CRISPR-Cas9-basierte Genom Engineering Jurkat Reporter Modelle für HIV-1-Infektion mit ausgewählten proviralen Integration Websites generieren

* These authors contributed equally
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Wir präsentieren einen Genom engineering Workflow für die Generation der neuen in-vitro-Modelle für HIV-1-Infektion, die proviralen Integration an ausgewählten genomischen Standorten zu rekapitulieren. Ausrichtung der HIV-abgeleitete Reporter wird durch CRISPR-Cas9-vermittelten, ortsspezifische Genom Manipulation erleichtert. Detaillierte Protokolle für einzellige Klon-Generierung, Screening und richtige targeting Überprüfung stehen zur Verfügung.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Bialek, J. K., Walther, T., Hauber, J., Lange, U. C. CRISPR-Cas9-based Genome Engineering to Generate Jurkat Reporter Models for HIV-1 Infection with Selected Proviral Integration Sites. J. Vis. Exp. (141), e58572, doi:10.3791/58572 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Human Immunodeficiency Virus (HIV) integriert seine proviralen DNA nicht zufällig in das Wirtsgenom Zelle an wiederkehrenden Standorten und genomische Hotspots. Hier präsentieren wir ein detailliertes Protokoll für die Generation der neuartige in-vitro-Modelle für HIV-Infektion mit ausgewählten genomischen Integration Websites mit CRISPR-Cas9-basierte Genom-engineering-Technologie. Mit dieser Methode eine Reporter-Sequenz der Wahl in eine gezielte, ausgewählten genomischen Locus, integrierbar klinisch relevante Integration Websites widerspiegeln.

In das Protokoll werden das Design ein HIV-abgeleitete Reporter und Auswahl der Zielsequenz Website und gRNA beschrieben. Ein Targetingvektor mit Homologie Armen gebaut und transfizierten Jurkat T-Zellen. Die Reporter-Sequenz richtet sich an den ausgewählten genomischen Standort durch homologe Rekombination durch eine Cas9-vermittelten Doppel-Strang-Pause an der Ziel-Site erleichtert. Einzellige Klone erzeugt und für die Ausrichtung von Veranstaltungen mit Durchflusszytometrie und PCR durchleuchtet. Ausgewählten Klone werden dann erweitert und korrekte Ausrichtung von PCR und Sequenzierung Southern blotting überprüft. Potenzielle Ziel Veranstaltungen CRISPR-Cas9-vermittelten Genom Engineering werden analysiert.

Mithilfe dieses Protokolls, neuartige Zellkultursysteme kann dieses Modell HIV-Infektion bei klinisch relevanten Integration Websites generiert werden. Obwohl die Generation der einzelligen Klone und Überprüfung der korrekten Reporter Sequenz Integration zeitaufwändig ist, sind die daraus resultierenden klonalen Linien mächtige Werkzeuge funktional proviralen Integration Website Wahl analysieren.

Introduction

Integration der proviralen DNA in das Wirtsgenom nach Infektion ist ein entscheidender Schritt im Lebenszyklus des menschlichen Immunodeficiencyvirus (HIV). Nach Integration bleibt HIV durch die Gründung der Latenz in langlebigen CD4 + T Zelle Teilmengen wie Speicher-CD4 + T-Zellen. HIV-Integration scheint nicht zufällig1,2. In mehreren Studien durch die Sequenzierung der Integration Websites in akut und chronisch infizierten Personen2,3,4 wurde eine Reihe von genomischen Hotspots mit immer wieder integrierte proviralen DNA festgestellt. ,5,6,7,8. Interessanterweise wurde auf einige dieser Integration Seiten der gleichen Locus erkannt, in ein großer Teil der infizierten Zellen, was zu der Idee, dass Integration an wiederkehrenden Standorten klonalen Expansion1positiv beeinflussen könnte.

Um unser Verständnis von der Bedeutung der wiederkehrenden Integration Websites zu gelangen, muss proviralen Integration Website Wahl geprüft werden. Jedoch einige technische Aspekte behindern studieren HIV Integration site-Wahl und die Folgen. Im großen und ganzen Zellmodelle Kultur für HIV Latenz verwendet, wie JLat Zelllinien nicht klinisch relevante wiederkehrende Integration Websites9entsprechen. Studien zur primären Patienten gewonnenen Zellen, auf der einen Seite Beschreibung der Integration Website Landschaft durch Sequenzierung zu aktivieren aber lassen keine Funktionsanalysen. Nach unserem Kenntnisstand steht keine ausreichende Versuchsmodell funktional ausgewählte klinisch relevante Integration Websites analysieren.

Hier präsentieren wir Ihnen einen detaillierte Workflow um neuartige Modelle für HIV-Infektion mit CRISPR-Cas9-basierte Genom-engineering-Technologie zu generieren. Die hierin beschriebene Workflow lässt sich T-Zell-derived Reporter Zelllinien zu generieren, die HIV-Infektion, genomisch integrierten proviralen Reporter bei einem gewählten Integrationsort trägt zu modellieren. Sie dienen somit als neue Werkzeuge wie der proviralen Integrationsort HIV Biologie auswirken kann und wie das Provirus reagiert auf unterschiedliche Behandlungsstrategien (z. B., Inducibility von Latenz Umkehr Agenten) zu erforschen. Unsere Methode nutzt die Vorteile der CRISPR-Cas9-basierte Genom-Technik, bei der Integration des Reporters Sequenz durch homologe Rekombination durch eine Cas9 Nuklease-induzierten Doppel-Strang Pause an der Ziel-Site erleichtert wird. Ziel-Sites für die Integration werden je nach Nähe zu den beschriebenen wiederkehrende Integration Websites von Studien über die HIV-infizierten Personen und das Vorhandensein von geeigneten PAM-Motiven für Cas9-vermittelten Genom Engineering ausgewählt.

In unserem exemplarische Ergebnisse haben wir uns auf die BACH2-gen-Locus, welche Codes für die BTB und CNC-Homologie transcriptional Regler 2 konzentriert. BACH2 bei chronisch HIV-infizierten Personen antiretrovirale Therapie gehört zu den Loci zeigt Anreicherung von integrierten HIV-1 Sequenzen3,6,7,8,10. Wir haben uns entschieden einen minimale HIV abgeleitet Reporter aus HIV-1-derived lange Terminal repeat (LTR), TdTomato kodierende Sequenz und Rinderwachstumshormon (BGH) Polyadenylation Signal (PA), die wir auf zwei bestimmte Websites in BACH2 Intron 5 ausgerichtet haben. Die vorgestellte Protokoll ist optimiert für Jurkat Zellen, eine menschliche CD4 + T-Zell-abgeleitete Fahrwerk-Zell-Linie, aber andere Zelle Linien verwendet werden können und das Protokoll entsprechend angepasst. Wir präsentieren Ihnen einen detaillierten Workflow für die Auswahl der Ziel-Site, Bau von Ziel-Vektor mit Homologie Arme, CRISPR-Cas9-vermittelten Ausrichtung des Reporters in ausgewählten genomischen Website, Generierung und Auswahl von klonalen Linien und umfassende Überprüfung der neu erstellte, zielgerichtete Reporter-Zell-Linien.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

(1) targeting-Strategie für Genom Engineering und Targeting Vektor (tv)-Design

Hinweis: Der erste Schritt des Genoms Engineering beinhaltet Auswahl und Erstellung von notwendigen Werkzeuge für die Zielgruppenadressierung CRISPR-Cas9-vermittelten. Auswahl einer genomischen Integration Website Locus, Wahl des Zelltyps für die Ausrichtung und Gestaltung von einer HIV-abgeleitete Reporter für die Integration sollte dieser Schritt vorausgehen. Dieses Protokoll beschreibt Angriffe auf eine HIV-LTR_tdTomato_BGH-PA-minimal-Reporter in Jurkat Zielzellen. Ein Flussdiagramm des Workflows zur CRISPR-Cas9 basierenden targeting, Energieerzeugung, Screening und Überprüfung der klonalen Linien ist in Abbildung 1dargestellt. Die beschriebenen targeting-Strategie nutzt S. Pyogenes Cas9 (SpCas9), unter der Regie von gRNA DsDNA Pausen an einem ausgewählten Integrationsort zu generieren. Die Reporter wird dann gezielt in den ausgewählten genomischen Locus durch homologe Rekombination durch die Bereitstellung einer nicht linearisiert Targetingvektor (tv), der Reporter-Sequenz flankiert von sogenannten 5' und 3' Homologie Arme (HA)11enthält.

  1. Wahl der gezielten Locus, gRNA und targeting Vektor-design
    1. Wählen Sie Thegenomic Locus ins Visier genommen werden, basierend auf der individuellen Fragestellung. Verwendung veröffentlichte Listen der wiederkehrenden Integration Websites von HIV bei Patienten in verschiedenen gefunden Studien2,3,4,5,6,7,8 als eine Leitlinie. In Silico extrahieren die genomische Sequenz von der gewünschten genomischen Lokus gezielte (Sequenz des kompletten Gens) oder mindestens 5 kb genomischen Sequenz mit UCSC Genom Browser (http:// genome.edu.ucsc.edu).
    2. Wählen Sie Guide RNAs (gRNAs) von 20 nt für die Ausrichtung der gewählten genomischen Locus mit dem E-CRISP-Webtool (http://www.e-crisp.org).
      1. Wählen Sie "Homo Sapiens GRCh38" als Organismus. Eingabe 2.000 bp der genomischen Sequenz für den gewünschten genomischen Locus in Schritt 1.1.1 extrahiert.
      2. Starten Sie eine gRNA Suche mit mittlerer Anwendungseinstellungen (PAM, jede 5' Basis, aus Ziele tolerieren Fehlanpassungen und Introns/CPG Inseln sind ausgeschlossen). Erscheint eine Liste mit möglichen gRNA Designs, ranking vom höchsten Punktzahlen für Spezifität und Effizienz zu senken.
      3. Wählen Sie eine gRNA, die vorzugsweise zeigt eine hohe Punktzahl für die Spezifität und Effizienz und ist so nah wie möglich an den gewünschten genomischen Locus ins Visier genommen werden.
        Hinweis: Muss ein Kompromiss zwischen Nähe zu der gewünschten genomischen Lokus und Gestaltung der gezielt und effizient gRNA gefunden werden.
    3. Explosion der gewählten gRNA Sequenz gegen das Referenz-Genom der Browser NCBI Explosion (https://blast.ncbi.nlm.nih.gov), um für die Einzigartigkeit der Bindungsstelle gRNA zu überprüfen.
      1. Wählen Sie "menschlicher" als Genom. Geben Sie die gRNA Reihenfolge als die Reihenfolge der Abfrage. Wählen Sie "sehr ähnliche Sequenzen" (Megadruckwelle) als das Programm. Sicherstellen Sie, dass die Sequenz gRNA einzigartig ist. Wenn nicht, wählen Sie verschiedene gRNA wieder aus Schritt 1.1.2.3 und Blast.
    4. Nachdem gRNA Sequenz ausgewählt ist, wählen Sie in Silico 1.000 bp vor- und nachgelagerten gRNA Sequenz von genomischen Sequenz im Schritt 1.1.1 als 5' und 3' HA entsprechend extrahiert.
      Hinweis: Die gRNAs soll homolog zu den ausgewählten genomischen Integration Website Locus und angrenzend an ein Protospacer angrenzenden Motiv (PAM; z. B., NGG für SpCas9) (Abbildung 2a). Der tv enthält die Reporter-Sequenz, die 5' und 3' HAs flankiert wird. Hat Abdeckung 1000 bp vor- und nachgelagerten gRNA Sequenz11. Die volle gRNA Sequenz sollte nicht in die HA enthalten. Eine Überlappung von bis zu 5 nt ist akzeptabel (Abbildung 2a).
  2. Generation von gRNA und targeting Vektoren
    Hinweis: Für Vektor-Systeme, siehe Abbildung 2 b.
    1. Um einen Vektor für die Expression von SpCas9 und gRNA zu generieren, verwenden Sie pX330-U6-Chimeric_BB-cBh-hSpCas9 als das Rückgrat aus dem SpCas9 und dem einzigen Guide RNA (SgRNA) gleichzeitig ausgedrückt werden können. Um die gRNA-Sequenz in das Rückgrat zu klonen, verwenden Sie die BbsI Beschränkung Seiten12.
    2. Um den Fernseher zu erzeugen, wählen Sie ein High-Kopie-Plasmid als Rückgrat (z. B., pMK oder cDNA3.1).
      1. Montieren Sie zunächst die Reporter (in diesem Protokoll: LTR_tdTomato_BGH-PA) in das Konstrukt Rückgrat von Gibson Assembly Clong13 mit einem kommerziellen Assembly Klonen kit sowie die Einführung 5' und 3' flankierende Restriktionsschnittstellen (z. B., 5' PacI und 3' SmaI) für spätere Einschränkung Verdauung Klonen der HAs.
      2. Verstärken Sie 1000 bp der HA Fragmente aus genomischer DNA (gDNA) in Schritt 1.1.4 ausgewählt des Zelltyps ins Visier genommen werden (in diesem Protokoll: Jurkat-Zellen) mit einer DNA-Polymerase mit Korrekturlesen Tätigkeit (siehe Tabellen 1 und 2 für PCR-Zutaten und Radfahren Bedingungen). Dann stellen Sie Reporter flankierende Restriktionsschnittstellen an den 5' und 3' Enden der einzelnen HA (PacI auf 5' HA beidseitig SmaI auf 3' HA an beiden Enden).
      3. Nacheinander hat Klon in Konstrukt Rückgrat bereits mit der Reporter (in Schritt 1.2.2.1 generierten) durch Restriktionsenzym Klonen14,15. Erstens Klon in 5' HA mit PacI Restriktionsschnittstellen, dann Klon in 3' HA SmaI Restriktionsschnittstellen verwenden.
        Hinweis: Enthält tv Rückgrat einen zusätzliche fluoreszierenden Reporter, unerwünschte Rückgrat Integration durch Durchflusszytometrie beurteilt werden kann (siehe Schritte 3.2.2 und 3.2.3). Wenn tv Rückgrat keine fluoreszierenden Reporter enthält, Rückgrat Integration muss beurteilt werden mittels PCR (siehe Schritt 3.2.8).

Figure 1
Abbildung 1: Workflow für CRISPR-Cas9-vermittelten targeting, Generierung und Auswahl von klonalen Reporter Linien mit definierten Integrationsort. (A) den Ziel-Vektor zu generieren und transduzieren Jurkat T-Zellen mit dem Ziel Vektor und Cas9/gRNA Expressionsplasmid. (B) anreichern der transfizierten Zellen 72 h Post Transfektion durch FACS. (C) lassen die Zellen wachsen 10 bis 14 Tage und bestätigen das Vorkommen des Zielens Ereignisse mittels PCR und flow Cytometry. (D) generieren, die einzellige Klone durch Begrenzung der Verdünnung und lassen Sie Klone für 3 Wochen wachsen. (E) Bildschirm die Klone für eine korrekte Ausrichtung von PCR und flow Cytometry in 96-Well-Format. Ausgewählten Klone zu erweitern. (F) überprüfen Sie korrekte Ausrichtung in ausgewählten Klone von Southern Blot, PCR und Sequenzierung und Analyse von Ziel-Ereignissen Cas9 Endonuklease Aktivität. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2: Targeting-Strategie und Vektor-Design. (ein) gRNA und Wahl der Homologie Waffen. 20 nt gRNA ist homolog zu den ausgewählten genomischen Zielstandort und liegt angrenzend an eine PAM. Homologie Arme sind komplementär zu 1.000 bp up- und downstream von der gRNA und sollte keine gRNA Sequenz. (b) Schaltpläne von targeting Vektor und gRNA/Cas9 Vektor. Die Targetingvektor besteht aus den gewählten Reporter-Sequenz, die 5' und 3' flankiert von den Armen Homologie ist. Die gRNA/Cas9-Vektor basiert auf dem pX330-U6-Chimeric_BB-cBh-hSpCas9-Backbone. (c) schematische Darstellung der Ausrichtung durch homologe Rekombination. Ziel Vektor- und GuideRNA/Cas9 Vektor sind in Jurkat Zellen transfiziert. Cas9 vermittelt eine Doppelstrang-Pause bei genomischen Zielsite (gekennzeichnet durch *) und erleichtert die homologe Rekombination und Integration der Reporter-Sequenz in den genomischen Target Locus. Bitte klicken Sie hier für eine größere Version dieser Figur.

2. CRISPR-Cas9-basierte Angriffe auf Jurkat-Zellen

  1. Transfektion von Jurkat-Zellen
    1. 24 h vor Transfektion, Platte 1,25 x 106 Jurkat T Zellen in 2,5 mL RPMI 1640 ergänzt mit 10 % (V/V) fetalen Kälberserum (FCS) und 4 mM L-Glutamin [bezeichnet als "RPMI w.o. Antibiotika (AB)"] pro Bohrloch eine Kultur 6-Well Zellplatte. Auf einem einzigen targeting Experiment vorbereiten eine komplette 6-Well-Platte (d. h., 6 Brunnen mit 2,5 mL Zellsuspension jeweils).
    2. Am Folgetag, Co transfizieren Sie Zellen mit kreisförmigen tv und pX330-U6-Chimeric_BB-cBh-hSpCas9/gRNA mit einem Transfection Reagens speziell für Jurkat Zellen.
      1. Fügen Sie 2 µg des kreisförmigen tv und 2 µg pX330-U6-Chimeric_BB-cBh-hSpCas9/gRNA pro Bohrloch 250 µL des kommerziellen RPMI Medium mit reduzierten Serumkonzentration optimiert zur Transfektion (RPMI mit 50 % Ermäßigung im Serum hinzu) in einem Reaktionsgefäß und gut mischen.
      2. Fügen Sie 12 µL Transfection Reagens langsam auf das DNA/Medium ohne Berührung der Wand des Rohres und wirbeln. Lassen Sie die Mischung 15 min inkubieren und ein gut von den Zellen tropfenweise hinzufügen. Inkubation der Zellen bei 37 ° C und 5 % CO2.
        Hinweis: Die Vorbereitung der Transfektion Reaktion kann hochskaliert werden. Nach der Transfektion ist keine mittlere Änderung erforderlich.
  2. Anreicherung von transfizierten Zellen durch Fluoreszenz-aktivierte Zelle sortieren (FACS)
    1. 72 h nach Transfektion Pool transfizierten Zellen, zählen sie und bereiten Sie für die Anreicherung durch FACS. Sammeln die Zellen in einem 50 mL konische Rohr, Zentrifuge bei 300 x g und Raumtemperatur (RT) für 4 min, waschen Sie die Zellen einmal in PBS, Zentrifugieren wieder auszusetzen, das Pellet in angemessener Höhe von FACS Puffer (PBS mit 1 % FCS + 1 mM EDTA ergänzt) 1 x 10 7 Zellen/mL, und schließlich in ein FACS-Rohr übertragen.
    2. Vorbehaltlich der Zellen FACS und diejenigen, die die fluoreszierenden Reporter des tv (z.B., TdTomato in diesem Protokoll) ausdrücken zu sortieren. Sammeln Sie die Zellen in RPMI 1640 mit 10 % FCS, 4 mM L-Glutamin und 50 U/mL Penicillin und Streptomycin (bezeichnet als "RPMI w / AB") ergänzt.
    3. Nach FACS sortieren, waschen Sie die Zellen einmal durch Zugabe von 20 mL RPMI w / AB zu sortierten Zellen und Zentrifugieren bei 300 X g für 4 min bei RT Aufschwemmen der Zelle Pellet in angemessener Höhe von RPMI w / AB und Platte Zellen in einen Brunnen einer Zelle-Kultur-Platte mit der angemessene Lautstärke nach Zelle Nummer Post-FACS.
      Hinweis: Kultur sortieren die Zellen in einem kleinen Volumen (z.B., 24-Well), da erhebliche Ebenen der Zelltod in der ersten Woche Post-targeting (bis zu 80 – 90 %) beobachtet wurden.
    4. Erweitern Sie die gemischten gezielte Zellpopulation bis zu einer Dichte von 1 x 106 Zellen/mL in einem 75 cm ² Zelle Kultur Kolben. Dies dauert rund 10-14 Tage Post-FACS sortieren.
  3. Bestätigung des Zielens Ereignisse durch Durchflusszytometrie in der gemischten gezielte Zellpopulation
    1. Nach 10 – 14 Tagen der Expansion (wenn Zellen eine Dichte von 1 x 106 Zellen/mL in einem 75 cm2 Zelle Kultur Kolben erreicht haben) gezielte Platte zwei Brunnen mit 1 x 106 Zellen der gemischten Zellpopulation in 1 mL RPMI w / AB in einer 12-Well-Zellkultur Platte.
    2. Die HIV-LTR des Reporters zu induzieren (tv-Generation wird in Schritt 1.2.2.1 beschrieben.) in einem der Brunnen durch Zugabe von 50 ng/mL Phorbol Myristate-12 13-Acetat (PMA) und 1 µM Ionomycin (PMA-Iono genannt). Verwenden Sie Zellen in den zweiten Brunnen als nicht-induzierte Kontrolle. Kultur der induzierten und die nicht-induzierte Zellen für 24 h.
    3. 0,5 mL Zellsuspension nicht induziert und induzierte Zellen (jeweils) einnehmen, einmal in PBS waschen und jeweils in 200 µL Puffer FACS auszusetzen.
    4. Analysieren Sie 100.000 Zellen durch Durchflusszytometrie. Tor die tragfähigen Einzel-Zellen abhängig von der Größe in vorwärts- und seitliche Streuung und fluoreszierende Reporter-gen-Expression zu analysieren.
      Hinweis: Bei diesem Schritt (10 – 14 Tage Post-FACS Sortierung), transiente Expression von fluoreszierenden Reporter durch Transfektion sollte nicht mehr nachweisbar sein. Fluoreszierende Ausdruck zu diesem Zeitpunkt angibt genomischen Integration der Reporter Sequenz.
  4. Erkennung des Zielens Ereignisse mittels PCR auf genomischer DNA der gemischten gezielt Zellpopulation
    Hinweis: , Targeting Veranstaltungen über PCR Design zwei Grundierung Paare speziell für die Integration (int.) Junction 5' und 3' int Kreuzung zu erkennen. Für die 5' int Kreuzung PCR, der forward Primer binden sollte oberhalb des 5' HA und die rückwärts-Primer in der LTR des Reporters (Primer P1 und P2 in Abbildung 3a). Primerpaar für die 3' int Kreuzung sollte PCR aus der PA des Reporters zu 100 – 200 bp stromabwärts von der 3' HA (Primer P3 und P4 in Abbildung 3a) umfassen. Primer P1 und P4 wird auch zur Verstärkung des ungezielte Allels in gezielte Mischpopulation dienen. Für einen Schaltplan siehe Abbildung 3a.
    1. GDNA von 2 mL Zellsuspension gemischte gezielte Zellpopulation aus Schritt 2.2.4 vorzubereiten. Verwenden Sie eine gDNA Extraktion Kit laut Protokoll des Herstellers. Dann bereiten Sie die gDNA ungezielte Zellen als Kontrolle.
    2. Durchführen int. Kreuzung PCRs (Primer P1/P2 und P3/P4 für 5' und 3' int Kreuzung, beziehungsweise) und ungezielte Allel PCR (Primer P1/P4) mit einem High-Fidelity-DNA-Polymerase (siehe Tabellen 3 und 4 für PCR-Zutaten und Radsport Bedingungen) . 5 µL des PCR-Produkte auf einem 1,5 % Agarose/TAE Gel zu analysieren.
      Hinweis: Wenn gezielte Mischpopulation Zellen, das Genom Engineering unterzogen haben enthält, ein spezifisches PCR-Produkt sollten beachtet werden, dass ist nicht in gDNA ungezielte Zellen (Negativkontrolle) nachweisbar. Für die ungezielte Allel PCR sollte man ein Produkt der gleichen Größe für die gezielte und ungezielte Zellen (Positivkontrolle für genomische P1 und P4 Primern) beobachten. Wenn keine Bands beobachtet werden, sollten Sie PCR-Radsport-Zustände zu verändern, durch Erhöhung der Anzahl der Zyklen oder Änderung des PCR-Puffers (z. B. durch Zugabe von DMSO oder erhöhte Mengen an Mg2 +), oder durch Ändern der Polymerase.

3. Generation von klonalen Linien und Screening für eine korrekte Ausrichtung

Hinweis: Nach Bestätigung der targeting-Events in der gemischten gezielte Zellpopulation durch Durchflusszytometrie und PCR (Abschnitte 2.2 – 2.4), einzellige Klone zu erzeugen (Dauer: 28 bis 35 Tage) und Bildschirm für die korrekte Einbindung der Reporter-Sequenz.

  1. Generation von einzelligen Klone durch Verdünnung Beschichtung
    1. Jurkat konditioniertes Medium im Voraus vorbereiten: ausziehen RPMI w / AB Medium aus gesunden, unbehandelten Jurkat T-Zellen gewachsen, Zentrifuge für 5 min bei 300 X g, 1 x 106 Zellen/mL und den Überstand mit einer Spritze-Filtereinheit 0,22 µm filtern.
      Hinweis: Halten die konditionierte Medium bei 4 ° C für kurzfristige Lagerung oder bei-20 ° C für die Lagerung länger als 1 Woche. 20 bis 30 mL konditionierten Medium vor Verdünnung Beschichtung vorzubereiten.
    2. Zählen Sie die gezielte Zellen aus Schritt 2.2.4 nach 10 – 14 Tagen der Expansion und verdünnen sie in RPMI w / AB einer Konzentration von 1 x 105 Zellen/mL. 100 µL 1 x 105 Zellen/mL Lösung zu nehmen und mit 9,9 mL Medium zu einer Konzentration von 1.000 Zellen/mL verdünnen. 1 mL der 1.000 Zellen/mL Lösung zu nehmen und mit 9 mL Medium zu einer Konzentration von 100 Zellen/mL verdünnen.
    3. Platte 96-Well-Platten mit 1 Zelle pro Bohrloch und 2 Zellen pro Bohrloch. Nehmen Sie für 1 Zelle pro Bohrloch 1 mL 100 Zellen/mL Lösung und mischen Sie mit 5 mL konditionierten Medium und 4 mL frisches Medium in einem sterilen Reagenz-Reservoir.
    4. Nehmen Sie für 2 Zellen pro Bohrloch 2 mL 100 Zellen/mL Lösung und mischen Sie mit 5 mL konditionierten Medium und 3 mL frisches Medium. Rundboden Platte 96-Well-Platten mit 100 µL der jeweiligen Zelle Verdünnung pro auch mit einem Mehrkanal-pipettieren.
      Hinweis: 5 bis 10 96-Well-Platten pro targeting Konstrukt ausreichen, um die Klone für das Screening zu erhalten.
    5. Stapeln Sie die 96-Well-Platten, decken Sie jeden Stapel mit einer 6-Well-Platte mit 3 mL PBS in jede Vertiefung und inkubieren Sie die Platten bei 37 ° C in einem befeuchteten Zelle Kultur Inkubator mit 5 % CO2 für 3 Wochen.
      Hinweis: Das Zellkulturmedium während dieser Zeit nicht ändern. Öffnen Sie den Inkubator nicht mehr als einmal oder zweimal pro Woche. Die besten Ergebnisse werden in Inkubatoren mit offenen Wasserreservoir beobachtet.
    6. Bestätigen Sie nach 3 Wochen Inkubation visuell das Vorhandensein von gewachsenen Kolonien mit Lichtmikroskopie (4 X Vergrößerung) und markieren Sie die Brunnen mit gewachsenen Kolonien zu, so dass sie als Punkte auf der Unterseite der Brunnen sichtbar sind.
    7. Vorbereiten einer 96-Well Rundboden-Platte mit 100 µL pro Bohrloch RPMI w / AB. Sanft Aufschwemmen Zellen eine markierte auch durch pipettieren. Dann mischen Sie leicht durch Pipettieren übertragen Sie 100 µL Zellsuspension in einem Brunnen der neue 96-Well-Platte, die bereits mit 100 µL RPMI w / AB zu. Übertragen Sie 100 µL dieser Zellsuspension in einen zweiten leeren Rundboden 96-Well-Platte duplizieren Sie die Platte.
    8. Fahren Sie mit allen markierten Brunnen mit gewachsenen Kolonien. Füllen Sie die leeren Brunnen mit 200 µL RPMI w / Medium AB. Inkubieren Sie die Platten bei 37° C und 5 % CO2.
      Hinweis: Man diese Platten dienen Ausbau der einzelligen Klone ("Lager-Platte") und die andere als "doppelte Platte" für das Screening.
  2. Screening von einzelligen Klone von Durchflusszytometrie und PCR
    Hinweis: Während der einzelligen Klone ausbauen, nutzen die doppelte Platte aus Schritt 3.1.8 Bildschirm Einzeller Klonen für Vorhandensein Reporter Reihenfolge durch PCR (Schritte 3.2.4–3.2.12) und Ausdruck der fluoreszierenden Reporter von Durchflusszytometrie (Schritte 3.2.2–3.2.3) (Abb. 3 c).
    1. Lassen Sie die doppelte Platte 24 bis 48 h inkubieren und die Platte wieder zu duplizieren. Um dies zu tun, geben Sie 100 µL RPMI w / AB in jeder, vorsichtig mischen durch pipettieren und 100 µL auf eine neue Rundboden 96-Well-Platte mit einem Mehrkanal-Pipettieren übertragen. Verwenden Sie eine Platte für Flow Cytometry Screening und die andere für PCR-basierten Screening.
    2. Stimulieren Sie für Flow Cytometry Screening die Zellen mit PMA-Iono. Bereiten Sie ein Mastermix von 0,1 µL des Ionomocin (1 mM Lager), 0,1 µL der PMA (50 µg/µL bestand) und 4,8 µL RPMI w / AB pro Anzahl der Bohrungen, fügen Sie 5 µL Mastermix pro Bohrloch.
      Hinweis: Induktion ist notwendig, um die Klone, erfolgreich zu identifizieren, wo die LTR möglicherweise transcriptionally leisen und daher die fluoreszierende Reporter wird nicht ausgedrückt.
    3. Lassen Sie Zellen 24 h inkubieren und Zellen für Durchflusszytometrie wie in Schritt 2.3.3 beschrieben vorbereiten. Tor lebensfähigen Einzel-Zellen abhängig von der Größe in vorwärts- und seitliche Streuung und fluoreszierende Reporter-gen-Expression durch Durchflusszytometrie zu analysieren (z.B. Ergebnisse, siehe Abbildung 3 c). Wenn TV-Rückgrat einen zweiten fluoreszierenden Reporter mit Promoter enthält (z.B., GLP), Bildschirm Klone für Rückgrat Reporter Ausdruck auch (siehe Schritt 1.2.2 und die folgende Anmerkung zur Erläuterung).
      Hinweis: Rückgrat Reporter Ausdruck zeigt unerwünschte Integration von Rückgrat Sequenzen.
    4. Sobald die Klone in der zweiten doppelten Platte ausreichend gewachsen sind (in der Regel 24 bis 48 h nach Verdoppelung der 96-Well-Platte), bereiten Sie Zelle Lysates mit gDNA für PCR-Screening. Zentrifuge die Platte für 10 min bei 300 X g bei RT sorgfältig abnehmen der Überstand ohne zu stören die Zelle Pellet.
      Hinweis: Alle Schritte für die Vorbereitung von Lysaten und PCR-Reaktionen können mit Mehrkanal-Pipetten durchgeführt werden.
    5. Waschen Sie Zellen mit 100 µL PBS, durch sanfte pipettieren und Zentrifugieren der Platte für 5 min bei 300 X g bei RT Nehmen der PBS und 200 µL der Lyse Puffer [200 mM NaCl, 100 mM Tris-HCl pH 8-8,5, 5 mM EDTA, 0,1 % SDS; fügen Sie 250 – 1.000 µg/mL Proteinase K (Pulver, wiegen frisch lyophilisiert)] pro Bohrloch. Mischen von pipettieren, und das Fahrwerk auf eine neue PCR-Platte zu übertragen.
    6. Die Dichtplatte mit Paraffin Film und 1 h bei 55 ° C in einem Thermocycler inkubieren. Zentrifugieren bei maximaler Geschwindigkeit für 10 min (3.000 X g) zu drehen nach unten Zellenrückstand, und den Überstand auf eine neue PCR-Platte zu übertragen.
      Hinweis: Zelle Lysates in Platten können in diesem Stadium bei 4 ° C bis zur weiteren Verwendung gespeichert werden.
    7. Bereiten Sie eine 96-Well-PCR-Platte mit 110 µL dH2O und fügen Sie 10 µL der Zelle lysate (01:12 Verdünnung). Zelle Lysates möglicherweise zäh und schwer zu pipettieren. Verwenden Sie mindestens 20 µL Pipettieren Tipps.
    8. Proteinase K durch Inkubation für 10 min bei 99 ° C in einem Thermocycler zu inaktivieren. Anschließend verwenden der inaktivierten verwässert und unverwässert Zelle Lysates für PCR-Screening.
    9. Design-Primer für das screening von PCR (P5 und P6) basierend auf der gewählten Reporter-Sequenz um 500 – 800 bp der Reporter-Sequenz zu verstärken. Verwenden Sie für Positivkontrolle PCR Primer P7 und P8, die verstärken 630 bp ein Wildtyp, ungezielte genomischen Locus (NUP188 gen) (Abbildung 3 c und Tabelle 5). Entwerfen Sie eine dritte Primerpaar, die 500 – 600 bp tv Rückgrat als Steuerelement für unspezifische Integration von tv Rückgrat Sequenzen (Backbone PCR) verstärkt.
    10. Für Screening, Kontrolle und Rückgrat PCR, verwenden Sie eine kommerzielle PCR Mastermix (siehe Tabellen 6 und 7 für PCR-Zutaten und Radsport Bedingungen). Verwenden Sie 2 µL verdünnt und inaktivierten lysate in Schritt 3.2.8 als Vorlage vorbereitet und PCR für 38 bis 40 Zyklen der PCR-Amplifikation in 96-Well-Format ausgeführt.
    11. 5 µL des PCR-Produkte auf einem 1,5 % Agarose/TAE Gel zu analysieren.
      Hinweis: Für Kontrolle PCR, einem bestimmten Frequenzband von 630 bp sollte für jede Probe bestätigt, dass die Qualität der Zelle Lysates ausreichend für PCR beobachtet werden. Einem bestimmten Frequenzband in screening-PCR (500 – 800 bp je nach besser gekleideteres Design) zeigt Integration der Reporter-Sequenz. Einem bestimmten Frequenzband für Backbone PCR (500 – 600 bp, je nach besser gekleideteres Design) zeigt unerwünschte Integration von tv-Rückgrat-Sequenzen (z.B. Ergebnisse, siehe Abbildung 3 c).
    12. Kombinieren Sie die Ergebnisse der Durchflusszytometrie (Schritt 3.2.3) und PCR-basierten Screening (Schritt 3.2.12). Wählen Sie Klone, die richtige Größe der PCR-Produkte zeigen in screening-PCR und Positivkontrolle PCR und Ausdruck der fluoreszierenden Reporter nach Induktion mit PMA-Iono Durchflusszytometrie. Schließen Sie Klone aus, die jeder PCR-Produkt im Backbone PCR oder Ausdruck tv Rückgrat-codierte fluoreszierenden Proteins, zeigt unspezifische Integration von tv Rückgrat Sequenz zeigen.
    13. Erweitern Sie nach und nach ausgewählte Klone aus dem Lager 96-Well Platte in größeren gut Formate (48/24/12/6-Well) bis zum Erreichen einer T75 Kultur Kolben Zellenformat durch Zugabe von frischem Medium alle 2 bis 3 Tage. Pflegen Sie eine Zelldichte von 1 x 105 bis 1 x 106 Zellen/mL.
    14. Achten Sie darauf, die Zelle Bestände der Klone bei Erweiterung vorzubereiten: die Zellen zählen, Zentrifugieren bei 300 X g für 5 min bei RT überstand verwerfen und Aussetzen der Zellen sanft in FCS + 10 % DMSO bei 5 x 106 Zellen/mL. Aliquot in kryogenen Fläschchen und Verwendung ein Kryo-Einfrieren Behälter zum Einfrieren der Zellen auf 80 ° C bei 1 ° C/min. Für langfristige Lagerung zu Flüssigkeit N2übertragen.
      Hinweis: Ist es ratsam, einen T75 Zelle Kultur Kolben (d. h., ca. 1 x 107 Zellen) während der Expansion in Vorbereitung der gDNA zur Überprüfung der Zielgruppenansprache von Southern blotting (siehe Abschnitt 3.4) zu behalten.
  3. Überprüfung der Integration Websites durch PCR/Sequenzierung in ausgewählten Klone
    Hinweis: 5' und 3' int.-Knotenpunkte der ausgewählten Klone sind PCR amplifiziert und eingereicht, Sanger Sequenzierung zu überprüfen, korrigieren auf der Ebene der DNA-Sequenz.
    1. Bereiten Sie gDNA der ausgewählten Klone und Jurkat Wildtyp Zellen mit einem kommerziellen gDNA Extraktion Kit vor.
    2. Verwenden Sie Primer-Paaren verbindlich 5'-Ende des Reporters und oberhalb des 5' HA für 5' int Junction (Primer P1 und P2) und dem 3' Ende des Reporters und downstream von 3' HA für 3' int Junction (Primer P3 und P4) wie unter Punkt 2.4 beschrieben. Verwenden Sie Primer P1 und P4, um die gezielte Integration-Website auf das Allel ohne Reporter integrant (Abb. 4a) zu verstärken.
    3. PCR-Reaktionen mit 100 – 200 ng gDNA als Vorlage vorbereiten und durchführen PCR unter Verwendung einer Polymerase mit Korrekturlesen Tätigkeit (siehe Tabellen 1 und 2 für PCR-Zutaten und Radsport Bedingungen).
      Hinweis: Sollten keine Bands zu beobachten sind, verändern die PCR-Radsport-Zustände durch Erhöhung der Anzahl der Zyklen oder Änderung des PCR-Puffers (z. B. durch Hinzufügen von DMSO oder erhöhte Mengen an Mg2 +), oder durch Ändern der Polymerase.
    4. 5 µL des PCR-Produkte auf einem 1,5 % Agarose/TAE Gel zu analysieren. Wenn richtige Band Größen beobachtet werden, die restlichen PCR-Produkt mit einem kommerziellen Kit reinigen und Sanger unterliegen Sequenzierung. Sequenzen von int. Junction 5', 3' int Junction und gezielte Site des Allels ohne Reporter integrant durch Abstimmung mit erwarteten Sequenzen zu überprüfen.
      Hinweis: Die homologe Allel, wo die Reporter hat nicht integriert, wird wahrscheinlich zeigen Cas9-vermittelte Änderungen an der Ziel-Site, wie Nukleotid Einfügungen oder Löschungen (Abb. 4a).
    5. Für Klone, die richtige int. Kreuzung Sequenzen nach Ausrichtung zeigen, führen Sie eine PCR Verstärkung der ganz gezielten Reporters und unterziehen es Sanger Sequenzierung, die richtige Reihenfolge der die integrant zu überprüfen.
  4. Südlicher Fleckanalyse zur Überprüfung der Zielgruppenansprache in ausgewählten Klone
    Hinweis: Südlicher Fleckanalyse der ausgewählten Klone ist verpflichtet, korrekte Ausrichtung zu überprüfen und auszuschließen Cas9-vermittelten Rekombinationsereignisse am Standort gezielte Integration aufgetreten sein könnten.
    1. Entwickeln Sie eine Strategie für die entsprechenden gDNA Verdauung und Sonde das Design vor Beginn des Experiments.
      1. Wählen Sie ein Restriktionsenzym gDNA Beschränkung, die entsprechenden Fragmente von 2 bis 10 kb Länge an der gezielten Website generiert. Bestimmte Restriktionsenzyme, wie z. B. Asp718, BamHI, BglI, BglII, EcoRV, HindIII, Ncoich Pstich, PvuII, Scaich Stuich, und SST Ich habe erfolgreich für hohes Molekulargewicht gDNA zu verdauen.
      2. Zwei verschiedene südlichen Sonden-Design: ein Reporter-spezifische Sonde und genomische Sonde. Die Reporter-spezifische Sonde hybridisiert zu einer Sequenz innerhalb der Reporter (d. h., TdTomato-spezifische Sonde). Die genomische Sonde hybridisiert, eine genomische Region nah an (aber nicht überlappend) ein HA.
      3. Wählen Sie die genomische Sonde, sodass das Fragment erzeugte gDNA Verdauung, die durch die genomische Sonde Bindung erkannt werden in der Länge (mehr als 2 kb) von der gezielten und ungezielte Allele (Abbildung 4 b) unterscheidet. Eine Sondenlänge 400 bis 1000 bp wird empfohlen.
      4. Entwerfen Sie PCR Zündkapseln, die zwei erforderlichen Sonden zu verstärken. Die Reporter-spezifische Sonde aus TV-Vorlage mit einem High-Fidelity-DNA-Polymerase zu verstärken (siehe Tabellen 3 und 4 für PCR-Zutaten und Radsport Bedingungen).
      5. Die genomische Sonde von Wildtyp Jurkat gDNA vorbereitet mit einem kommerziellen gDNA Extraktion Kit mit einer DNA-Polymerase mit Korrekturlesen Tätigkeit zu verstärken (siehe Tabellen 1 und 2 für PCR-Zutaten und Radsport Bedingungen). Reinigen Sie die PCR-Produkte auf einem Agarose/TAE-Gel und extrahieren Sie die Fragmente mit einem kommerziellen Gel Extraction Kit gemäß den Anweisungen des Herstellers zu.
    2. 1 x 107 Zellen der Wildtyp Jurkat Zellen und ausgewählten Klone aus Schritt 3.2.14 entziehen Sie hochmolekularen gDNA.
      1. Pellet-Zellen durch Zentrifugation bei 300 X g für 5 min bei RT, einmal mit PBS waschen und unterbrechen das Pellet in 4 mL Lyse Puffer [200 mM NaCL, 100 mM Tris-HCl pH 8, 5 mM EDTA, 0,1 % SDS; fügen Sie 250 – 1.000 µg/mL Proteinase K (lyophilisierte Pulver frisch wiegen)]. Inkubieren Sie o/n bei 55 ° C, bei 350 u/min in einem Tabletop Thermomixer schütteln.
      2. 4 mL Isopropanol und mischen durch Umkehrung 10 bis 20 Mal. Die gDNA sollte als weißen Niederschlag sichtbar werden. Spool die ausgefällten gDNA auf die feine Spitze eine Glaspipette, Waschen von aufstrebenden in 750 µL 70 % EtOH, und lassen Sie trocknen bei RT (5-10 min).
      3. Schuppen des Niederschlags in einem 1,5 mL Reaktionsgefäß mit 500 µL 1 X TE-Puffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA) und o/n bei 4 ° C, bei 350 u/min schütteln lösen lassen. Jede Pipettieren gDNA aus dieser Phase sollte mit Wide-Bohrung-Tipps zur Vermeidung von Scheren durchgeführt werden.
        Hinweis: Vorbereitung der hochmolekularen gDNA ist essentiell für südlicher Fleckanalyse und handelsüblichen gDNA Vorbereitung Kits sind nicht geeignet.
    3. Digest (zwei Mal) 15 µg des gDNA der ausgewählten Klone und Wildtyp Jurkat Zellen mit ausgewählten Restriktionsenzym (siehe Schritt 3.4.1.1) in einer 60 µL Reaktion mit 6 µL des Enzyms (20 Einheiten/µL): Erstens hinzufügen DNA, Verdauung Puffer und DdH2O, o/n bei 37 ° C inkubieren , dann fügen Sie Enzym und o/n bei Enzym-spezifische Verdauung Temperatur inkubieren. 15 Ug verdaute gDNA ist pro südlichen Sonde erforderlich.
    4. Verwenden Sie 7 µL 60 µL-Beschränkungsauswahl für analytische Gelelektrophorese auf einem 1 % Agarose/TAE-Gel. Ein Abstrich zeigt vollständige Verdauung und gute Qualität der DNA für südlicher Fleckanalyse.
    5. Überstürzen sich die verbleibenden Beschränkungsauswahl durch Zugabe von 01:10 3 M Natriumacetat und 2 Bände 100 % EtOH, dann 1 h bei-80 ° C und Zentrifuge für 30 min bei 15.600 X g bei 4 ° c inkubieren
    6. Den Überstand verwerfen und waschen Sie die Pellets mit 70 % EtOH. Für 15 min bei 15.600 X g bei 4 ° C Zentrifugieren, überstand verwerfen, lassen Sie die Pellets bei RT kurz trocknen und lösen sich in 20 µL DdH2O.
    7. Laufen Sie 1 % Agarose/TAE befleckende Gel, laden 20 uL der verdaute gDNA pro Bahn. Führen Sie das Gel für 2 h bei 60 V, 400 mA.
      Hinweis: Der Prozentsatz der Agarose-Gel und laufen Zeit/Spannung erwarteten Fragmentgröße für südlicher Fleck Erkennung im Schritt 3.4.1.1 berechnet angepasst werden kann. Die folgenden Schritte der südlicher Fleckanalyse werden in einem Zusatzprotokoll (Stufen 1 bis 18) detailliert beschrieben. Diese Schritte umfassen: waschen das befleckende Gel, Löschpapier auf einer Nylon-Membran, radioaktive Sonde Generation Sonde Hybridisierung und Entwicklung des Autoradiograph Films. Vergleichen Sie die erhaltenen Bandenmuster nach Autoradiograph Entwicklung in Schritt 18 (Zusatzprotokoll) mit dem erwarteten Muster nach Southern-Strategie (z.B. Ergebnisse, siehe Abbildung 4 b).
  5. Analyse der Ziel-Veranstaltungen
    Hinweis: Da CRISPR-Cas9-vermittelten Genom Engineering Ziel Effekte, PCR-verstärken die zehn höchsten Rang in Silicoerzeugen kann-vorhergesagt aus Ziel-Sites in Klone ausgewählt und sie Sanger Sequenzierung.
    1. CCTop16 (http://crispr.cos.uni-heidelberg.de) verwenden, um eine Liste der zehn besten generieren in Silico -Zielsequenzen vorhergesagt.
      1. Geben Sie die gRNA Sequenz einschließlich PAM wie für eine Ausrichtung wie die Reihenfolge der Abfrage verwendet. Wählen Sie "NGG" als PAM und "Menschliche Genom" als Referenz für die Ziel-Vorhersage.
      2. Legen Sie maximale insgesamt Fehlanpassungen "4" und Ziel Länge auf die Länge des gRNA ohne PAM vor Ort. Die Ausgabedatei wird eine Rangliste der genomischen Weg-Ziel-Sites für die jeweiligen gRNA bieten.
    2. In Silico extrahieren die genomischen Sequenz 500 bp vor- und nachgelagerten jedes der zehn höchsten Rang Ziel-Hits mit UCSC Genome Browser (http://genome.edu.ucsc.edu) und die Zielposition der off-hit aus CCTop Ergebnisliste.
    3. Für jede aus der Ziel-Sites analysiert werden, verstärkt ein PCR-Primer koppeln, dass Design ein Fragment von 600 bis 700 bp Länge einschließlich der prognostizierten Ziel-Website.
    4. Die ausgewählten Klone und Jurkat Wildtyp Zellen mit einem kommerziellen gDNA Extraktion Kit entziehen Sie gDNA. Für jede Ziel-Site durchführen eine PCR unter Verwendung einer DNA-Polymerase mit Korrekturlesen Tätigkeit (siehe Tabellen 1 und 2 für PCR-Zutaten und Radsport Bedingungen) auf Wild-Typ und der jeweiligen Klon-abgeleitete gDNA.
    5. 5 µL des PCR-Produkte auf einem 1,5 % Agarose/TAE Gel zu analysieren. Richtige Band Größen eingehalten, reinigen das restliche PCR-Produkt mit einem kommerziellen PCR-Reinigung-Kit und unterziehen es Sanger Sequenzierung. Sequenzen der Ziel-Websites in Jurkat-Zellen und die gezielte Klone zu vergleichen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

In diesem repräsentativen Experiment haben wir uns entschieden, einen minimale HIV-1-derived Reporter bestehend aus LTR, TdTomato-kodierenden Sequenz und PolyA Signalsequenz zwei Loci in Intron 5 BACH2 gen17Zielen. Die Loci für targeting wurden nach Nähe zu veröffentlichten wiederkehrende Integration Websites gefunden in verschiedenen Studien auf primäre T-Zellen von HIV-infizierten Patienten2,4,5,6ausgewählt, 7,8 und das Vorhandensein eines PAM-Motivs NGG für Cas9-vermittelte Induktion der Doppel-Strangbrüchen notwendig. Ziel Vektoren wurden gebaut und nach dem beschriebenen Protokoll transfiziert. Der Workflow zur Transfektion, Prüfung für die Ausrichtung von Veranstaltungen, Erzeugung von einzelligen Klone und Screening und Auswahl der Klone ist schematisch in Abbildung 1dargestellt.

Zwei Wochen nach FACS-Anreicherung von transfizierten Zellen konnten wir Reporter-gen-Expression nach PMA-Iono Induktion durch Durchflusszytometrie bei 4 bis 12 % der Zellen, je nach Integrationsort (Daten nicht gezeigt) und PCR-Produkte auf genomischer DNA überspannt die gesamte 5' zu erkennen und 3' Integration Kreuzung aus vorgelagerten 5 ' HA in Reporter Sequenz und flussabwärts von 3' HA in Reporter Sequenz bzw. (Abbildung 3a und 3 b). Haben bestätigt, dass gezielt Veranstaltungen aufgetreten ist, gingen wir um einzellige Klone zu erzeugen, durch die Begrenzung Verdünnung Beschichtung. In unseren Händen war die Beschichtung 5 bis 10 96-Well-Platten pro targeting Konstrukt ausreicht, um genügend Klone für einen erfolgreichen Bildschirm zu erhalten. Im Protokoll (Abschnitt 3.2) ist es wie eine Screening der einzelligen Klone in duplizierten 96-Brunnen durchführen beschrieben. In diesem Zusammenhang müssen nur positive Klone erweitert werden, das spart Zeit und Mühe. In Abbildung 3 csind Beispieldaten von FACS-Screening nach PMA-Iono Induktion und PCR-Screening gezeigt. Wir beobachteten eine Reihe von Klonen mit höchst-, Tiefst- und nicht fluoreszierende Reporter-gen-Expression (Abb. 3 c). Für PCR-Screening ist es wichtig, ein PCR-Steuerelement enthalten, die eine genomischen Locus Wahl zu bestimmen, ob die Qualität der Zelle Lysates ausreichend für PCR ist verstärkt. In unserem Fall haben wir eine 630 bp-Sequenz in der NUP188 gen-Lokus für Kontrolle PCR (Primer-Sequenzen, siehe Tabelle 5). Primer für das screening von PCR wurden dann konzipiert, um einen kürzeren Sequenz befindet sich in der Reporter zu verstärken. Darüber hinaus wurde PCR für eine Sequenz auf dem Ziel-Vektor-Backbone durchgeführt, um alle Klone auszuschließen, die unspezifisch Zielsequenzen Vektor Rückgrat (Backbone PCR, Daten nicht gezeigt) integriert hatte.

Vorgewählten Klone wurden dann erweitert und weiter für die korrekte Ausrichtung von südlicher Fleck und PCR und Sequenzierung analysiert. Südlicher Fleck erfolgte mittels eine Reporter-spezifische-Sonde und eine spezielle Sonde für die genomischen Locus Bindung außerhalb der Reporter aber nicht innerhalb der Homologie Wappen der Targetingvektor. Interessanterweise alle Klone, die durch Southern Blot getestet wurden waren positive Screening-PCR im Voraus, aber nur ein Teil richtig Band Größen in südlicher Fleckanalyse zeigte und hatte heterozygously die Reporter (Abbildung 4 b) integriert. Es ist daher notwendig, nicht nur auf screening PCR-Ergebnisse verlassen, sondern auch überprüfen, korrekte Ausrichtung von Southern blotting. Um zu überprüfen, korrekte Ausrichtung auf der Ebene der DNA-Sequenz, Integration Kreuzungen wurden mittels PCR verstärkt und Produkte wurden Sanger-Sequenzierung (Abb. 4a). Vor allem offenbart Sequenzierung des Ziel Website homologen Allel, wo die Reporter nicht integriert hatte, Cas9-vermittelte Änderungen. In Abbildung 4aBeispiele für eine Cas9-vermittelten löschen wird angezeigt. Um für Cas9-vermittelten Ziel Effekte zu testen, wurde eine Liste mit den höchsten Rang von Ziel-Sites generiert, wie in Abschnitt 3.5 beschrieben. Zehn besten aus Ziel-Sites wurden aus genomischer DNA der Klonkrieger PCR verstärkt, und die Produkte Sanger Sequenzierung. In die gezielte einzellige Klone, die wir generiert, wurden keine Abweichungen von Jurkat Wildtyp Sequenzen an den zehn höchsten Rang Ziel Standorten beobachtet.

Figure 3
Abbildung 3: Screening von einzelligen Klone für die Ausrichtung von Veranstaltungen. (ein) schematische Darstellung der Primer Design für die Erkennung des Zielens Ereignisse mittels PCR in gemischten gezielte Zellpopulation. Primer-Paare für die Erkennung von 5' Integration Kreuzung (P1, P2) und 3' Integration Junction (P3, P4) werden als Pfeile angezeigt. Primer P1 und P4 auch dazu dienen, verstärken gezielt Nenner für das Allel ohne Reporter integrant (b) Genomic DNA gemischte gezielte Zellpopulation wurde 10 Tage nach FACS Anreicherung von transfizierten Zellen vorbereitet und analysiert für 5' Integration Junction (P1, P2 ), 3' Integration Junction (P3, P4, Daten nicht gezeigt) und Wildtyp Allel von der gezielten Lokus (P1, P4). Wildtyp Jurkat Zellen (wt) diente als Kontrolle. (c) ersten Bildschirm der einzelligen Klone in 96-Well Platten. 96-Well-Platten mit einzelligen Klone wurden gezeigt, für die korrekte Ausrichtung von Durchflusszytometrie nach PMA-Iono Induktion und PCR-Analyse. Ergebnisse zum Beispiel Klone werden angezeigt. PCR erfolgte auf Zelle Lysates mit Reporter-spezifische Primer (screening PCR; P5, P6) und Verstärkung einer genomischen Locus Primer (PCR, hier Steuern: NUP188 Locus; P7, P8). Zelle Lysates Wildtyp Jurkat Zellen (wt) und genomischer DNA aus HIVisB2 Klonen (B2)18 mit kommerziell erhältlichen Kit diente als Negativkontrolle für das screening von PCR und Positivkontrolle für Kontrolle PCR, bzw. vorbereitet. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 4
Abbildung 4: Analyse der ausgewählten einzellige Klone für richtige Reporter Integration. (ein) Sequenzanalyse der Integration Kreuzungen und gezielte Locus auf das Allel ohne Reporter integrant. Grundierung Paare für die Erkennung von 5' Integration Kreuzung (P1, P2), 3' Integration Junction (P3, P4) und gezielte Lokus des Allels ohne Reporter integrant (P1, P4) dienten. PCR-Produkte wurden verstärkt aus genomischer DNA einzellige Klone und Sanger Sequenzierung. Sequenzierung Ergebnisse waren erwarteten Sequenzen ausgerichtet. Gezeigt werden Beispieldaten von einem Klon. Sequenz Chromatogramme von Genom/HA Junction und HA/Reporter Kreuzung sind für 5' und 3' Integration Junction gezeigt. Spiele werden als Punkte angezeigt. Bindungsstelle des gRNA wird mit einer Box markiert. Cas9-induzierte Mutationen sind rot hervorgehoben. Schematische Darstellung der besser gekleideteres Design ist unten dargestellt. Pfeile zeigen Grundierung Positionen zur Verstärkung. (b) südlicher Fleckanalyse von ausgewählten gezielt einzelne Zelle Klonen und Jurkat Wildtyp Zellen. Südlicher Fleckanalyse erfolgte auf genomischer DNA mit einem Reporter-spezifische-Sonde und einer Sonde erkennen einer genomischen Sequenz in gezielten und Wildtyp Allel (genomische Sonde). Daten von 7 Beispiel Klonen werden angezeigt. Klone mit richtigen Band Größen sind mit Boxen gekennzeichnet. Verdünnte Ziel Vector Plasmid diente als positive Kontrolle (+). Schaltplan für südlicher Fleckanalyse ist unten dargestellt. Bitte klicken Sie hier für eine größere Version dieser Figur.

Reagenz Fügen Sie pro Reaktion
Nach vorne Primer (20 µM) 1 ΜL
Reverse Primer (20 µM) 1 ΜL
10 x Taq Puffer 5 ΜL
1 µL dNTPs (2,5 mM) 1 ΜL
MgCl (50 mM) 1 ΜL
DMSO 1,5 ΜL
gDNA (50-100 ng/µL) 2 ΜL
Nuklease-freies Wasser Füllen Sie bis zu 49,5 µL
Taq-DNA-Polymerase (5 U/mL) 0,5 ΜL
Reaktionsvolumen 50 ΜL

Tabelle 1: Rezept für PCR unter Verwendung einer Polymerase mit Korrekturlesen Tätigkeit. Die angegebene jedes Reagenz pro PCR-Reaktion hinzugefügt werden. PCR dient zur Amplifikation genomischen DNA als Vorlage verwenden. Das Rezept wird in Schritt 1.2.2.2 (Verstärkung der Homologie Arme), Schritt 3.3.3 (Überprüfung der Integration Websites), Schritt 3.4.1.5 (Erzeugung von genomischen Sonde für südlicher Fleck) und Schritt 3.5.4 (Analyse der Ziel-Ereignisse) verwendet.

Schritte Temperatur Zeit Zyklen
Anfängliche Denaturierung 95 ° C 2 min 1
Denaturierung 95 ° C 40 s 30 -35
Glühen 58 ° C 45 s
Erweiterung 72 ° C 1 min/kb
Letzte Erweiterung 72 ° C 10 min 1

Tabelle 2: Radsport Bedingungen für PCR unter Verwendung einer Polymerase mit Korrekturlesen Tätigkeit. Radsport Bedingungen entsprechen PCR Rezept in Tabelle 1aufgeführt.

Reagenz Fügen Sie pro Reaktion
Nach vorne Primer (20 µM) 1 ΜL
Reverse Primer (20 µM) 1 ΜL
5 x High-Fidelity-Puffer 5 ΜL
1 µL dNTPs (2,5 mM) 1 ΜL
gDNA (50 – 100 ng/µL) oder Plasmid DNA (50 ng/µL) 2 µL gDNA oder
1 µL Plasmid DNA
Nuklease-freies Wasser Füllen Sie bis zu 49,5 µL
High-Fidelity-DNA-polymerase 0,5 ΜL
Reaktionsvolumen 50 ΜL

Tabelle 3: Rezept für PCR unter Verwendung einer High Fidelity Polymerase. Die angegebene jedes Reagenz pro PCR-Reaktion hinzugefügt werden. PCR ist für robuste Verstärkung von DNA-Templates bestimmt. Das Rezept wird in 2.4.2 (Erkennung von targeting Ereignissen) und Schritt 3.4.1.4 (Erzeugung von Reporter-spezifische Sonde für Southern Blot) verwendet.

Schritte Temperatur Zeit Zyklen
Anfängliche Denaturierung 98 ° C 30 s 1
Denaturierung 98 ° C 10 s 30 - 35
Glühen 58 ° C 30 s
Erweiterung 72 ° C 30 s/kb
Letzte Erweiterung 72 ° C 10 min 1

Tabelle 4: Radsport Bedingungen für PCR unter Verwendung einer High Fidelity Polymerase. Radsport Bedingungen entsprechen PCR Rezept in Tabelle 3aufgeführt.

Grundierung Sequenz (5'-3')
P7 Kontrolle PCR F CTTTGTTGGGTAAGCATGGAGGTC
P8 Kontrolle PCR R CAGTTACTCACCTTTGCACATAGG

Tabelle 5: Oligonukleotid-Sequenzen zur Steuerung PCR. Forward und reverse Primer für die Amplifikation eines 630 bp Fragments NUP188 Locus sind angegeben.

Reagenz Fügen Sie pro Reaktion
Ready-to-Use PCR Master Mix 8 ΜL
Nach vorne Primer (20 µM) 1 ΜL
Reverse Primer (20 µM) 1 ΜL
Nuklease-freies Wasser 8 µl
Zelle lysate (01:12 Verdünnung) 2 ΜL
gesamte Reaktionsvolumen 20 ΜL

Tabelle 6: Rezept für Screening-PCR. Die angegebene jedes Reagenz pro PCR-Reaktion hinzugefügt werden. PCR-Rezept ist für das screening von PCR im Schritt 3.2.11 vorgesehen.

Schritte Temperatur Zeit Zyklen
Pre-PCR Denaturierung 94 ° C 2 min 1
Glühen 58 ° C 1 min
Erweiterung 72 ° C 1 min
Denaturierung 94 ° C 30 s 38
Glühen 58 ° C 30 s
Erweiterung 72 ° C 1 min
Letzte Erweiterung 72 ° C 10 min 1

Tabelle 7: Radfahren Bedingungen für Screening-PCR. Radsport Bedingungen entsprechen PCR Rezept aufgeführt Tabelle 6.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Hier beschreiben wir ein Protokoll, um HIV-1-derived Jurkat Reporter Modelle mit ausgewählten proviralen Integration Websites Anwendung CRISPR-Cas9-basierte Genom Engineering generieren.

Mehrere Punkte des Protokolls erfordert besondere Aufmerksamkeit bei der Planung. Erstens der Lokus ins Visier genommen werden gewählt werden sorgfältig, wie einige Loci leichter zum Ziel als andere sein könnte (z. B., je nach dem Chromatin-Status der Region und das Ziel-Sequenz selbst). Repetitive Sequenzen sind hart, in den Targetingvektor zu klonen und sind oft nicht eindeutig innerhalb des Genoms. Regionen von repressiven Chromatin sind schwerer zu CRISPR-Cas9 System19,20als Ziel wählen.

Zweitens ist die Wahl des gRNA entscheidend für die Zielgruppenadressierung CRISPR-Cas9-vermittelten. Zur Erzeugung von Modellen für HIV-Infektion mit repräsentativen Integration Websites, würde man gRNA so nah wie möglich an eine Integration Hotspot binden wollen. Diese Seite möglicherweise jedoch nicht ideal für die Cas9-Einstellung; Daher muss ein Kompromiss zwischen Nähe der gRNA Sequenz zum Integrationsort Wahl und gRNA Qualität erfolgen. Wir haben dem E-CRISP-Webtool zuverlässig bei der Vorhersage des funktionalen gRNAs gefunden. Es ist auch möglich, ein Vorversuch gRNA vorübergehend zum Ausdruck bringen, wie mehrere gRNAs zusammen mit Cas9 in der Zelle Art ausgerichtet, gefolgt von einem Screening auf Mutationen durchführen. Eine geeignete gRNA direkte Cas9 effizient an den Zielstandort und die gRNA ergänzende Website zeigen Mutationen. Die Länge der HAs (1.000 bp upstream und downstream von der Integrationsort) wurde nach bisher veröffentlichten Studien11gewählt. In der Regel führt reduziert die Länge der Homologie Arme reduzierte targeting Frequenz. Einer Länge von 1.000 bp der Homologie Arm stellt einen guten Kompromiss zwischen ausreichender targeting Häufigkeit und Leichtigkeit von Ziel-Vektor-Konstruktion.

Drittens muss genügend Zeit für ein gutes Design des Reporter-Konstrukts ausgegeben werden. Die minimalen Reporter verwendet in diesem Protokoll enthält eine HIV-1 NL4-3 LTR und eine TdTomato Sequenz Kodierung abgeleitet, wurde konzipiert, basiert auf folgendem Prinzip: einzelne LTRs beschrieben worden als allein verbleibenden proviralen Fragmente in mehreren Fällen von klonalen Ausbau in chronisch HIV-1-infizierten Personen21. Es wird erwartet, dass der LTR stark Einflüsse der Chromatin-Status bei Integration Websites ist und die Rekrutierung von zellulären komplexe organisiert. Wir haben einen minimalen HIV-Reporter mit Schwerpunkt auf die HIV-LTR als wichtigsten regulatorischen genetisches Element gewählt, dann TdTomato als fluoreszierende LTR Aktivität Marker statt weitere HIV-1 Gene eingeführt, als Genom engineering Häufigkeit berichtet wurde, um höhere mit kleiner sein Targeting, fügt11. Betrachtet man die zeitaufwendige Schritte des tv Klonen, klonale Selektion, Screening und Überprüfung der Klone ist es ratsam, sorgfältig prüfen das Design von der HIV-Reporter im Rahmen der funktionellen Studien, die schließlich auf durchgeführt werden gezielte Zell-Linien. Man könnte, z. B. die Aufnahme von Knebel-Leader-Sequenz, 3' HIV LTR und/oder anderen viralen Gensequenzen in der Reporter betrachten. Das Protokoll kann solche Konstrukte verschiedene Reporter leicht angepasst.

Im Allgemeinen ist es wichtig, die Wahl der Zelltyp ins Visier genommen werden, wie einzelne Zelle Klon-Generation mit bestimmten Zelllinien schwierig sein kann. Wir fanden, dass Jurkat Zellen nicht sehr effizient bei der einzigen Klon Generation; Allerdings haben wir beschlossen diese Zelle für die bisher bekannten Verwendung in latente HIV Infektion Modelle9wählen. Wir erhalten die besten Ergebnisse in Jurkat klonalen Verdünnung Beschichtung mit 50 % konditionierten Medium, wenn Platten ungestört in einem Inkubator gelassen wurden, die nicht mehr als 3 Mal pro Woche geöffnet wurde. Wenn mit einer anderen Zelllinie gewünscht wird, ist es ratsam, die Möglichkeit der Erzeugung von einzelligen Klone durch die Durchführung einer Verdünnung Plattieren Experiment Vortest. Ein weiterer Punkt im Auge zu behalten ist die Variation der Transfektion Preise von verschiedenen Zelllinien. Wenn Transfektion nicht machbar für die gewählten Zell-Linie ist, können Electroporating die Zellen für die Ausrichtung notwendig sein. Beachten Sie, dass die Wahl der Zell-Linie für eine Ausrichtung verwendet nicht von technischen Aspekten, wie z. B. Effizienz für die Transfektion oder einzigen Klon Generation bestimmt werden kann. Funktionale Aspekte können auch berücksichtigt werden, z. B. transkriptionelle Aktivität oder Inducibility gezielte gen-Locus. Dies erfordert möglicherweise Screening von verschiedenen Zelllinien vor den targeting-Workflow.

Es sollte betont werden, dass das beschriebene Protokoll zeitintensiv ist. Es sollte 3 bis 6 Monate ab dem ersten Schritt zum endgültigen klonalen Zelllinien zu erwarten sein. Die südlicher Fleckanalyse, die verwendet wird, überprüfen für standortspezifische einzelne Integrationsveranstaltungen, mag umständlich, aber nach unserer Erfahrung ist es sehr wichtig - als nur eine Teilmenge der einzelligen Klone, die die erwarteten Integration zeigte Kreuzungen pro PCR zeigte eine Musterung in der Southern Blot zu korrigieren. Im Idealfall sollten Experimentatoren erzeugen eine Anzahl von Klonen mit dem gleichen Einsatz gezielt auf die gleichen Integrationsort Steuern für klonale Effekte in jedem nachfolgenden Experimente, die machen verwenden der Klone. Es ist möglich, heterozygot sowie homozygot Ausrichtung zu tun. In Heterozygoten Reporter Zelllinien dürfte das Allel ohne ein integrant zeigen Änderungen an der Cas9 Ausrichtung auf Website, die durch PCR (Abb. 4a) untersucht werden kann. Homozygot targeting empfehlen wir, dass beide Allele nacheinander ausgerichtet sein.

Unter Berücksichtigung dieser Überlegungen, bietet diesen Workflow die Möglichkeit, leistungsstarke Zellmodellen zu generieren, die verwendet werden, um das Verständnis der chronischen HIV-Infektion erhöhen. Beispielsweise kann proviralen Tätigkeit als Reaktion auf Latenz-Umkehr-Agenten im Rahmen der wiederkehrenden Integration Websites getestet werden. Dies kann von besonderem Interesse für Forscher auf dem Gebiet sein, da Positionseffekte postuliert worden, HIV-Latenz und Umkehr22beeinflussen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts preisgeben.

Acknowledgments

Wir danken Britta Weseloh und Bettina Abel für technische Hilfe. Wir danken auch Arne Düsedau und Jana Hennesen (Flow Cytometry Technologieplattform, Heinrich-Pette-Institut) für den technischen Support.

Materials

Name Company Catalog Number Comments
pX330-U6-Chimeric_BB-cBh-hSpCas9 Addgene 42230 vector for expression of SpCas9 and gRNA
pMK GeneArt mammalian expression vector for cloning
cDNA3.1 Invitrogen V79020 mammalian expression vector for cloning
BbsI New England Biolabs R0539S restriction enzyme
NEBuilder Hifi DNA Assembly Cloning Kit New England Biolabs E5520S Assembly cloning kit used for target vector generation
TaqPlus Precision PCR System Agilent Technologies 600210 DNA polymerase with proofreading activity used for amplification of homology arms (step 1.2.2.2), verification of integration site and reporter sequence (step 3.3.3 and 3.3.5), generation of genomic probe for Southern blot (step 3.4.1.5) and analysis of off-target events (step 3.5.4)
96-well tissue culture plate (round-bottom) TPP 92097 tissue culture plates for dilution plating
Phusion High-Fidelity DNA polymerase New England Biolabs M0530 L DNA polymerase used for detection of targeting events (step 2.4.2) and generation ofreporter-specific probe for Southern blot (step 3.4.1.4)
Dimethyl sulfoxide (DMSO) Sigma-Aldrich D9170 dimethyl sulfoxide as PCR additive
Magnesium Chloride (MgCl2) Solution New England Biolabs B9021S MgCl2 solution as PCR additive
Deoxynucleotide (dNTP) Solution Mix New England Biolabs N0447S dNTP mixture with 10 mM of each nt for PCR reactions
5PRIME HotMasterMix 5PRIME 2200400 ready-to-use PCR mix used for screening PCR (step 3.2.11)
QIAamp DNA blood mini kit Qiagen 51106 DNA isolation and purification kit
QIAquick PCR Purification Kit Qiagen 28106 PCR Purification Kit
RPMI 1640 without glutamine Lonza BE12-167F cell culture medium
Fetal Bovine Serum South Africa Charge PAN Biotech P123002 cell culture medium supplement
L-glutamine Biochrom K 0282 cell culture medium supplement
Penicillin/Streptomycin 10.000 U/mL/ 10.000 µg/mL Biochrom A 2212 cell culture medium supplement
Gibco Opti-MEM Reduced Serum Media Thermo Fisher Scientific 31985062 cell culture medium with reduced serum concentration optimized for transfection
TransIT-Jurkat Mirus Bio MIR2125 transfection reagent
phorbol 12-myristate 13-acetate Sigma-Aldrich P8139-1MG cell culture reagent
Ionomycin Sigma-Aldrich I0634-1MG cell culture reagent
Syringe-driven filter unit, PES membrane, 0,22 µm Millex SLGP033RB filter unit for sterile filtration
Heracell 150i incubator Thermo Fisher Scientific 51026280 tissue culture incubator
Amershan Hybond-N+ GE Healthcare RPN1520B positively charged nylon membrane for DNA and RNA blotting
Stratalinker 1800 Stratagene 400072 UV crosslinker
High Prime Roche 11585592001 kit for labeling of DNA with radioactive dCTP using random oligonucleotides as primers
illustra ProbeQuant G-50 Micro Columns GE Healthcare 28-9034-08 chromatography spin-columns for purification of labeled DNA

DOWNLOAD MATERIALS LIST

References

  1. Hughes, S. H., Coffin, J. M. What Integration Sites Tell Us about HIV Persistence. Cell Host and Microbe. 19, (5), 588-598 (2016).
  2. Marini, B., Kertesz-Farkas, A., et al. Nuclear architecture dictates HIV-1 integration site selection. Nature. 521, (7551), 227-231 (2015).
  3. Cesana, D., Santoni de Sio, F. R., et al. HIV-1-mediated insertional activation of STAT5B and BACH2 trigger viral reservoir in T regulatory cells. Nature Communications. 8, (1), 498 (2017).
  4. Cohn, L. B., Silva, I. T., et al. HIV-1 Integration Landscape during Latent and Active Infection. Cell. 160, (3), 420-432 (2015).
  5. Han, Y., Lassen, K., et al. Resting CD4+ T cells from human immunodeficiency virus type 1 (HIV-1)-infected individuals carry integrated HIV-1 genomes within actively transcribed host genes. Journal of Virology. 78, (12), 6122-6133 (2004).
  6. Ikeda, T., Shibata, J., Yoshimura, K., Koito, A., Matsushita, S. Recurrent HIV-1 integration at the BACH2 locus in resting CD4+ T cell populations during effective highly active antiretroviral therapy. The Journal of Infectious Diseases. 195, (5), 716-725 (2007).
  7. Wagner, T. A., Mclaughlin, S., et al. Proliferation of cells with HIV integrated into cancer genes contributes to persistent infection. Science. 345, (6196), 570-573 (2014).
  8. Maldarelli, F., Wu, X., et al. Specific HIV integration sites are linked to clonal expansion and persistence of infected cells. Science. 345, (6193), 179-183 (2014).
  9. Jordan, A., Bisgrove, D., Verdin, E. HIV reproducibly establishes a latent infection after acute infection of T cells in vitro. The EMBO Journal. 22, (8), 1868-1877 (2003).
  10. Mack, K. D., Jin, X., et al. HIV insertions within and proximal to host cell genes are a common finding in tissues containing high levels of HIV DNA and macrophage-associated p24 antigen expression. Journal of Acquired Immune Deficiency Syndromes. 33, (3), 308-320 (2003).
  11. Byrne, S. M., Ortiz, L., Mali, P., Aach, J., Church, G. M. Multi-kilobase homozygous targeted gene replacement in human induced pluripotent stem cells. Nucleic Acids Research. 43, (3), 1-12 (2014).
  12. ZhangLab. CRISPR Genome Engineering Toolbox: Target Sequence Cloning Protocol. Addgene website. Available from: https://www.addgene.org/static/cms/filer_public/e6/5a/e65a9ef8-c8ac-4f88-98da-3b7d7960394c/zhang-lab-general-cloning-protocol.pdf (2013).
  13. Moser, F. Addgene. Gibson Assembly Protocol. Addgene website. Available from: https://www.addgene.org/protocols/gibson-assembly/ (2009).
  14. Addgene Plasmid Cloning by PCR. Addgene website. Available from: https://www.addgene.org/protocols/pcr-cloning/ (2014).
  15. Addgene Plasmid Cloning by Restriction Enzyme Digest (aka Subcloning). Addgene website. Available from: https://www.addgene.org/protocols/subcloning/ (2013).
  16. Stemmer, M., Thumberger, T., Del Sol Keyer, M., Wittbrodt, J., Mateo, J. L. CCTop: An intuitive, flexible and reliable CRISPR-Cas9 target prediction tool. Public Library of Science (PLoS) ONE. 10, (4), (2015).
  17. Lange, U. C., Bialek, J. K., Walther, T., Hauber, J. Pinpointing recurrent proviral integration sites in new models for latent HIV-1 infection. Virus Research. 249, (2018).
  18. Bialek, J. K., Dunay, G. A., et al. Targeted HIV-1 Latency Reversal Using CRISPR-Cas9-Derived Transcriptional Activator Systems. PloS ONE. 11, (6), e0158294 (2016).
  19. Lee, C. M., Davis, T. H., Bao, G. Examination of CRISPR-Cas9 design tools and the effect of target site accessibility on Cas9 activity. Experimental Physiology. 103, (4), 456-460 (2018).
  20. Jensen, K. T., Fløe, L., et al. Chromatin accessibility and guide sequence secondary structure affect CRISPR-Cas9 gene editing efficiency. FEBS Letters. 591, (13), 1892-1901 (2017).
  21. Simonetti, F. R., Sobolewski, M. D., et al. Clonally expanded CD4 + T cells can produce infectious HIV-1 in vivo. Proceedings of the National Academy of Sciences. 113, (7), 1883-1888 (2016).
  22. Chen, H. C., Martinez, J. P., Zorita, E., Meyerhans, A., Filion, G. J. Position effects influence HIV latency reversal. Nature Structural and Molecular Biology. 24, (1), 47-54 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics