRV, HindIII, NcoI Pstjeg, PvuII, Scajeg, StuI, og SST Jeg har blitt brukt for fordøye molekylvekt gDNA.
      2. Utforme to forskjellige sørlige sonder: en reporter-spesifikke sonde og genomisk sonde. Reporter-spesifikke sonden arten til en sekvens innenfor reporteren (dvs., tdTomato-spesifikke sonde). Genomic sonden arten en genomisk regionen nær (men ikke overlapper) en HA.
      3. Velge genomisk sonden fragmentet generert av gDNA fordøyelsen som vil bli oppdaget av genomisk sonde bindingen varierer i lengde (mer enn 2 kb) målrettet og ikke-målrettede alleler (figur 4b). En sonde lengde på 400 til 1000 bp anbefales.
      4. Design PCR primere å forsterke to nødvendige sonder. Forsterke reporter-spesifikke sonden tv malen bruker en høy-troskapen DNA polymerase (se 3 og 4 for PCR ingredienser og sykling forhold).
      5. Forsterke genomisk sonden fra vill-type Jurkat gDNA med en kommersiell gDNA utvinning kit med en DNA polymerase korrekturlesing aktiviteten (se tabell 1 og 2 for PCR ingredienser og sykling forhold). Rense PCR produktene på en agarose/TAE gel og ekstra fragmenter med en kommersiell gel utvinning utstyr i henhold til produsentens instruksjoner.
    2. Ekstra høy molekylvekt gDNA fra 1 x 107 celler av vill-type Jurkat celler og valgte kloner fra trinn 3.2.14.
      1. Pellets cellene med sentrifugering på 300 x g i 5 min på RT vaske det en gang med PBS og avbryte pellet 4 mL lyseringsbuffer [200 mM NaCL, 100 mM Tris-HCl pH 8, 5 mM EDTA, 0,1% SDS, legg deretter til 250-1000 µg/mL proteinasen K (lyofiliserte pulveret veier fersk)]. Inkuber o/n ved 55 ° C, rister på 350 rpm i en tabletop thermomixer.
      2. Legg 4 mL isopropanol og bland ved inversjon 10-20 ganger. GDNA bør bli synlig som hvit utløse. Spole utfelt gDNA på fine spissen av en glass pipette, vask av nye i 750 µL av 70% EtOH, og la tørr på RT (5-10 min).
      3. Kaste føre til en 1,5 mL reaksjon rør som inneholder 500 µL 1 x TE bufferen (10 mM Tris-HCl pH 8.0, 1 mM EDTA) og la oppløse o/n ved 4 ° C, rister på 350 rpm. Noen pipettering av gDNA fra dette stadiet bør gjøres med bred-fødte tips unngå klipping.
        Merk: Utarbeidelse av høy molekylvekt gDNA er avgjørende for sørlige blot analyse, og kommersielt tilgjengelig gDNA forberedelse kits er ikke egnet.
    3. Digest (to ganger) 15 µg av gDNA valgte kloner og vill-type Jurkat celler med valgte begrensning enzym (se trinn 3.4.1.1) i en 60 µL reaksjon med 6 µL av enzym (20 enheter/µL): først legge DNA, fordøyelsen buffer og ddH2O, ruge o/n på 37 ° C , deretter legger enzym og ruge o/n enzym-spesifikke fordøyelsen temperatur. 15 ug av fordøyd gDNA kreves per sørlige sonde.
    4. Bruke 7 µL av 60 µL begrensning sammendraget for analytisk gel geleelektroforese på en 1% agarose/TAE gel. En smear angir fullstendig fordøyelsen og DNA god for sørlige blot analyse.
    5. Utløse gjenværende begrensningen sammendraget ved å legge til 1:10 3 M natrium acetate og 2 volumer 100% EtOH, deretter ruge 1t-80 ° C og sentrifuge for 30 min 15,600 x g på 4 ° C.
    6. Forkaste nedbryting og vaske pellets med 70% EtOH. Virvel i 15 min 15,600 x g på 4 ° C, forkaste nedbryting, la pellet tørr kort på RT, og løses i 20 µL av ddH2O.
    7. Kjøre 1% agarose/TAE blotting gel, lasting 20 uL av fordøyd gDNA per kjørefelt. Kjøre gel 2 h på 60 V, 400 mA.
      Merk: Prosenten av agarose gel og kjører tid/spenning kan justeres i henhold til forventet fragment størrelse for sørlige blot gjenkjenning beregnet i trinn 3.4.1.1. Følgende sørlige blot analyse er beskrevet i detalj i en supplerende protokoll (trinn 1 til 18). Disse trinnene omfatter av: Vask av blotting gel, blotting på en nylon membran, radioaktivt sonde generasjon, sonde hybridisering og utvikling av autoradiograph film. Sammenligne den fått stripemønster etter autoradiograph utvikling i takt 18 (supplerende protocol) med den forventede mønsteret etter Southern strategi (for eksempel resultater, se figur 4b).
  5. Analyse av off-målet hendelser
    Merk: Siden CRISPR-Cas9-mediert genomet engineering kan generere off-målet effekter, PCR-forsterke ti høyest rangerte i sili-spådde off-målet områder i valgt kloner og gitt dem til Sanger sekvensering.
    1. Bruk CCTop16 (http://crispr.cos.uni-heidelberg.de) til å generere en liste over de ti høyest rangerte i sili spådd off-målet sekvenser.
      1. Input gRNA sekvensen inkludert PAM som brukes for målretting som spørringen sekvensen. Velg "NGG" som PAM og "Menneskelige genom" som referanse for off-målet prediksjon.
      2. Angi maksimal total uoverensstemmelser "4" og målet området lengde lengden på gRNA uten PAM. Utdatafilen vil gi en rangert liste over genomisk off-målet områder for respektive gRNA.
    2. I sili ekstra genomisk sekvens 500 bp oppstrøms og nedstrøms av hver av de ti høyeste rangerte off-målet treffene UCSC genomet nettleser (http://genome.edu.ucsc.edu) og plasseringen av off-målet hit fra CCTop resultatlisten.
    3. For hver av målområdene å bli analysert, design en PCR primer paret forsterker et fragment av 600 til 700 bp i lengde inkludert spådd av målet nettstedet.
    4. Pakk ut gDNA fra det valgte kloner og Jurkat vill-type celler ved hjelp av en kommersiell gDNA utvinning kit. For hvert av mål område, utføre en PCR bruker en DNA polymerase med korrekturlesing aktiviteten (se tabell 1 og 2 for PCR ingredienser og sykling forhold) på vill-type og de respektive klone-avledet gDNA.
    5. Analysere 5 µL av PCR-produkter på en 1,5% agarose/TAE gel. Hvis riktig bandet størrelser er observert, rense gjenværende PCR produktet ved hjelp av en kommersiell PCR rensing kit og utsett den for Sanger sekvensering. Sammenligne sekvenser av webområdene off-målet i Jurkat celler og målrettet kloner.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

I dette representant eksperimentet har vi valgt å målrette en minimal HIV-1-derivert reporter bestående av en polyA-signalet rekkefølge til to loci i intron 5 BACH2 gen17med LTR og tdTomato-coding sekvens. Loci for målretting ble valgt etter avstand til publiserte tilbakevendende integrering nettsteder funnet i forskjellige studier på primær T-celler fra HIV-infiserte pasienter2,4,5,6, 7,8 og tilstedeværelsen av PAM motivet NGG nødvendig for Cas9-mediert induksjon av dobbel-strand bryter. Målet vektorer ble konstruert og transfekterte i henhold til beskrevet protokollen. Arbeidsflyten for hva, sjekke for målretting hendelser, generasjon av encellede kloner, og screening og utvalg av kloner skjematisk vises i figur 1.

To uker etter FACS-anriking av transfekterte celler, var vi kjøpedyktig merker reporter genuttrykk etter PMA-Iono innledningen av flowcytometri i 4 til 12% av celler, avhengig av integrasjon området (data ikke vist) og PCR produkter på genomisk DNA som spenner over hele 5' og 3 integrering krysset fra oppstrøms av 5' HA reporter sekvens og nedstrøms av 3' HA i reporter sekvens, henholdsvis (figur 3a og 3b). Etter å ha bekreftet at målretting hendelser skjedd, dro vi på å generere encellede kloner ved å begrense fortynning plating. I våre hender var plating 5 til 10 96-brønns plater per målretting konstruere tilstrekkelig for å oppnå nok kloner for en vellykket skjerm. I protokollen (kapittel 3.2), er det beskrevet hvordan du utfører en screening av encellede kloner i duplisert 96-brønner. I denne forbindelse må bare positive kloner utvides, noe som sparer både tid og arbeid. I Figur 3 cvises eksempeldata av FACS-screening etter PMA-Iono induksjon og PCR screening. Observerte vi en rekke kloner med høy, lav og ikke fluorescerende reporter genuttrykk (Figur 3 c). For PCR-screening er det viktig å inkludere en kontroll PCR som forsterker et genomisk locus valg å avgjøre om kvaliteten på cellen lysates er tilstrekkelig for PCR. I vårt tilfelle har vi valgt en 630 bp sekvens NUP188 gene locus for kontroll PCR (for primer sekvenser, se tabell 5). Primere for screening PCR ble deretter utviklet for å forsterke en kortere sekvens i reporteren. I tillegg ble PCR for en serie på målet vektor ryggraden utført for å utelate alle kloner som hadde uspesifikt integrert målet vektor ryggraden sekvenser (backbone PCR, data ikke vist).

Forhåndsvalgt kloner ble deretter utvidet og ytterligere analysert for riktig målretting av sørlige blot og PCR og sekvenser. Sørlige blot ble utført med en reporter-spesifikke sonde og en sonde bestemt for genomisk locus bindingen utenfor reporteren men ikke innenfor homologi armer målretting vektoren. Interessant, alle kloner som ble testet av sørlige blott var positive i screening PCR på forhånd, men bare en del viste riktig bandet størrelser i sørlige blot analyse og hadde heterozygously integrert reporteren (figur 4b). Derfor er det nødvendig å ikke bare stole på screening PCR resultater, men også kontrollere riktig målretting av Southern blotting. For å bekrefte riktig målgruppe på DNA sekvensen nivå, integrasjon veikryss ble forsterket av PCR og produkter ble utsatt for Sanger sekvensering (figur 4a). Spesielt, viste sekvensering av målet området homologe allelet, der reporteren ikke hadde integrert, Cas9-mediert endringer. Figur 4avises eksempler på Cas9-mediert slettingen. For å teste for Cas9-mediert off-målet effekter, ble en liste over webområdene høyest rangerte off-målet generert som beskrevet i Seksjon 3.5. Ti høyest rangerte off-målet områder var PCR-forsterkeren fra genomisk DNA kloner, og produktene utsatt for Sanger sekvensering. I målrettet encellede kloner vi generert, ble ingen varianter fra Jurkat vill-type sekvenser observert på ti høyest rangerte off-målet nettsteder.

Figure 3
Figur 3: Screening av encellede kloner for målretting hendelser. (en) skjematisk av primer design for påvisning av målretting hendelser etter PCR i blandet målrettet celle befolkningen. Primer par for gjenkjenning av 5' integrering junction (P1, P2) og 3 integrering krysset (P3, P4) angis som piler. Primer P1 og P4 også tjene til å forsterke målrettet locus av allelet uten reporter integrant (b) Genomic DNA av blandet målrettet celle befolkningen var forberedt 10 dager etter FACS anriking av transfekterte celler og analysert for 5' integrering krysset (P1, P2 ), 3 integrering junction (P3, P4, data ikke vist) og vill-type allelet av målrettet locus (P1, P4). Vill-type Jurkat celler (wt) som kontroll. (c) første skjermbildet encellede kloner i 96-brønnen plater. 96-brønns plater med encellede kloner ble vist for riktig målretting av flowcytometri etter PMA-Iono induksjon og PCR analyse. Resultatene for eksempel kloner vises. PCR ble utført på cellen lysates med reporter-spesifikke primer (screening PCR; P5, P6) grunninger forsterke et genomisk locus (kontrollere PCR, her: NUP188 locus; P7, P8). Celle lysates av vill-type Jurkat celler (wt) og genomisk DNA fra HIVisB2 klone (B2)18 tilberedt med kommersielt tilgjengelig utstyr som en negativ kontroll for screening PCR og positiv kontroll for kontrollen PCR, henholdsvis. Klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4: analyse av valgte encellede kloner riktig reporter integrasjon. (en) sekvens analyse av integrasjon veikryss og målrettet locus på allelet uten reporter integrant. Primer par for gjenkjenning 5' integrering krysset (P1, P2), 3 integrering krysset (P3, P4) og målrettet locus av allelet uten reporter integrant (P1, P4) ble brukt. PCR produkter ble forsterket fra genomisk DNA av encellede kloner og utsatt for Sanger sekvensering. Sekvensering resultater ble justert til forventet sekvenser. Vises eksempeldata i en klone. Rekkefølgen chromatograms fra Genova/HA krysset og HA/reporter junction vises for både 5' og 3 integrering junction. Kamper angis som prikker. Binding området av gRNA er merket med en boks. Cas9-indusert mutasjoner er uthevet i rødt. Skjematisk av primer design nedenfor. Pilene angir primer posisjoner brukes til forsterkning. (b) sør blot analyse av valgte målrettet encellede kloner og Jurkat vill-type celler. Sørlige blot analyse var utført på genomisk DNA med en reporter-spesifikke sonde og en sonde gjenkjenne en genomisk sekvens både målrettet og vill-type allelet (genomisk sonde). Data av 7 eksempel kloner vist. Kloner med riktig bandet størrelser er merket med bokser. Utvannet målet vektor plasmider servert som positive (+). Skjematisk for sørlige blot analyse nedenfor. Klikk her for å se en større versjon av dette tallet.

Reagens Legg til per reaksjon
Videresende Primer (20 µM) 1 ΜL
Omvendt Primer (20 µM) 1 ΜL
10 x Taq buffer 5 ΜL
1 µL dNTPs (2,5 mM hver) 1 ΜL
MgCl (50 mM) 1 ΜL
DMSO 1,5 ΜL
gDNA (50-100 ng/µL) 2 ΜL
Nuclease-fritt vann Fyll opp til 49,5 µL
Taq DNA utvalg (5 U/mL) 0,5 ΜL
reaksjon volum 50 ΜL

Tabell 1: oppskrift for PCR med et utvalg med korrekturlesing aktiviteten. Hvor mye hver reagens legges per PCR reaksjon er angitt. PCR er ment for forsterkning ved hjelp av genomisk DNA som mal. Oppskriften er brukt i trinn 1.2.2.2 (forsterkning av homologi våpen), trinn 3.3.3 (bekreftelse av integrering), trinn 3.4.1.5 (generasjon genomisk sonde for sørlige klatt) og trinn 3.5.4 (analyse av off-målet hendelser).

Trinn Temperatur Tid Sykluser
Første rødsprit 95 ° C 2 min 1
Rødsprit 95 ° C 40 s 30-35
Avspenning 58 ° C 45 s
Utvidelse 72 ° C 1 min/kb
Endelig utvidelse 72 ° C 10 min 1

Tabell 2: sykling betingelser for PCR med et utvalg med korrekturlesing aktiviteten. Sykling forholdene tilsvarer PCR oppskrift oppført i tabell 1.

Reagens Legg til per reaksjon
Videresende Primer (20 µM) 1 ΜL
Omvendt Primer (20 µM) 1 ΜL
5 x Hi-Fi-buffer 5 ΜL
1 µL dNTPs (2,5 mM hver) 1 ΜL
gDNA (50-100 ng/µL) eller plasmider DNA (50 ng/µL) 2 µL gDNA eller
1 µL plasmider DNA
Nuclease-fritt vann Fyll opp til 49,5 µL
Hi-Fi-DNA utvalg 0,5 ΜL
reaksjon volum 50 ΜL

Tabell 3: oppskrift for PCR bruker et nøyaktig utvalg. Hvor mye hver reagens legges per PCR reaksjon er angitt. PCR er ment for robust forsterkning av DNA maler. Oppskriften er brukt i trinn 2.4.2 (gjenkjenning av målretting hendelser) og 3.4.1.4 (generasjon av reporter-spesifikke probe for sørlige klatt).

Trinn Temperatur Tid Sykluser
Første rødsprit 98 ° C 30 s 1
Rødsprit 98 ° C 10 s 30 - 35
Avspenning 58 ° C 30 s
Utvidelse 72 ° C 30 s/kb
Endelig utvidelse 72 ° C 10 min 1

Tabell 4: sykling betingelser for PCR bruker et nøyaktig utvalg. Sykling forholdene tilsvarer PCR oppskrift oppført i tabell 3.

Primer Sekvens (5-3')
P7 kontroll PCR F CTTTGTTGGGTAAGCATGGAGGTC
P8 kontroll PCR R CAGTTACTCACCTTTGCACATAGG

Tabell 5: Oligonucleotide sekvenser for kontroll PCR. Forover og bakover grunning for forsterkningen på en 630 bp fragment av NUP188 locus angis.

Reagens Legg til per reaksjon
klar til bruk PCR Master Mix 8 ΜL
Videresende Primer (20 µM) 1 ΜL
Omvendt Primer (20 µM) 1 ΜL
Nuclease-fritt vann 8 µl
celle lysate (1:12 fortynning) 2 ΜL
Totalt reaksjon volum 20 ΜL

Tabell 6: oppskrift for screening PCR. Hvor mye hver reagens legges per PCR reaksjon er angitt. PCR oppskrift er ment for screening PCR i trinn 3.2.11.

Trinn Temperatur Tid Sykluser
Pre-PCR Rødsprit 94 ° C 2 min 1
Avspenning 58 ° C 1 min
Utvidelse 72 ° C 1 min
Rødsprit 94 ° C 30 s 38
Avspenning 58 ° C 30 s
Utvidelse 72 ° C 1 min
Endelig utvidelse 72 ° C 10 min 1

Tabell 7: sykling betingelser for screening PCR. Sykling forholdene tilsvarer PCR oppskrift i tabell 6.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Her beskriver vi en protokoll for å generere HIV-1-derivert Jurkat reporter modeller med valgt proviral integrasjon nettsteder bruke CRISPR-Cas9-baserte genomet engineering.

Flere punkter av protokollen krever nøye på planleggingsstadiet. Først locus bli målrettet bør velges nøye, som noen loci kan være lettere å mål enn andre (f.eks, avhengig av chromatin status i regionen og målet sekvens selv). Gjentatte sekvenser er vanskelig å klone til målretting vektoren og er ofte ikke unike i genomet. Regionene i undertrykkende chromatin er vanskeligere å målrette med CRISPR-Cas9 systemet19,20.

Andre er valg av gRNA avgjørende for CRISPR-Cas9-mediert målretting. For å generere modeller for HIV-infeksjon med representant integrering områder, ville du gRNA å binde så nært som mulig til en integrasjon hotspot. Men kan dette nettstedet ikke være ideell for Cas9 rekruttering; et kompromiss må derfor gjøres mellom nærhet gRNA sekvensen til webområdet integrering av valg og gRNA kvalitet. Vi har funnet E-skarp webtool pålitelig forutse funksjonelle gRNAs. Det er også mulig å gjennomføre en pre-test for gRNA ved å uttrykke transiently flere gRNAs med Cas9 i celle type målrettet, etterfulgt av en screening for mutasjoner. Dirigere en egnet gRNA effektivt Cas9 til målområdet og gRNA komplementære området vises mutasjoner. Lengden på har (1000 bp oppstrøms og nedstrøms webområdet integrering) ble valgt i henhold til tidligere publiserte undersøkelser11. Generelt, redusere lengden av homologi våpen vil resultere i redusert målretting frekvens. En lengde på 1000 bp homologi arm presenterer et bra kompromiss mellom tilstrekkelig målretting frekvens og brukervennlighet målet vektor konstruksjon.

Tredje brukes nok tid på en god utforming av den reporter konstruere. Minimal reporteren i denne protokollen, som inneholder en HIV-1 NL4-3 avledet LTR og en tdTomato koding sekvens, ble designet basert på følgende prinsipp: enkelt LTRs har blitt beskrevet som utelukkende gjenværende proviral fragmenter i flere tilfeller av klonal ekspansjon i kronisk HIV-1-infiserte individer21. Det forventes at LTR er sterkt påvirker chromatin status på integrering områder og organiserer rekruttering av mobilnettet komplekser. Vi har valgt en minimal HIV reporter med fokus på HIV LTR som regulatoriske genetisk hovedelementet, så introdusert tdTomato som en fluorescerende LTR aktivitet markør i stedet for ytterligere HIV-1 gener, som genomet engineering frekvens ble rapportert å være høyere med mindre målretting setter inn11. Vurderer tidkrevende trinnene av tv kloning klonal utvalg, screening og verifisering av kloner, det anbefales å nøye vurdere utformingen av HIV reporteren i sammenheng med funksjonell studier som skal eventuelt utføres på målrettet linjer. Man kan for eksempel vurdere inkludering av gag leder sekvens, 3' HIV LTR eller annen viral genetiske sekvenser i reporteren. Protokollen kan lett tilpasses slike forskjellige reporter konstruksjoner.

Vanligvis er det viktig å vurdere valg av celle type bli målrettet som encellede klone generasjon kan være vanskelig med bestemte linjer. Vi fant at Jurkat celler ikke er veldig effektivt i enkelt klone generasjon; men besluttet vi å velge denne celle type for sin tidligere kjent i latente HIV infeksjon modeller9. Vi fikk det best resultatet i Jurkat klonal fortynning plating med 50% betinget medium, når platene var igjen uforstyrret i en inkubator ble åpnet mer enn 3 ganger i uken. Hvis bruke en annen celle, anbefales det å pre teste muligheten for å generere encellede kloner ved å utføre en fortynning plating eksperiment. Et annet punkt å huske på er variasjonen av transfection priser på ulike linjer. Hvis hva ikke er mulig for den valgte cellen linjen, electroporating celler for målretting kan være nødvendig. Vær oppmerksom på at valget av cellen linje brukt for målretting ikke kan bestemmes av tekniske aspekter, som effektivitet for transfection eller enkelt klone generasjon. Funksjonelle aspekter kan også betraktes som transcriptional aktivitet eller inducibility av målrettet genet locus. Dette kan kreve screening av forskjellige linjer før målretting arbeidsflyten.

Det bør understrekes at beskrevet protokollen er tidkrevende. Det bør forventes å ta 3 til 6 måneder fra første trinn å endelig klonal linjer. Den sørlige blot analysen, som brukes til å kontrollere for områdespesifikke enkelt integrering hendelser, kan virke uhåndterlige, men vår erfaring er det svært viktig - som bare et delsett av encellede kloner som viste forventet integrering Forbindelsesstykke per PCR viste en korrigere mønstre i sørlige blot. Ideelt sett forskere skal generere en rekke kloner med samme innsatsen rettet mot samme integrering sted å kontrollere for klonal effekter i alle etterfølgende eksperimenter som gjør bruk av kloner. Det er mulig å gjøre heterozygote og homozygous målretting. I heterozygote reporter cellelinjer trolig allelet uten en integrant Vis endringer på Cas9 målretting området, som kan bli vist av PCR (figur 4a). For homozygous målretting anbefaler vi at begge alleler målrettes fortløpende.

Hensyntatt disse hensyn, gir denne arbeidsflyten et middel til å generere kraftig mobilnettet modeller som kan brukes til å øke forståelsen av kronisk HIV-smitte. For eksempel kan proviral aktivitet svar ventetid-reversere agenter testes i forbindelse med tilbakevendende integrering nettsteder. Dette kan være av spesiell interesse for forskere i feltet siden posisjon effekter har blitt postulert for å påvirke HIV ventetid og reversering22.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

Vi takker Britta Weseloh og Bettina Abel for teknisk assistanse. Vi takker også Arne Düsedau og Jana Hennesen (flyt cytometri teknologiplattform, Heinrich Pette Institut) for kundestøtte.

Materials

Name Company Catalog Number Comments
pX330-U6-Chimeric_BB-cBh-hSpCas9 Addgene 42230 vector for expression of SpCas9 and gRNA
pMK GeneArt mammalian expression vector for cloning
cDNA3.1 Invitrogen V79020 mammalian expression vector for cloning
BbsI New England Biolabs R0539S restriction enzyme
NEBuilder Hifi DNA Assembly Cloning Kit New England Biolabs E5520S Assembly cloning kit used for target vector generation
TaqPlus Precision PCR System Agilent Technologies 600210 DNA polymerase with proofreading activity used for amplification of homology arms (step 1.2.2.2), verification of integration site and reporter sequence (step 3.3.3 and 3.3.5), generation of genomic probe for Southern blot (step 3.4.1.5) and analysis of off-target events (step 3.5.4)
96-well tissue culture plate (round-bottom) TPP 92097 tissue culture plates for dilution plating
Phusion High-Fidelity DNA polymerase New England Biolabs M0530 L DNA polymerase used for detection of targeting events (step 2.4.2) and generation ofreporter-specific probe for Southern blot (step 3.4.1.4)
Dimethyl sulfoxide (DMSO) Sigma-Aldrich D9170 dimethyl sulfoxide as PCR additive
Magnesium Chloride (MgCl2) Solution New England Biolabs B9021S MgCl2 solution as PCR additive
Deoxynucleotide (dNTP) Solution Mix New England Biolabs N0447S dNTP mixture with 10 mM of each nt for PCR reactions
5PRIME HotMasterMix 5PRIME 2200400 ready-to-use PCR mix used for screening PCR (step 3.2.11)
QIAamp DNA blood mini kit Qiagen 51106 DNA isolation and purification kit
QIAquick PCR Purification Kit Qiagen 28106 PCR Purification Kit
RPMI 1640 without glutamine Lonza BE12-167F cell culture medium
Fetal Bovine Serum South Africa Charge PAN Biotech P123002 cell culture medium supplement
L-glutamine Biochrom K 0282 cell culture medium supplement
Penicillin/Streptomycin 10.000 U/mL/ 10.000 µg/mL Biochrom A 2212 cell culture medium supplement
Gibco Opti-MEM Reduced Serum Media Thermo Fisher Scientific 31985062 cell culture medium with reduced serum concentration optimized for transfection
TransIT-Jurkat Mirus Bio MIR2125 transfection reagent
phorbol 12-myristate 13-acetate Sigma-Aldrich P8139-1MG cell culture reagent
Ionomycin Sigma-Aldrich I0634-1MG cell culture reagent
Syringe-driven filter unit, PES membrane, 0,22 µm Millex SLGP033RB filter unit for sterile filtration
Heracell 150i incubator Thermo Fisher Scientific 51026280 tissue culture incubator
Amershan Hybond-N+ GE Healthcare RPN1520B positively charged nylon membrane for DNA and RNA blotting
Stratalinker 1800 Stratagene 400072 UV crosslinker
High Prime Roche 11585592001 kit for labeling of DNA with radioactive dCTP using random oligonucleotides as primers
illustra ProbeQuant G-50 Micro Columns GE Healthcare 28-9034-08 chromatography spin-columns for purification of labeled DNA

DOWNLOAD MATERIALS LIST

References

  1. Hughes, S. H., Coffin, J. M. What Integration Sites Tell Us about HIV Persistence. Cell Host and Microbe. 19, (5), 588-598 (2016).
  2. Marini, B., Kertesz-Farkas, A., et al. Nuclear architecture dictates HIV-1 integration site selection. Nature. 521, (7551), 227-231 (2015).
  3. Cesana, D., Santoni de Sio, F. R., et al. HIV-1-mediated insertional activation of STAT5B and BACH2 trigger viral reservoir in T regulatory cells. Nature Communications. 8, (1), 498 (2017).
  4. Cohn, L. B., Silva, I. T., et al. HIV-1 Integration Landscape during Latent and Active Infection. Cell. 160, (3), 420-432 (2015).
  5. Han, Y., Lassen, K., et al. Resting CD4+ T cells from human immunodeficiency virus type 1 (HIV-1)-infected individuals carry integrated HIV-1 genomes within actively transcribed host genes. Journal of Virology. 78, (12), 6122-6133 (2004).
  6. Ikeda, T., Shibata, J., Yoshimura, K., Koito, A., Matsushita, S. Recurrent HIV-1 integration at the BACH2 locus in resting CD4+ T cell populations during effective highly active antiretroviral therapy. The Journal of Infectious Diseases. 195, (5), 716-725 (2007).
  7. Wagner, T. A., Mclaughlin, S., et al. Proliferation of cells with HIV integrated into cancer genes contributes to persistent infection. Science. 345, (6196), 570-573 (2014).
  8. Maldarelli, F., Wu, X., et al. Specific HIV integration sites are linked to clonal expansion and persistence of infected cells. Science. 345, (6193), 179-183 (2014).
  9. Jordan, A., Bisgrove, D., Verdin, E. HIV reproducibly establishes a latent infection after acute infection of T cells in vitro. The EMBO Journal. 22, (8), 1868-1877 (2003).
  10. Mack, K. D., Jin, X., et al. HIV insertions within and proximal to host cell genes are a common finding in tissues containing high levels of HIV DNA and macrophage-associated p24 antigen expression. Journal of Acquired Immune Deficiency Syndromes. 33, (3), 308-320 (2003).
  11. Byrne, S. M., Ortiz, L., Mali, P., Aach, J., Church, G. M. Multi-kilobase homozygous targeted gene replacement in human induced pluripotent stem cells. Nucleic Acids Research. 43, (3), 1-12 (2014).
  12. ZhangLab. CRISPR Genome Engineering Toolbox: Target Sequence Cloning Protocol. Addgene website. Available from: https://www.addgene.org/static/cms/filer_public/e6/5a/e65a9ef8-c8ac-4f88-98da-3b7d7960394c/zhang-lab-general-cloning-protocol.pdf (2013).
  13. Moser, F. Addgene. Gibson Assembly Protocol. Addgene website. Available from: https://www.addgene.org/protocols/gibson-assembly/ (2009).
  14. Addgene Plasmid Cloning by PCR. Addgene website. Available from: https://www.addgene.org/protocols/pcr-cloning/ (2014).
  15. Addgene Plasmid Cloning by Restriction Enzyme Digest (aka Subcloning). Addgene website. Available from: https://www.addgene.org/protocols/subcloning/ (2013).
  16. Stemmer, M., Thumberger, T., Del Sol Keyer, M., Wittbrodt, J., Mateo, J. L. CCTop: An intuitive, flexible and reliable CRISPR-Cas9 target prediction tool. Public Library of Science (PLoS) ONE. 10, (4), (2015).
  17. Lange, U. C., Bialek, J. K., Walther, T., Hauber, J. Pinpointing recurrent proviral integration sites in new models for latent HIV-1 infection. Virus Research. 249, (2018).
  18. Bialek, J. K., Dunay, G. A., et al. Targeted HIV-1 Latency Reversal Using CRISPR-Cas9-Derived Transcriptional Activator Systems. PloS ONE. 11, (6), e0158294 (2016).
  19. Lee, C. M., Davis, T. H., Bao, G. Examination of CRISPR-Cas9 design tools and the effect of target site accessibility on Cas9 activity. Experimental Physiology. 103, (4), 456-460 (2018).
  20. Jensen, K. T., Fløe, L., et al. Chromatin accessibility and guide sequence secondary structure affect CRISPR-Cas9 gene editing efficiency. FEBS Letters. 591, (13), 1892-1901 (2017).
  21. Simonetti, F. R., Sobolewski, M. D., et al. Clonally expanded CD4 + T cells can produce infectious HIV-1 in vivo. Proceedings of the National Academy of Sciences. 113, (7), 1883-1888 (2016).
  22. Chen, H. C., Martinez, J. P., Zorita, E., Meyerhans, A., Filion, G. J. Position effects influence HIV latency reversal. Nature Structural and Molecular Biology. 24, (1), 47-54 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics