CRISPR-Cas9-gebaseerde genoom Engineering voor het genereren van Jurkat verslaggever modellen voor HIV-1 infectie met geselecteerde proviraal integratie Sites

* These authors contributed equally
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

We presenteren een genoom engineering workflow voor de generatie van nieuwe in vitro modellen voor HIV-1 infectie die recapituleren proviraal integratie op geselecteerde genomic sites. Doelgerichtheid van HIV-afgeleide verslaggevers wordt vergemakkelijkt door CRISPR-Cas9-gemedieerde, site-specific genoom manipulatie. Gedetailleerde protocollen voor eencellige kloon generatie, screening en juiste targeting verificatie worden geleverd.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Bialek, J. K., Walther, T., Hauber, J., Lange, U. C. CRISPR-Cas9-based Genome Engineering to Generate Jurkat Reporter Models for HIV-1 Infection with Selected Proviral Integration Sites. J. Vis. Exp. (141), e58572, doi:10.3791/58572 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Humaan immunodeficiëntie virus (HIV) integreert zijn proviraal DNA niet-willekeurig in het genoom van de cel host op terugkerende sites en genomische hotspots. Hier presenteren we een gedetailleerd protocol voor het genereren van nieuwe in vitro modellen voor HIV-infectie met gekozen genomic integratie sites met behulp van CRISPR-Cas9-gebaseerde genoom engineering technologie. Met deze methode kan een verslaggever opeenvolging van keuze worden geïntegreerd in een gerichte, gekozen genomic locus, als gevolg van de integratie van klinisch relevante sites.

In het protocol, worden het ontwerp van een HIV-afgeleide verslaggever en kiezen voor een doel-site en gRNA-sequence beschreven. Een targeting vector met homologie armen is gebouwd en in Jurkat T cellen transfected. De verslaggever-reeks is gericht op de geselecteerde genomic site door homologe recombinatie vergemakkelijkt door een Cas9-gemedieerde dubbel-strand break op de doelsite. Eencellige klonen zijn gegenereerd en gescreend voor het targeten van gebeurtenissen door stroom cytometry en PCR. Geselecteerde klonen zijn dan uitgebreid en de juiste targeting is geverifieerd door PCR, sequencing en Southern blotting. Potentiële uit doelsoort zijn gebeurtenissen van CRISPR-Cas9-gemedieerde genoom engineering worden geanalyseerd.

Met behulp van dit protocol, de nieuwe cel cultuur systemen kan dat model HIV-infectie op klinisch relevante integratie sites worden gegenereerd. Hoewel de generatie van eencellige klonen en verificatie van de juiste verslaggever reeks integratie tijdrovend is, zijn de resulterende klonale lijnen krachtige hulpmiddelen voor het analyseren van functioneel proviraal integratie site keuze.

Introduction

Integratie van proviraal DNA in het genoom van de host na infectie is een cruciale stap in de levenscyclus van het humaan immunodeficiëntie virus (HIV). Na de integratie, HIV blijft door de oprichting van latentie in langlevende CD4 + T cel subsets zoals geheugen CD4 + T cellen. HIV integratie lijkt te zijn non-random1,2. Een aantal genomic hotspots met productlevering geïntegreerde proviraal DNA is vastgesteld in verschillende studies door de sequencing van integratie sites in acuut en chronisch geïnfecteerde individuen2,3,4 ,5,6,7,8. Interessant, werd sommige van deze sites van de integratie, de zelfde locus gedetecteerd in een groot deel van de geïnfecteerde cellen, wat leidt tot het idee dat integratie op terugkerende sites klonale uitbreiding1positief kan beïnvloeden.

Om te gaan ons begrip van de betekenis van terugkerende integratie sites, moet proviraal integratie site keuze worden onderzocht. Echter, verschillende technische aspecten bestuderen HIV integratie belemmeren site keuze en de gevolgen. In grote lijnen gebruikt cel cultuur modellen voor HIV latentie zoals JLat cellijnen niet klinisch relevante terugkerende integratie sites9 weerspiegelen. Studies over primaire patiënt-afgeleide cellen, aan de ene kant, beschrijving van integratie site landschap inschakelen door sequentiebepaling maar laat niet voor functionele analyses. Om onze kennis is geen voldoende experimentele model beschikbaar voor de geselecteerde klinisch relevante integratie sites functioneel te analyseren.

Hier presenteren we een gedetailleerd workflow voor het genereren van nieuwe modellen voor HIV-infectie met behulp van CRISPR-Cas9-gebaseerde genoom engineering technologie. De hierin beschreven werkstroom kan worden gebruikt voor het genereren van verslaggever T cel-afgeleide cellijnen die model van HIV-infectie, uitvoering van een genomically geïntegreerde proviraal verslaggever bij een gekozen integratie-site. Ze zijn dus nieuwe instrumenten te onderzoeken hoe de site proviraal integratie kan invloed hebben op HIV biologie en hoe de provirus reageert op verschillende behandelingsstrategieën (b.v., inducibility door latency achteruitrijlicht agenten) bijeenkomen. Onze methode maakt gebruik van de voordelen van CRISPR-Cas9-gebaseerde genoom techniek, in welke integratie van de verslaggever opeenvolging van homologe recombinatie wordt vergemakkelijkt door een Cas9 nuclease-geïnduceerde dubbele-strand break op de doelsite. Doel sites voor integratie zijn gekozen op basis van nabijheid van de sites beschreven terugkerende integratie van studies over HIV-geïnfecteerde individuen en de aanwezigheid van geschikte PAM motieven voor Cas9-gemedieerde genoom engineering.

In onze voorbeeldige resultaten, hebben we gericht op de BACH2 gen locus, welke codes voor de BTB en CNC homologie transcriptionele regulator 2. In chronisch HIV-geïnfecteerde individuen op antiretrovirale therapie is BACH2 een van de loci verrijking van geïntegreerde HIV-1 sequenties3,6,7,8,10te tonen. Wij hebben een minimale HIV-afgeleide verslaggever bestaande van HIV-1-afgeleide lange terminal herhalen (LTR), tdTomato codering sequentie, en groeihormoon voor runderen (BGH) polyadenylatie signaal (PA), die we hebben gericht op twee specifieke sites in BACH2 intron 5 gekozen. Het gepresenteerde protocol is geoptimaliseerd voor Jurkat cellen, een menselijke CD4 + T cel-afgeleide schorsing cellijn, maar andere cel lijnen kunnen worden gebruikt en het protocol aangepast. We presenteren een gedetailleerde workflow voor selectie van de doelsite, bouw van doel vector met homologie armen, CRISPR-Cas9-gemedieerde doelgerichtheid van de verslaggever in de gekozen genomic locatie, de generatie en de selectie van klonen lijnen en uitgebreide verificatie van de nieuw gegenereerde, gerichte verslaggever cellijnen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. gericht op de strategie voor genoom Engineering en Targeting Vector (tv)-ontwerp

Opmerking: De eerste stap van genoom engineering impliceert selectie en generatie van de nodige instrumenten voor CRISPR-Cas9-gemedieerde targeting. Selectie van een genomic integratie site locus, keuze van celtype voor targeting, en het ontwerp van een HIV-afgeleide verslaggever voor integratie moeten voorafgaan aan deze stap. Dit protocol beschrijft doelgerichtheid van een HIV-LTR_tdTomato_BGH-PA minimale verslaggever in Jurkat doelcellen. Een stroomschema van de workflow voor CRISPR-Cas9-gebaseerde targeting, generatie, screening en verificatie van klonen lijnen is afgebeeld in Figuur 1. De beschreven targeting strategie gebruikt de S. pyogenes -Cas9 (SpCas9) voor het genereren van gRNA geleide dsDNA einden op een integratie van de geselecteerde site. De verslaggever is het vervolgens gericht in de gekozen genomic locus door middel van homologe recombinatie door middel van een niet-gelineariseerde targeting vector (tv), waarin de volgorde van de verslaggever geflankeerd door zogenaamde 5' en 3' homologie wapens (HA)-11.

  1. Keuze van de gerichte locus, gRNA, en gericht op vector design
    1. Kies thegenomic locus worden gericht op basis van de individuele wetenschappelijke vraag. Gebruik gepubliceerde lijsten met sites bij terugkerende integratie van HIV bij patiënten in verschillende gevonden studies2,3,4,5,6,7,8 als een richtsnoer. In silico extract de genomic opeenvolging van de gewenste genomic locus gerichte (sequentie van de volledige gen) of minimaal 5 kb aan de genomic volgorde met behulp van UCSC genome browser (http:// genome.edu.ucsc.edu).
    2. Kies gids RNAs (gRNAs) van 20 nt voor het targeten van de gekozen genomic locus met behulp van de E-CRISP webtool (http://www.e-crisp.org).
      1. Selecteer "Homo sapiens GRCh38" als het organisme. Input 2.000 bp van de genomic sequentie die betrekking hebben op de gewenste genomic locus uitgepakt in stap 1.1.1.
      2. Start een gRNA zoeken met behulp van middellange toepassingsinstellingen (elke PAM, elke 5' basis, af-doelstellingen tolereren incongruenties en introns/CPG eilanden zijn uitgesloten). Verschijnt een lijst met mogelijke gRNA ontwerpen, ranking van hoog naar lagere scores voor specificiteit en efficiëntie.
      3. Selecteer een gRNA dat bij voorkeur toont een hoge score voor specificiteit en efficiëntie en zo dicht mogelijk bij de gewenste genomic locus worden gericht.
        Opmerking: Een compromis tussen de nabijheid van de gewenste genomic locus en ontwerp van specifieke en efficiënte gRNA moet worden gevonden.
    3. Blast de volgorde van de gekozen gRNA tegen het genoom van de verwijzing de NCBI blast browser (https://blast.ncbi.nlm.nih.gov) gebruiken om te controleren voor de uniciteit van de gRNA binding site.
      1. Selecteer "mens" als het genoom. Ingang van de volgorde van de gRNA als de query-reeks. Selecteer "zeer soortgelijk sequenties" (megablast) als het programma. Zorg ervoor dat de volgorde van gRNA uniek is. Zo niet, koos een verschillende gRNA weer uit stap 1.1.2.3 en blast.
    4. Zodra gRNA volgorde is gekozen, selecteer in silico 1000 bp upstream- en downstream van gRNA reeks in genomic reeks uitgepakt in stap 1.1.1 als 5' en 3' HA dienovereenkomstig.
      Opmerking: De gRNAs moet homoloog aan de gekozen genomic integratie site locus en gelegen naast een protospacer aangrenzende motief (PAM; bijvoorbeeld, NGG voor SpCas9) (Figuur 2a). De tv bevat de verslaggever volgorde die is 5' en 3' geflankeerd door heeft. Heeft dekking 1000 bp bedrijven stroomopwaarts en stroomafwaarts van de gRNA reeks11. De volgorde van de volledige gRNA moet niet worden opgenomen in de HA. Een overlapping van maximaal 5 nt is aanvaardbaar (Figuur 2a).
  2. Generatie van gRNA en gericht op vectoren
    Opmerking: Zie Figuur 2bvoor vector regelingen.
    1. Gebruik voor het genereren van een speerpunt voor de expressie van SpCas9 en gRNA, de pX330-U6-Chimeric_BB-cBh-hSpCas9 als de ruggengraat, waaruit zowel SpCas9 als de één gids RNA (sgRNA) kunnen worden gelijktijdig uitgedrukt. Gebruiken om te clonen de volgorde van de gRNA in de ruggengraat, de BbsI beperking sites12.
    2. Voor het genereren van de tv, een hoge-kopie plasmide als backbone (bijvoorbeeld, , pMK of cDNA3.1) te kiezen.
      1. Eerst, assembleren de verslaggever (in dit protocol: LTR_tdTomato_BGH-PA) in de ruggengraat van de constructie door Gibson vergadering clong13 met behulp van een commerciële vergadering klonen kit, en invoering van 5' en 3' flankerende beperkingsplaatsen (b.v., 5' PacI en 3' SmaI) voor verdere beperking spijsvertering klonen van de HAs.
      2. Versterken van 1000 bp van de fragmenten van de HA gekozen in stap 1.1.4 van genomic DNA (gDNA) van het celtype worden gericht (in dit protocol: Jurkat cellen) met behulp van een polymerase van DNA met proeflezen activiteit (Zie tabellen 1 en 2 voor PCR ingrediënten en fietsen van voorwaarden). Vervolgens, verslaggever flankerende beperkingsplaatsen op de 5' en 3' einden van elke HA (PacI op 5' HA aan beide uiteinden, SmaI op 3' HA aan beide uiteinden) in te voeren.
      3. Sequentieel heeft kloon in construct ruggengraat al met de reporter (gegenereerd in stap 1.2.2.1) door restrictie-enzym klonen van14,15. Ten eerste kloon in 5' HA gebruikt PacI beperkingsplaatsen, vervolgens clone in 3' HA met behulp van SmaI beperkingsplaatsen.
        Opmerking: Als tv ruggengraat een extra fluorescerende verslaggever bevat, ongewenste ruggengraat integratie kan worden geëvalueerd door stroom cytometry (zie stap 3.2.2 en 3.2.3). Als tv ruggengraat geen fluorescerende verslaggever bevat, ruggengraat integratie moet worden beoordeeld met behulp van PCR (zie stap 3.2.8).

Figure 1
Figuur 1: Workflow voor CRISPR-Cas9-gemedieerde targeting, generatie en selectie van klonen verslaggever lijnen met gedefinieerde integratie site. (A) de doelgroep vector genereren en Jurkat T cellen met de doelgroep vector- en Cas9/gRNA expressie plasmide transduce. (B) Enrich de transfected cellen 72 h post transfectie door FACS. (C) laat de cellen groeien voor 10 tot 14 dagen en bevestigen van het vóórkomen van gerichte evenementen door PCR en stroom cytometry. (D) genereren eencellige klonen door beperking van de verdunnings- en laat klonen voor 3 weken groeien. (E) het scherm van het klonen voor juiste targeting door PCR en stroom cytometry in 96-Wells-indeling. Geselecteerde klonen uit te breiden. (F) Controleer juiste targeting in geselecteerde klonen door Southern blot, PCR en sequentiebepaling en analyse van off-target gebeurtenissen van Cas9 endonuclease activiteit. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2: Targeting strategie en vector ontwerp. (een) gRNA en keuze van homologie wapens. 20 nt gRNA is homoloog aan de genomic gekozen doelsite en grenzend aan een marcheer homologie wapens zijn complementair aan 1000 bp up- en "downstream" van de gRNA en mag niet de volgorde van de gRNA gelegen. (b) schema's vector- en gRNA/Cas9 vector te targeten. De targeting vector bestaat uit de gekozen verslaggever-reeks dat 5' en 3' geflankeerd door de homologie-armen. De gRNA/Cas9-vector is gebaseerd op de pX330-U6-Chimeric_BB-cBh-hSpCas9-backbone. (c) Schematische voorstelling van de doelgerichtheid van homologe recombinatie. Doel vector- en guideRNA/Cas9 vector zijn transfected in Jurkat cellen. Cas9 bemiddelt met een dubbele streng break aan de genomic doelsite (aangegeven met *) en faciliteert homologe recombinatie en integratie van verslaggever sequentie in de genomische doel locus. Klik hier voor een grotere versie van dit cijfer.

2. CRISPR-Cas9-gebaseerde Targeting van Jurkat cellen

  1. De transfectie van Jurkat cellen
    1. 24 h vóór transfectie, plaat 1.25 x 106 Jurkat T cellen in 2.5 mL RPMI 1640 werden aangevuld met foetaal kalfsserum van 10% (v/v) (FCS), en 4 mM L-glutamine [hierna aangeduid als "RPMI w.o. antibiotica (AB)"] per putje van de plaat van een 6-well cel cultuur. Voor een enkele targeting experiment, bereiden een volledige plaat van de 6-well (dat wil zeggen, 6 elk met 2,5 mL celsuspensie wells).
    2. De volgende dag, transfect mede de cellen met de circulaire tv en pX330-U6-Chimeric_BB-cBh-hSpCas9/gRNA met behulp van een specifieke transfectie reagens voor Jurkat cellen.
      1. Toevoegen 2 µg van circulaire tv en 2 µg voor pX330-U6-Chimeric_BB-cBh-hSpCas9/gRNA per putje aan 250 µL van commerciële RPMI medium met verminderde serumconcentratie geoptimaliseerd voor Transfectie (RPMI met 50% korting in het serum) in een reactiebuis en meng goed.
      2. Voeg 12 µL van transfectiereagens langzaam aan het DNA/medium zonder het aanraken van de wand van de buis en wervelen. Laat het mengsel Incubeer gedurende 15 minuten en ontkleuring toevoegen aan één putje van cellen. Incubeer de cellen bij 37 ° C en 5% CO2.
        Opmerking: De voorbereiding van de transfectie reactie kan worden opgeschaald. Middellange ongewijzigd is vereist na transfectie.
  2. Verrijking van transfected cellen door fluorescentie-activated cell sorting (FACS)
    1. 72 h na transfectie, zwembad transfected cellen, ze tellen, en voorbereiden van verrijking door FACS. Verzamelen van de cellen in een conische tube van 50 mL, centrifuge bij 300 x g en kamertemperatuur (RT) voor 4 min, wassen van de cellen een keer in PBS, nogmaals centrifugeren, schorten de pellet in een passend bedrag van FACS buffer (PBS aangevuld met 1% FCS + 1 mM EDTA) in 1 x 10 7 cellen/mL, en tot slot breng kwantitatief over in een buis FACS.
    2. De cellen onverminderd FACS en sorteren van degenen die uitdrukking geven aan de fluorescerende verslaggever van de tv (b.v., tdTomato in dit protocol). Het verzamelen van de cellen in RPMI 1640 aangevuld met 10% FCS, 4 mM L-glutamine, en 50 U/mL penicilline en streptomycine (hierna aangeduid als "RPMI w / AB").
    3. Na FACS sorteren, wassen van de cellen eenmaal door het toevoegen van 20 mL RPMI w / AB naar gesorteerde cellen en centrifugeer bij 300 x g voor 4 min op RT. resuspendeer de pellet cel in een juiste hoeveelheid RPMI w / AB en plaat van de cellen in een put van een cel cultuur plaat met de passende omvang volgens cel nummer post-FACS.
      Opmerking: Cultuur sorteren de cellen in een klein volume (bijvoorbeeld, 24-well), zoals aanzienlijke niveaus van celdood zijn waargenomen in de eerste week na targeting (tot 80-90%).
    4. Vouw de gemengde gerichte celpopulatie tot aan een dichtheid van 1 x 106 cellen/mL in een 75 cm² kolf voor de cultuur van de cel. Zulks zal voeren rond de 10-14 dagen post-FACS sorteren.
  3. Bevestiging van gerichte evenementen door stroom cytometry in de gemengde gerichte celpopulatie
    1. Na 10-14 dagen van expansie (wanneer cellen hebt bereikt een dichtheid van 1 x 106 cellen/mL in een maatkolf van 75 cm2 cel cultuur), twee putjes van de plaat met 1 x 106 cellen van de gemengde gericht celpopulatie in 1 mL van RPMI w / AB in een 12-well celkweek plaat.
    2. De HIV-LTR van de verslaggever induceren (generatie tv is beschreven in stap 1.2.2.1.) in een van de putten door toevoeging van 50 ng/mL phorbol 12-myristaat 13-acetaat (PMA) en 1 µM Ionomycin (hierna: PMA-Iono). Als het besturingselement niet-geïnduceerde cellen worden gebruikt in de tweede put. Cultuur van de geïnduceerde zowel de niet-geïnduceerde cellen gedurende 24 uur.
    3. Nemen van 0,5 mL celsuspensie van niet-geïnduceerde en geïnduceerde cellen (per stuk), was ze een keer in PBS en schorten elk in 200 µL van FACS buffer.
    4. 100.000 cellen door stroom cytometry analyseren. Poort van de levensvatbare single-cellen op basis van grootte in voorwaartse en zijwaartse scatter, en analyseren van fluorescerende verslaggever genexpressie.
      Opmerking: Bij deze stap (10-14 dagen post-FACS sortering), voorbijgaande expressie van fluorescerende reporter door transfectie niet langer moet aantoonbaar. Fluorescerende expressie op dit tijdstip wijst genomic integratie van verslaggever sequentie.
  4. Detectie van gerichte evenementen door PCR op genomic DNA van de gemengde gerichte celpopulatie
    Opmerking: Te detecteren targeting evenementen via PCR, ontwerp twee primerparen specifiek voor de integratie (int.) afslag 5' en 3' int. junction. Voor de 5' int. kruising PCR, de voorwaartse primer moet binden upstream van het 5' HA en de omgekeerde primer in de LTR van de verslaggever (inleidingen P1 en P2 in Figuur 3a). Het paar primer voor de 3' int. kruising PCR-element moet omvatten van de PA van de verslaggever aan 100-200-bp stroomafwaarts van de 3' HA (inleidingen P3 en P4 in Figuur 3a). Inleidingen P1 en P4 zal ook dienen voor de versterking van de niet-doelgerichte allel in de gemengde gerichte bevolking. Voor een schematische, Zie Figuur 3a.
    1. GDNA van 2 mL celsuspensie van de gemengde gerichte celpopulatie uit stap 2.2.4 voor te bereiden. Gebruik een gDNA extractie kit volgens protocol van de fabrikant. De gDNA van niet-doelgerichte cellen vervolgens als een besturingselement worden bereid.
    2. Uitvoeren van int. junction PCRs (inleidingen P1/P2 en P3/P4 voor 5' en 3' int. junction, respectievelijk) en niet-doelgerichte allel PCR (inleidingen P1/P4) met behulp van een hifi-polymerase van DNA (Zie tabellen 3 en 4 voor PCR ingrediënten en fietsen voorwaarden) . Analyseren 5 µL van het PCR producten op een agarose/TAE-gel van 1,5%.
      Opmerking: Als de gemengde gerichte bevolking cellen die genoom engineering hebben ondergaan bevat, een specifiek PCR-product moet worden opgemerkt dat is niet in de gDNA van niet-doelgerichte cellen (negatieve controle) worden opgespoord. Voor de niet-doelgerichte allel PCR, moet men een product van dezelfde grootte voor zowel de gerichte en niet-doelgerichte cellen (positieve controle voor genomic P1 en P4 inleidingen) waarnemen. Geen banden worden waargenomen, overweeg PCR fietsen voorwaarden wijzigen door verhoging van het aantal cycli of wijzigen van de PCR-buffer (bijvoorbeeld door middel van toevoeging van DMSO of verhoogde hoeveelheid Mg2 +), of door het veranderen van de polymerase.

3. productie van klonen lijnen en Screening voor juiste Targeting

Opmerking: Genereren na bevestiging van de gerichte evenementen in de gemengde gerichte celpopulatie door stroom cytometry en PCR (secties 2.2-2.4), eencellige klonen (duur: 28 tot 35 dagen) en scherm voor correcte integratie van de verslaggever-reeks.

  1. Generatie van eencellige klonen door verdunning plating
    1. Jurkat-geconditioneerd medium tevoren bereiden: RPMI w / AB medium uit gezonde, onbehandelde Jurkat T cellen uitgegroeid tot 1 x 106 cellen/mL, centrifuge voor 5 min. 300 x gopstijgen en filteren van het supernatans dat met behulp van een 0,22 µm spuit filter eenheid.
      Opmerking: Het geconditioneerde medium bewaren bij 4 ° C voor korte termijn opslag of bij-20 ° C voor opslag langer dan 1 week. 20 tot 30 mL van geconditioneerde medium vóór verdunning beplating voor te bereiden.
    2. Gerichte cellen uit stap 2.2.4 na 10-14 dagen van expansie tellen en vul hen in RPMI w / AB tot een concentratie van 1 x 105 cellen/mL. Neem 100 µL van 1 x 105 cellen/mL oplossing en met 9.9 mL van medium tot een concentratie van 1000 cellen/mL verdund. Neem 1 mL van 1000 cellen/mL oplossing en Verdun met 9 mL middellange tot een concentratie van 100 cellen/mL wordt bereikt.
    3. Plaat 96-wells-platen met 1 cel per putje en 2 cellen per putje. Voor 1 cel per putje, neem 1 mL van 100 cellen/mL oplossing en meng zachtjes met 5 mL van geconditioneerde medium en 4 mL verse voedingsbodem in een steriele reagens reservoir.
    4. Voor 2 cellen per putje, neem 2 mL van 100 cellen/mL oplossing en meng zachtjes met 5 mL van geconditioneerde medium en 3 mL verse voedingsbodem. Ronde plaat 96-Wells beneden platen met de verdunning van de respectieve cel per goed met behulp van een meerkanaals Pipetteer 100 µL.
      Opmerking: 5 tot 10 96-wells-platen per richten constructie zijn voldoende om het verkrijgen van klonen voor screening.
    5. Stapelen van de 96-wells-platen, dekking van elke stack met een 6-well plaat met 3 mL PBS in elk putje en Incubeer de platen bij 37 ° C in een broedstoof cultuur bevochtigde cel met 5% CO2 voor 3 weken.
      Opmerking: Het kweekmedium cel niet veranderen gedurende deze tijd. Niet openen de incubator meer dan een of twee keer per week. De beste resultaten worden waargenomen in voorbroeders met open waterreservoir.
    6. Na 3 weken van incubatie, de aanwezigheid van volwassen kolonies met behulp van de lichte microscopie (4 X vergroting) visueel te bevestigen en de putjes met volwassen kolonies te markeren zodat ze zichtbaar als punten op de bodem van de putten zijn.
    7. Een 96-Wells ronde-bodemplaat met RPMI w / AB 100 µL per putje te bereiden. Zachtjes resuspendeer de cellen van een gemarkeerde goed door pipetteren. Pipetteer 100 µL celsuspensie in één putje van de nieuwe 96-wells-plaat al met 100 µL RPMI w / AB en meng zachtjes door pipetteren. Pipetteer 100 µL van deze celsuspensie in een tweede lege 96-Wells ronde-bodemplaat te dupliceren van de plaat.
    8. Alle gemarkeerde putjes met volwassen kolonies voortzetten. Vul alle lege putjes met 200 µL van RPMI w / AB medium. Incubeer de platen bij 37° C en 5% CO2.
      Opmerking: Één van deze platen zal dienen voor de uitbreiding van eencellige klonen ("voorraad plaat") en anderzijds als een "dubbele plaat" voor screening.
  2. Screening van eencellige klonen door stroom cytometry en PCR
    Opmerking: Terwijl de eencellige klonen uit te breiden zijn, gebruikt de dubbele plaat uit stap 3.1.8 scherm eencellige klonen voor aanwezigheid van verslaggever sequentie door PCR (stappen 3.2.4–3.2.12) en expressie van fluorescerende reporter door stroom cytometry (stappen 3.2.2–3.2.3) (Figuur 3 c).
    1. Laat de dubbele plaat Incubeer gedurende 24 tot 48 h en dupliceren de plaat weer. Om dit te doen, voeg 100 µL van RPMI w / AB aan elk putje, meng zachtjes door pipetteren en overbrengen in een nieuwe 96-Wells ronde-bodemplaat met behulp van een meerkanaals Pipetteer 100 µL. Voor stroom cytometry screening en anderzijds voor PCR-gebaseerde screening een plaat te gebruiken.
    2. Stimuleren van de cellen met de PMA-Iono voor stroom cytometry voorstelling. Bereiden van een mastermix van 0.1 µL van Ionomocin (1 mM voorraad), 0.1 µL van PMA (50 µg/µL stock), en 4.8 µL van RPMI w / AB per nummer van putten, voeg toe 5 µL per putje mastermix.
      Opmerking: Inductie is noodzakelijk om te identificeren met succes klonen, waar de LTR wellicht transcriptionally stil en daarom de fluorescerende verslaggever komt niet tot uiting.
    3. Laat cellen Incubeer gedurende 24u en cellen voor stroom cytometry zoals beschreven in stap 2.3.3 te bereiden. Poort van elke levensvatbare single-cellen op basis van grootte in voorwaartse en zijwaartse scatter en analyseren van fluorescerende verslaggever genexpressie door stroom cytometry (bijvoorbeeld resultaten, Zie Figuur 3 c). Als tv ruggengraat een tweede fluorescerende verslaggever met promotor bevat (b.v., GFP), eventuele klonen voor ruggengraat verslaggever expressie ook scherm (zie stap 1.2.2 en de opmerking hieronder voor uitleg).
      Opmerking: Backbone verslaggever expressie geeft ongewenste integratie van opeenvolgingen van de ruggengraat.
    4. Zodra de klonen in de tweede dubbele plaat voldoende gegroeid (meestal 24 tot 48 uur na de verdubbeling van de 96-wells-plaat), cel lysates met gDNA voor PCR screening voor te bereiden. Centrifugeer de plaat gedurende 10 min bij 300 x g bij RT. zorgvuldig opstijgen de bovendrijvende vloeistof zonder verstoring van de cel-pellet.
      Opmerking: Alle stappen voor de voorbereiding van lysates en PCR reacties kunnen worden uitgevoerd met meerkanaals pipetten.
    5. Cellen met 100 µL van PBS wassen door zachte pipetteren en centrifugeren van de plaat gedurende 5 minuten bij 300 x g bij RT. De PBS opstijgen en voeg 200 µL van lysis buffer [200 mM NaCl, 100 mM Tris-HCl pH 8-8,5, 5 mM EDTA, 0,1% SDS; Voeg vervolgens 250 – 1000 µg Mn/mL proteïnase K (gelyofiliseerde vorm van poeder, weeg in vers)] per putje. Meng zachtjes door pipetteren, en spoel de suspensie aan een nieuwe plaat van de PCR.
    6. Afdichting van de plaat met paraffine film en incubeer gedurende 1 uur bij 55 ° C in een thermocycler. Centrifugeer bij maximumsnelheid voor 10 min (3000 x g) te draaien naar beneden cel puin, en het supernatant overbrengen in een nieuwe PCR-plaat.
      Opmerking: Cel lysates in platen kunnen worden opgeslagen in dit stadium bij 4 ° C tot verder gebruik.
    7. Bereiden van een 96-Wells PCR plaat met 110 µL van dH2O en voeg 10 µL van cel lysate (1:12 verdunning). Cel lysates mogelijk viskeuze en moeilijk te Pipetteer. Gebruik ten minste 20-µL Pipetteer tips.
    8. Inactivering van proteïnase K door incubatie gedurende 10 min bij 99 ° C in een thermocycler. Gebruik vervolgens de geïnactiveerd en verdunde cel lysates voor PCR screening.
    9. Het ontwerpen van inleidingen voor PCR (P5 en P6) op basis van de volgorde van de gekozen verslaggever om te versterken van 500 – 800 bp van de verslaggever reeks screening. Voor positieve controle PCR gebruikt inleidingen P7 en P8 dat versterken van 630 bp van een wild-type, niet-doelgerichte genomic locus (NUP188 gene) (Figuur 3 c en tabel 5). Het ontwerp van een derde primer paar dat versterkt van 500-600 bp van de ruggengraat van de tv als een besturingselement voor aspecifieke integratie van tv ruggengraat sequenties (backbone PCR).
    10. Voor screening, controle en ruggengraat PCR, gebruiken een commerciële PCR mastermix (Zie tabellen 6 en 7 voor PCR ingrediënten en fietsen voorwaarden). 2 µL van de verdunde en geïnactiveerd lysate voorbereid in stap 3.2.8 als een sjabloon en uitvoeren van PCR voor 38-40 cycli van PCR versterking in 96-Wells-indeling gebruiken.
    11. Analyseren 5 µL van het PCR producten op een agarose/TAE-gel van 1,5%.
      Opmerking: Voor controle PCR, een specifieke band van 630 bp moet worden waargenomen voor elk monster, waarin wordt bevestigd dat de kwaliteit van de cel lysates voor PCR volstaat. Een specifieke band bij bevolkingsonderzoek PCR (500 – 800 bp afhankelijk van primer ontwerp) wijst op integratie van de verslaggever-reeks. Een specifieke band voor backbone PCR (500-600 bp, afhankelijk van het ontwerp van de primer) wijst op ongewenste integratie van tv ruggengraat sequenties (bijvoorbeeld resultaten, Zie Figuur 3 c).
    12. Het resultaat van stroom cytometry (stap 3.2.3) en PCR-gebaseerde screening (stap 3.2.12) combineert. Selecteer klonen waaruit de juiste maten van PCR producten in PCR en positieve controle PCR en expressie van fluorescerende verslaggever na inductie met PMA-Iono in stroom cytometry screening. Uitsluiten van klonen dat PCR product in ruggengraat PCR of expressie van tv backbone-gecodeerde TL proteïne, die aspecifieke integratie van tv ruggengraat reeks aangeeft.
    13. Geleidelijk aan geselecteerde klonen van de voorraad 96-wells-plaat naar grotere goed formaten (48/24/12/6-well) uit te breiden tot het bereiken van een T75 celnotatie cultuur kolf door toevoeging van vers medium elke 2 tot 3 dagen. Het handhaven van een celdichtheid tussen 1 x 10,5 en 1 x 106 cellen/mL.
    14. Zorg ervoor dat cel voorraden van klonen gedurende de uitbreiding voorbereiden: cellen tellen, centrifugeer bij 300 x g gedurende 5 min op RT, verwijder het supernatant en opschorten van de cellen zachtjes in FCS + 10% DMSO bij 5 x 106 cellen/mL. ALIQUOT in cryogene flesjes en gebruik een cryo-bevriezing container te bevriezen van de cellen tot 80 ° C op 1 ° C/min. Voor lange termijn opslag, overbrengen naar vloeistof N2.
      Opmerking: Is het raadzaam om een T75 cel cultuur kolf (dwz, ongeveer 1 x 107 cellen) behouden tijdens de expansie in voorbereiding van gDNA voor verificatie van targeting door Southern blotting (zie punt 3.4).
  3. Verificatie van sites van de integratie door PCR/sequentiebepaling in geselecteerde klonen
    Opmerking: 5' en 3' int. kruispunten van de geselecteerde klonen zijn PCR versterkt en voorgelegd aan Sanger rangschikkend om te controleren of corrigeren gericht op op het niveau van de opeenvolging van DNA.
    1. GDNA van de geselecteerde klonen en Jurkat wild-type cellen met behulp van een commerciële gDNA extractie kit voor te bereiden.
    2. Gebruik primerparen bindend van het einde 5' van de verslaggever en stroomopwaarts van 5' HA van 5' int. junction (inleidingen P1 en P2) en het 3' uiteinde van de verslaggever en "downstream" van 3' HA van 3' int. junction (inleidingen P3 en P4) zoals beschreven in stap 2.4. Inleidingen P1 en P4 gebruiken om aan te vullen van de site van de gerichte integratie op het allel zonder verslaggever integrant (figuur 4a).
    3. PCR reacties met 100-200 ng van gDNA als een sjabloon voorbereiden en uitvoeren van PCR een polymerase met proeflezen activiteit (Zie tabellen 1 en 2 voor PCR ingrediënten en fietsen voorwaarden).
      Opmerking: Als geen banden worden waargenomen, kunt u overwegen de PCR fietsen voorwaarden wijzigen door verhoging van het aantal cycli of wijzigen van de PCR-buffer (bijvoorbeeld door toevoeging van DMSO of verhoogde hoeveelheid Mg2 +), of door het veranderen van de polymerase.
    4. Analyseren 5 µL van het PCR producten op een agarose/TAE-gel van 1,5%. Als de juiste band maten worden waargenomen, de resterende PCR product met behulp van een commerciële kit zuiveren en onder voorbehoud het Sanger sequencing. Controleer of sequenties van int. junction 5', 3' int. junction, en gerichte website van het allel zonder verslaggever integrant door ze met verwachte sequenties.
      Opmerking: Het homologe allel waar de verslaggever niet heeft geïntegreerd zal waarschijnlijk Toon Cas9-gemedieerde veranderingen op de doelsite, zoals nucleotide invoegingen of verwijderingen (figuur 4a).
    5. Voor klonen die juiste int. junction sequenties na uitlijning tonen, het verrichten van een PCR de hele gerichte verslaggever frequentiebanden te versterken en onder voorbehoud het Sanger rangschikkend om te controleren of de juiste volgorde van de integrant.
  4. Zuidelijke vlekkenanalyse voor verificatie van targeting in geselecteerde klonen
    Opmerking: Zuidelijke vlekkenanalyse van geselecteerde klonen vereist is om te controleren of de juiste targeting en recombinatie Cas9-gemedieerde gebeurtenissen die zich mogelijk hebben voorgedaan bij de gerichte integratie-site sluiten.
    1. Een strategie ontwikkelen voor passende gDNA spijsvertering en sonde van het ontwerp voor het begin van het experiment.
      1. Selecteer een restrictie-enzym gDNA beperking dat passende fragmenten van 2 tot en met 10 kb lengte op de gerichte site genereert. Bepaalde enzymen van de beperking, zoals Asp718, BamHI, BglI, BglII, EcoRV, HindIII, Ncoik, Pstik, PvuII, Scaik, StuI, en SST Ik heb met succes gebruikt voor het verteren van ultrahoog moleculair gewicht gDNA.
      2. Ontwerpen van twee verschillende zuidelijke sondes: een verslaggever-specifieke sonde en genomische sonde. De verslaggever-specifieke sonde hybridizes in een reeks binnen de verslaggever (dwz, tdTomato-specifieke sonde). De genomische sonde hybridizes naar een genomic regio dicht bij (maar niet overlappen) één HA.
      3. Kies de genomic sonde zodat het fragment gegenereerd door gDNA spijsvertering die zal worden gedetecteerd door genomic sonde bindende in lengte (meer dan 2 kb) van de gerichte en niet-doelgerichte allelen (figuur 4b verschilt). Een sonde de lengte van 400 tot 1000 bp wordt aanbevolen.
      4. PCR inleidingen te versterken de twee vereiste sondes te ontwerpen. De verslaggever-specifieke sonde van tv sjabloon met behulp van een hifi-polymerase van DNA te versterken (Zie tabellen 3 en 4 voor PCR ingrediënten en fietsen voorwaarden).
      5. Versterken van de genomic sonde van wild-type Jurkat gDNA bereid met een commerciële gDNA extractie kit een polymerase van DNA met proeflezen activiteit (Zie tabellen 1 en 2 voor PCR ingrediënten en fietsen voorwaarden). Zuiveren van de PCR producten op een agarose/TAE-gel en haalt de fragmenten met behulp van een commerciële gel extractie kit volgens de instructies van de fabrikant.
    2. Het uittreksel van ultrahoog moleculair gewicht gDNA van 1 x 107 cellen van de wild-type Jurkat cellen en geselecteerde klonen uit stap 3.2.14.
      1. De cellen door centrifugeren bij 300 x g gedurende 5 min op RT pellet, een keer wassen met PBS en Suspendeer de pellet in 4 mL lysisbuffermengsel [200 mM NaCL, 100 mM Tris-HCl pH 8, 5 mM EDTA, 0,1% SDS; Voeg vervolgens 250 – 1000 µg Mn/mL proteïnase K (gelyofiliseerd poeder wegen in vers)]. O/n bij 55 ° C, schudden bij 350 t/min in een tafelblad thermomixer uit te broeden.
      2. Voeg 4 mL isopropanol en meng door inversie 10 tot 20 keer. De gDNA moet worden zichtbaar als witte neerslag. Spoel de geprecipiteerde gDNA op de fijne tip van een glazen pipet, wassen door opkomende in 750 µL van 70% EtOH, en laat droog op RT (5 tot 10 min).
      3. Schuur het neerslag in een 1,5 mL reactiebuis met 500 µL van 1 x TE buffer (10 mM Tris-HCl pH 8,0, 1 mM EDTA) en laat los o/n bij 4 ° C, schudden bij 350 t/min. Elke pipetteren van gDNA vanaf dit stadium moet gebeuren met wide-boring tips om te voorkomen dat scheren.
        Opmerking: Voorbereiding van ultrahoog moleculair gewicht gDNA is van essentieel belang voor de zuidelijke vlekkenanalyse en verkrijgbare gDNA voorbereiding kits zijn niet geschikt.
    3. Digest (twee keer) 15 µg voor gDNA van de geselecteerde klonen en wild-type Jurkat cellen met geselecteerde restrictie-enzym (zie stap 3.4.1.1) in een reactie van de 60 µL met 6 µL van enzym (20 eenheden/µL): eerste, toevoegen van DNA, spijsvertering buffer en ddH2O, incubeer o/n bij 37 ° C , dan toevoegen van enzym en o/n op enzym-specifieke spijsvertering temperatuur uit te broeden. 15 mg verteerd gDNA is vereist per zuidelijke sonde.
    4. 7 µL van de 60 µL beperking digest voor analytische gelelektroforese op een 1% agarose/TAE gel gebruiken. Een uitstrijkje geeft aan volledige spijsvertering en goede kwaliteit van DNA voor zuidelijke vlekkenanalyse.
    5. De overige beperking digest neerslaan door toevoeging van 1:10 3 M natriumacetaat en 2 delen 100% EtOH, vervolgens Incubeer gedurende 1 uur bij-80 ° C en Centrifugeer gedurende 30 minuten bij 15,600 x g bij 4 ° C.
    6. Verwijder het supernatant en wassen van de pellet met 70% EtOH. Centrifugeer gedurende 15 min bij 15,600 x g bij 4 ° C, verwijder het supernatant, laat de pellet kort drogen op RT en ontbinden in 20 µL van ddH2O.
    7. Stel 1% agarose/TAE Bevlekkende gel, laden 20 uL van verteerd gDNA per rijstrook. De gel voor 2 h draaien op 60 V, 400 mA.
      Opmerking: Het percentage van agarose gel en lopende tijd/spanning kan worden aangepast volgens de grootte van de verwachte fragment voor detectie van de zuidelijke vlek berekend in stap 3.4.1.1. De volgende stappen van de zuidelijke vlekkenanalyse worden beschreven in detail in een aanvullend protocol (stappen 1 tot en met 18). Deze stappen bestaan uit: wassen van de Bevlekkende gel, bevlekken op een nylon membraan, radioactieve sonde generatie sonde hybridisatie en ontwikkeling van autoradiograph film. Vergelijk de verkregen banding patroon na autoradiograph ontwikkeling in stap 18 (aanvullend protocol) met het verwachte patroon volgens zuidelijke strategie (bijvoorbeeld resultaten, Zie figuur 4b).
  5. Analyse van off-target evenementen
    Opmerking: Omdat CRISPR-Cas9-gemedieerde genoom engineering uit-target effecten, PCR-versterken van de tien hoogste gerangschikte in silico genereren kunt-voorspeld uit doelsoort sites in geselecteerde klonen en onderwerpen aan Sanger sequencing.
    1. CCTop16 (http://crispr.cos.uni-heidelberg.de) gebruiken voor het genereren van een lijst van de tien hoogste gerangschikte in silico voorspelde af-target sequenties.
      1. Ingang van de volgorde van de gRNA met inbegrip van PAM zoals gebruikt voor het richten als de query-reeks. Selecteer "NGG" als PAM en "Menselijk genoom" als de referentie voor off-target voorspelling.
      2. Instellen van de maximale totale incongruenties "4" en doel site lengte aan de lengte van de gRNA zonder PAM. Het uitvoerbestand zorgt een ranglijst van genomic af-target sites voor de respectieve gRNA.
    2. Pak de genomic reeks 500 bp upstream- en downstream van elk van de tien hoogste gerangschikte af-target hits met behulp van UCSC Genome Browser (http://genome.edu.ucsc.edu) en de positie van de af-target hit uit CCTop resultatenlijst in silico .
    3. Voor elk van de doel-sites worden geanalyseerd, versterkt design een PCR Inleiding koppelen die een fragment van 600 tot 700 bp in lengte met inbegrip van de voorspelde af-doelsite.
    4. Pak gDNA uit de geselecteerde klonen en Jurkat wild-type cellen met behulp van een commerciële gDNA extractie kit. Voor elke uit-doelsite, verrichten een herlezing van de activiteit van een polymerase van DNA met PCR (Zie tabellen 1 en 2 voor PCR ingrediënten en fietsen voorwaarden) op wild-type en de respectieve kloon-afgeleide gDNA.
    5. Analyseren 5 µL van het PCR producten op een agarose/TAE-gel van 1,5%. Als de juiste band maten worden waargenomen, het zuiveren van het resterende PCR-product met behulp van een commerciële PCR zuivering kit en onder voorbehoud het Sanger sequencing. Vergelijk sequenties van de af-target sites in Jurkat cellen en de gerichte klonen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

In dit representatieve experiment hebben wij besloten te richten op een minimale HIV-1-afgeleide verslaggever die bestaat uit een LTR, volgorde tdTomato-codering en polyA-signaal volgorde naar twee loci in intron 5 van de BACH2 gen17. De loci voor targeting werden gekozen op basis van nabijheid naar gepubliceerde terugkerende integratie sites gevonden in verschillende studies op primaire T-cellen van HIV-geïnfecteerde patiënten2,4,5,6, 7,8 en de aanwezigheid van een PAM motief NGG nodig voor Cas9-gemedieerde inductie van dubbel-strand einden. Doel vectoren werden gebouwd en transfected volgens het protocol beschreven. De werkstroom voor transfectie, controleren voor het targeten van gebeurtenissen, generatie van eencellige klonen, en screening en selectie van klonen wordt schematisch weergegeven in Figuur 1.

Twee weken na FACS-verrijking van transfected cellen, waren we kundig voor speurder verslaggever genexpressie na PMA-Iono inductie door stroom cytometry in 4 tot en met 12% van de cellen, afhankelijk van integratie plaats (gegevens niet worden weergegeven) en de PCR producten op genomic DNA verspreid over de hele 5' en 3' integratie kruispunt van stroomopwaarts van 5' HA in verslaggever reeks en stroomafwaarts van 3' HA in verslaggever volgnummer, respectievelijk (Figuur 3a en 3b). Hebben bevestigd dat gericht op gebeurtenissen voorgedaan, gingen we op voor het genereren van eencellige klonen door verdunning beplating te beperken. In onze handen volstond plating 5 tot 10 96-wells-platen per targeting construct om genoeg klonen voor een succesvolle scherm. In het protocol (punt 3.2), wordt beschreven hoe u kunt uitvoeren van een screening van eencellige klonen in gedupliceerde 96-wells. In dit verband moeten alleen positieve klonen worden uitgebreid, dat bespaart zowel tijd en moeite. In Figuur 3 c, voorbeeldgegevens van FACS-screening na PMA-Iono inductie en PCR screening worden weergegeven. We hebben vastgesteld een aantal klonen met hoge, lage en geen TL verslaggever genexpressie (Figuur 3 c). Voor PCR-screening is het belangrijk om op te nemen van een besturingselement PCR die een genomic locus van keuze om te bepalen versterkt of de kwaliteit van de cel lysates voldoende voor PCR. In ons geval hebben wij ervoor gekozen een 630 bp-reeks in de NUP188 gen locus voor controle PCR (voor primer sequenties, Zie tabel 5). Inleidingen voor PCR screening werden vervolgens ontworpen om een kortere reeks gelegen in de verslaggever te versterken. Bovendien, werd PCR voor een reeks op de backbone van de vector doel uitgevoerd om uit te sluiten van alle klonen die had unspecifically geïntegreerd doel vector ruggengraat sequenties (backbone PCR, gegevens niet worden weergegeven).

Vooraf geselecteerde klonen waren dan uitgebreid en verder geanalyseerd voor juiste targeting door Southern blot en PCR en sequencing. Zuidelijke vlek werd uitgevoerd met behulp van een verslaggever-specifieke sonde en een specifieke sonde voor de binding van de genomic locus buiten de verslaggever maar niet in de armen van de homologie van de targeting vector. Interessant, alle klonen die zijn getest door Southern blot waren positief in het vooraf screenen van PCR, maar slechts een gedeelte toonde juiste band maten in zuidelijke vlekkenanalyse en had de verslaggever (figuur 4b) heterozygously geïntegreerd. Het is daarom noodzakelijk om niet alleen vertrouwen op de screening van de PCR-resultaten maar ook controleren of de juiste targeting door Southern blotting. Om te controleren of de juiste targeting op de DNA sequentie niveau, integratie kruispunten werden versterkt door PCR en producten werden onderworpen aan Sanger sequencing (figuur 4a). Met name bleek sequentiebepaling van het doel website homologe allel, waar had de verslaggever niet geïntegreerd, Cas9-gemedieerde wijzigingen. In figuur 4a, voorbeelden voor een Cas9-gemedieerde verwijdering wordt weergegeven. Om te testen voor Cas9-gemedieerde af-target effecten, werd een lijst van de af-target hoogste gerangschikte sites gegenereerd, zoals beschreven in paragraaf 3.5. Tien hoogste gerangschikte af-target sites werden PCR-versterkte van genomic DNA van het klonen, en de producten onderworpen aan Sanger sequencing. In de gerichte eencellige klonen die we genereerden, werden geen variaties van Jurkat wild-type sequenties waargenomen op de tien hoogste gerangschikte sites uit doelsoort zijn.

Figure 3
Figuur 3: Screening van eencellige klonen voor targeting gebeurtenissen. (een) schema van primer ontwerp voor detectie van gerichte evenementen door PCR in gemengde gerichte celpopulatie. Primerparen voor detectie van 5' integratie junction (P1, P2) en 3' integratie junction (P3, P4) worden aangeduid als pijlen. Primer P1 en P4 ook dienen te versterken gerichte locus van het allel zonder verslaggever integrant (b) Genomic DNA van gemengde gerichte celpopulatie werd 10 dagen na FACS verrijking van transfected cellen voorbereid en geanalyseerd voor 5' integratie junction (P1, P2 ), 3' integratie junction (P3, P4; gegevens niet worden weergegeven) en wild-type allel van de gerichte locus (P1, P4). Wild-type Jurkat cellen (wt) diende als controle. (c) het eerste scherm van eencellige klonen in 96-wells-platen. 96-wells-platen met eencellige klonen waren gescreend voor juiste targeting door stroom cytometry na PMA-Iono inductie en PCR analyse. Resultaten bijvoorbeeld klonen worden weergegeven. PCR is uitgevoerd op cel lysates met verslaggever-specifieke primers (screening PCR; P5, P6) en grondlagen sturen een genomic locus (controle van PCR, hier: NUP188 locus; P7, P8). Cel lysates met wild-type Jurkat cellen (wt) en genomic DNA van HIVisB2 kloon (B2)18 bereid met verkrijgbare kit diende als een negatieve controle voor het screenen van PCR en positieve controle voor controle PCR, respectievelijk. Klik hier voor een grotere versie van dit cijfer.

Figure 4
Figuur 4: analyse van geselecteerde eencellige klonen voor juiste verslaggever integratie. (een) sequentieanalyse van integratie kruispunten en gerichte locus op het allel zonder verslaggever integrant. Primerparen voor detectie van 5' integratie junction (P1, P2), 3' integratie junction (P3, P4) en gerichte locus van allel zonder verslaggever integrant (P1, P4) werden gebruikt. PCR producten werden versterkt van genomic DNA van eencellige klonen en onderworpen aan Sanger sequencing. Sequencing resultaten waren afgestemd op de verwachte sequenties. Getoond worden voorbeeldgegevens van één kloon. Reeks chromatogrammen van genoom/HA junction en HA/verslaggever junction staan voor zowel 5' en 3' integratie junction. Wedstrijden worden aangeduid als stippen. Bindende site van gRNA is gemarkeerd met een doos. Cas9-geïnduceerde mutaties zijn rood gemarkeerd. Schematische voorstelling van de primer ontwerp is hieronder weergegeven. Pijlen geven aan primer posities gebruikt voor amplificatie. (b) zuidelijke vlekkenanalyse van geselecteerde gerichte eencellige klonen en Jurkat wild-type cellen. Zuidelijke vlekkenanalyse werd uitgevoerd op genomic DNA met een verslaggever-specifieke sonde en een sonde herkennen een genomic reeks in zowel gerichte en wild-type allel (genomic sonde). Gegevens van 7 voorbeeld klonen wordt weergegeven. Klonen met de juiste band maten zijn gemarkeerd met vakken. Verdunde doel vector plasmide diende als positieve controle (+). Schema voor zuidelijke vlekkenanalyse is hieronder weergegeven. Klik hier voor een grotere versie van dit cijfer.

Reagens Per reactie toevoegen
Toekomen Primer (20 µM) 1 ΜL
Omgekeerde Primer (20 µM) 1 ΜL
10 x Taq buffer 5 ΜL
1 µL dNTPs (elke 2.5 mM) 1 ΜL
MgCl (50 mM) 1 ΜL
DMSO 1.5 ΜL
gDNA (50-100 ng/µL) 2 ΜL
Nuclease-gratis water Vul tot 49,5 µL
Polymerase van DNA Taq (5 U/mL) 0,5 ΜL
volume van de reactie 50 ΜL

Tabel 1: recept voor PCR een polymerase met activiteit proeflezen. Het bedrag van elk reagens worden toegevoegd per PCR reactie wordt aangegeven. PCR is bedoeld voor amplificatie genomic DNA als sjabloon gebruiken. Het recept is gebruikt in stap 1.2.2.2 (versterking van homologie wapens), stap 3.3.3 (verificatie van integratie sites), stap 3.4.1.5 (generatie van genomic sonde voor zuidelijke vlek) en stap 3.5.4 (analyse van off-target evenementen).

Stappen Temperatuur Tijd Cycli
Eerste denaturatie 95 ° C 2 min 1
Denaturatie 95 ° C 40 s 30-35
Gloeien 58 ° C 45 s
Uitbreiding 72 ° C 1 min/kb
Final Extension 72 ° C 10 min 1

Tabel 2: fietsen voorwaarden voor PCR een polymerase met activiteit proeflezen. Fietsen voorwaarden overeen met PCR recept vermeld in tabel 1.

Reagens Per reactie toevoegen
Toekomen Primer (20 µM) 1 ΜL
Omgekeerde Primer (20 µM) 1 ΜL
5 x HiFi-buffer 5 ΜL
1 µL dNTPs (elke 2.5 mM) 1 ΜL
gDNA (50-100 ng/µL) of plasmide DNA (50 ng/µL) 2 µL gDNA of
1 µL plasmide DNA
Nuclease-gratis water Vul tot 49,5 µL
High-Fidelity DNA-polymerase 0,5 ΜL
volume van de reactie 50 ΜL

Tabel 3: recept voor PCR met behulp van een hifi-polymerase. Het bedrag van elk reagens worden toegevoegd per PCR reactie wordt aangegeven. PCR is bedoeld voor robuuste versterking van DNA sjablonen. Het recept is gebruikt in stap 2.4.2 (detectie van targeting evenementen) en 3.4.1.4 (generatie van verslaggever-specifieke sonde voor zuidelijke vlek).

Stappen Temperatuur Tijd Cycli
Eerste denaturatie 98 ° C 30 s 1
Denaturatie 98 ° C 10 s 30 - 35
Gloeien 58 ° C 30 s
Uitbreiding 72 ° C 30 s/kb
Final Extension 72 ° C 10 min 1

Tabel 4: fietsen voorwaarden voor PCR met behulp van een hifi-polymerase. Fietsen voorwaarden overeen met PCR recept vermeld in tabel 3.

Primer Volgorde (5'-3')
P7 controle PCR F CTTTGTTGGGTAAGCATGGAGGTC
P8 controle PCR R CAGTTACTCACCTTTGCACATAGG

Tabel 5: Oligonucleotide sequenties voor controle PCR. Voorwaartse en omgekeerde inleidingen voor de versterking van een 630 bp fragment van het NUP188 locus worden aangegeven.

Reagens Per reactie toevoegen
kant-en-klare PCR Master Mix 8 ΜL
Toekomen Primer (20 µM) 1 ΜL
Omgekeerde Primer (20 µM) 1 ΜL
Nuclease-gratis water 8 µl
cel lysate (1:12 verdunning) 2 ΜL
volume van de totale reactie 20 ΜL

Tabel 6: recept voor screening-PCR. Het bedrag van elk reagens worden toegevoegd per PCR reactie wordt aangegeven. PCR recept is bedoeld voor het screenen van PCR in stap 3.2.11.

Stappen Temperatuur Tijd Cycli
Pre-PCR Denaturatie 94 ° C 2 min 1
Gloeien 58 ° C 1 min
Uitbreiding 72 ° C 1 min
Denaturatie 94 ° C 30 s 38
Gloeien 58 ° C 30 s
Uitbreiding 72 ° C 1 min
Final Extension 72 ° C 10 min 1

Tabel 7: fietsen voorwaarden voor screening-PCR. Fietsen voorwaarden overeen met PCR recept vermeld tabel 6.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Hier beschrijven we een protocol voor het genereren van HIV-1-afgeleide Jurkat verslaggever modellen met gekozen proviraal integratie sites CRISPR-Cas9-gebaseerde genoom engineering toe te passen.

Verschillende punten van het protocol vereist zorgvuldige aandacht tijdens de planningsfase. Ten eerste de locus worden gericht moet worden zorgvuldig gekozen, zoals sommige loci gemakkelijker te richten dan anderen wellicht (bijvoorbeeld, afhankelijk van de status van de chromatine van de regio en de doelstelling van sequentie zelf). Repetitieve sequenties zijn moeilijk te klonen in de targeting vector en zijn vaak niet uniek zijn binnen het genoom. Regio's van de repressieve chromatine zijn moeilijker te richten met de CRISPR-Cas9 systeem19,20.

Ten tweede, de keuze van gRNA is cruciaal voor CRISPR-Cas9-gemedieerde targeting. Met het oog op het genereren van modellen voor HIV-infectie met representatieve integratie sites, wil men de gRNA zo dicht mogelijk bij een hotspot integratie binden. Echter, deze site niet zou ideaal zijn voor het aanwerven van de Cas9; Daarom moet een compromis worden gemaakt tussen de nabijheid van de volgorde van de gRNA op de site van de integratie van keuze en gRNA kwaliteit. We hebben de E-CRISP webtool betrouwbaar zijn in het voorspellen van functionele gRNAs gevonden. Het is ook mogelijk om uit te voeren een gRNA pre-test Transient uitspreken verschillende gRNAs samen met Cas9 in het celtype te worden gericht, gevolgd door een screening voor mutaties. Een geschikt gRNA zal Cas9 efficiënt rechtstreeks naar de doelsite en de gRNA aanvullende site toont mutaties. De lengte van de HAs (1.000 bp bedrijven stroomopwaarts en stroomafwaarts van de integratie-site) werd gekozen op basis van eerder gepubliceerde studies11. In het algemeen, vermindering van de lengte van de homologie wapens zal leiden tot verlaagde targeting frequentie. Een lengte van 1.000 bp voor homologie arm presenteert een goed compromis tussen voldoende gericht op frequentie en gebruiksgemak doel vector bouw.

Ten derde moet voldoende tijd worden besteed aan een goed ontwerp voor de verslaggever construct. De minimale verslaggever gebruikt in dit protocol, waarin een HIV-1 NL4-3 LTR en een tdTomato reeks codering afgeleid, werd ontworpen op basis van het volgende principe: één liter zijn beschreven als uitsluitend resterende proviraal fragmenten in verschillende gevallen van klonen expansie in chronisch HIV-1-geïnfecteerde individuen21. Verwacht wordt dat de LTR sterk invloeden de chromatine-status op integratie sites is en de aanwerving van cellulaire complexen organiseert. We hebben gekozen voor een minimale HIV verslaggever zich te concentreren op de HIV LTR als voornaamste regelgevende genetische element, dan tdTomato geïntroduceerd als een TL LTR activiteit marker in plaats van verdere HIV-1 genen, zoals genoom engineering frequentie werd gemeld dat hoger met kleinere gericht op voegt11. Gezien de tijdrovende stappen van tv klonen, kloonselectie, screening en verificatie van de klonen, wordt aangeraden om zorgvuldig overwegen het ontwerp van de HIV-verslaggever in het kader van functionele studies die uiteindelijk zal worden uitgevoerd op gerichte cellijnen. Een, bijvoorbeeld, overwegen de opneming van gag leider volgorde, 3' HIV LTR, en/of andere virale gensequenties in de verslaggever. Het protocol kan gemakkelijk aangepast worden aan dergelijke constructies verschillende verslaggever.

In het algemeen, is het belangrijk dat de keuze van celtype als eencellige kloon generatie moeilijk met bepaalde cellijnen kunnen worden gericht. We vonden dat de Jurkat cellen niet zeer efficiënt in één kloon generatie zijn; echter besloten we om te kiezen deze celtype voor het gebruik ervan eerder bekend in latente HIV infectie modellen9. We behaalde de beste resultaten in Jurkat klonen verdunning beplating met 50% geconditioneerde medium, wanneer platen bleven ongestoord in een incubator dat niet meer dan 3 keer per week is geopend. Desgewenst met behulp van een andere cel-lijn is, is het aangeraden om vooraf testen de mogelijkheid van het genereren van eencellige klonen door het uitvoeren van een verdunning plating experiment. Een ander punt in gedachten te houden is de variatie van de transfectie tarieven van verschillende cellijnen. Als transfectie niet haalbaar voor de gekozen cellijn is, electroporating de cellen voor targeting kunnen nodig zijn. Opmerking dat de keuze van cellijn gebruikt voor targeting niet kan worden bepaald door technische aspecten alleen, zoals efficiëntie voor Transfectie of één kloon generatie. Functionele aspecten kunnen ook worden overwogen, zoals transcriptionele activiteit of inducibility van de gerichte gene locus. Hiervoor kan de screening van verschillende cellijnen vóór de targeting workflow.

Benadrukt moet worden dat het beschreven protocol tijdrovende is. Het mag worden verwacht dat 3 tot 6 maanden duren vanaf de eerste stap om te laatste klonale cellijnen. De zuidelijke vlekkenanalyse, die wordt gebruikt om te controleren voor specifieke interne integratie evenementen, lijkt misschien omslachtig, maar onze ervaring is zeer belangrijk - als slechts een subset van eencellige klonen die de verwachte integratie toonde kruispunten per PCR toonde een patronen in de zuidelijke vlek te corrigeren. In het ideale geval onderzoekers moeten genereren een aantal klonen met de dezelfde invoegen gericht op dezelfde integratie website controle voor klonen effecten in een latere experimenten die maken gebruik van de klonen. Het is mogelijk te doen heterozygoot evenals homozygoot targeting. Het allel zonder een integrant is heterozygoot verslaggever cellijnen, waarschijnlijk om te laten zien van de wijzigingen op de Cas9 gericht site, die kan worden gescreend door PCR (figuur 4a). Homozygoot targeting, wij stellen voor dat beide allelen opeenvolgend worden gericht.

Rekening houdend met deze overwegingen, biedt deze workflow een manier voor het genereren van krachtige cellulaire modellen die kunnen worden gebruikt om het begrip van chronische HIV-infectie. Bijvoorbeeld, kan proviraal activiteit in reactie op latency-omdraaiende agenten worden getest in het kader van recurrente integratie sites. Dit kan worden van bijzonder belang aan onderzoekers in het veld omdat positie effecten hebben is gepostuleerd om de impact van HIV latentie en omkering22.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Wij danken Britta Weseloh en Bettina Abel voor technische bijstand. Wij danken ook Arne Düsedau en Jana Hennesen (stroom cytometry technologieplatform, Heinrich-Pette Institut) voor technische ondersteuning.

Materials

Name Company Catalog Number Comments
pX330-U6-Chimeric_BB-cBh-hSpCas9 Addgene 42230 vector for expression of SpCas9 and gRNA
pMK GeneArt mammalian expression vector for cloning
cDNA3.1 Invitrogen V79020 mammalian expression vector for cloning
BbsI New England Biolabs R0539S restriction enzyme
NEBuilder Hifi DNA Assembly Cloning Kit New England Biolabs E5520S Assembly cloning kit used for target vector generation
TaqPlus Precision PCR System Agilent Technologies 600210 DNA polymerase with proofreading activity used for amplification of homology arms (step 1.2.2.2), verification of integration site and reporter sequence (step 3.3.3 and 3.3.5), generation of genomic probe for Southern blot (step 3.4.1.5) and analysis of off-target events (step 3.5.4)
96-well tissue culture plate (round-bottom) TPP 92097 tissue culture plates for dilution plating
Phusion High-Fidelity DNA polymerase New England Biolabs M0530 L DNA polymerase used for detection of targeting events (step 2.4.2) and generation ofreporter-specific probe for Southern blot (step 3.4.1.4)
Dimethyl sulfoxide (DMSO) Sigma-Aldrich D9170 dimethyl sulfoxide as PCR additive
Magnesium Chloride (MgCl2) Solution New England Biolabs B9021S MgCl2 solution as PCR additive
Deoxynucleotide (dNTP) Solution Mix New England Biolabs N0447S dNTP mixture with 10 mM of each nt for PCR reactions
5PRIME HotMasterMix 5PRIME 2200400 ready-to-use PCR mix used for screening PCR (step 3.2.11)
QIAamp DNA blood mini kit Qiagen 51106 DNA isolation and purification kit
QIAquick PCR Purification Kit Qiagen 28106 PCR Purification Kit
RPMI 1640 without glutamine Lonza BE12-167F cell culture medium
Fetal Bovine Serum South Africa Charge PAN Biotech P123002 cell culture medium supplement
L-glutamine Biochrom K 0282 cell culture medium supplement
Penicillin/Streptomycin 10.000 U/mL/ 10.000 µg/mL Biochrom A 2212 cell culture medium supplement
Gibco Opti-MEM Reduced Serum Media Thermo Fisher Scientific 31985062 cell culture medium with reduced serum concentration optimized for transfection
TransIT-Jurkat Mirus Bio MIR2125 transfection reagent
phorbol 12-myristate 13-acetate Sigma-Aldrich P8139-1MG cell culture reagent
Ionomycin Sigma-Aldrich I0634-1MG cell culture reagent
Syringe-driven filter unit, PES membrane, 0,22 µm Millex SLGP033RB filter unit for sterile filtration
Heracell 150i incubator Thermo Fisher Scientific 51026280 tissue culture incubator
Amershan Hybond-N+ GE Healthcare RPN1520B positively charged nylon membrane for DNA and RNA blotting
Stratalinker 1800 Stratagene 400072 UV crosslinker
High Prime Roche 11585592001 kit for labeling of DNA with radioactive dCTP using random oligonucleotides as primers
illustra ProbeQuant G-50 Micro Columns GE Healthcare 28-9034-08 chromatography spin-columns for purification of labeled DNA

DOWNLOAD MATERIALS LIST

References

  1. Hughes, S. H., Coffin, J. M. What Integration Sites Tell Us about HIV Persistence. Cell Host and Microbe. 19, (5), 588-598 (2016).
  2. Marini, B., Kertesz-Farkas, A., et al. Nuclear architecture dictates HIV-1 integration site selection. Nature. 521, (7551), 227-231 (2015).
  3. Cesana, D., Santoni de Sio, F. R., et al. HIV-1-mediated insertional activation of STAT5B and BACH2 trigger viral reservoir in T regulatory cells. Nature Communications. 8, (1), 498 (2017).
  4. Cohn, L. B., Silva, I. T., et al. HIV-1 Integration Landscape during Latent and Active Infection. Cell. 160, (3), 420-432 (2015).
  5. Han, Y., Lassen, K., et al. Resting CD4+ T cells from human immunodeficiency virus type 1 (HIV-1)-infected individuals carry integrated HIV-1 genomes within actively transcribed host genes. Journal of Virology. 78, (12), 6122-6133 (2004).
  6. Ikeda, T., Shibata, J., Yoshimura, K., Koito, A., Matsushita, S. Recurrent HIV-1 integration at the BACH2 locus in resting CD4+ T cell populations during effective highly active antiretroviral therapy. The Journal of Infectious Diseases. 195, (5), 716-725 (2007).
  7. Wagner, T. A., Mclaughlin, S., et al. Proliferation of cells with HIV integrated into cancer genes contributes to persistent infection. Science. 345, (6196), 570-573 (2014).
  8. Maldarelli, F., Wu, X., et al. Specific HIV integration sites are linked to clonal expansion and persistence of infected cells. Science. 345, (6193), 179-183 (2014).
  9. Jordan, A., Bisgrove, D., Verdin, E. HIV reproducibly establishes a latent infection after acute infection of T cells in vitro. The EMBO Journal. 22, (8), 1868-1877 (2003).
  10. Mack, K. D., Jin, X., et al. HIV insertions within and proximal to host cell genes are a common finding in tissues containing high levels of HIV DNA and macrophage-associated p24 antigen expression. Journal of Acquired Immune Deficiency Syndromes. 33, (3), 308-320 (2003).
  11. Byrne, S. M., Ortiz, L., Mali, P., Aach, J., Church, G. M. Multi-kilobase homozygous targeted gene replacement in human induced pluripotent stem cells. Nucleic Acids Research. 43, (3), 1-12 (2014).
  12. ZhangLab. CRISPR Genome Engineering Toolbox: Target Sequence Cloning Protocol. Addgene website. Available from: https://www.addgene.org/static/cms/filer_public/e6/5a/e65a9ef8-c8ac-4f88-98da-3b7d7960394c/zhang-lab-general-cloning-protocol.pdf (2013).
  13. Moser, F. Addgene. Gibson Assembly Protocol. Addgene website. Available from: https://www.addgene.org/protocols/gibson-assembly/ (2009).
  14. Addgene Plasmid Cloning by PCR. Addgene website. Available from: https://www.addgene.org/protocols/pcr-cloning/ (2014).
  15. Addgene Plasmid Cloning by Restriction Enzyme Digest (aka Subcloning). Addgene website. Available from: https://www.addgene.org/protocols/subcloning/ (2013).
  16. Stemmer, M., Thumberger, T., Del Sol Keyer, M., Wittbrodt, J., Mateo, J. L. CCTop: An intuitive, flexible and reliable CRISPR-Cas9 target prediction tool. Public Library of Science (PLoS) ONE. 10, (4), (2015).
  17. Lange, U. C., Bialek, J. K., Walther, T., Hauber, J. Pinpointing recurrent proviral integration sites in new models for latent HIV-1 infection. Virus Research. 249, (2018).
  18. Bialek, J. K., Dunay, G. A., et al. Targeted HIV-1 Latency Reversal Using CRISPR-Cas9-Derived Transcriptional Activator Systems. PloS ONE. 11, (6), e0158294 (2016).
  19. Lee, C. M., Davis, T. H., Bao, G. Examination of CRISPR-Cas9 design tools and the effect of target site accessibility on Cas9 activity. Experimental Physiology. 103, (4), 456-460 (2018).
  20. Jensen, K. T., Fløe, L., et al. Chromatin accessibility and guide sequence secondary structure affect CRISPR-Cas9 gene editing efficiency. FEBS Letters. 591, (13), 1892-1901 (2017).
  21. Simonetti, F. R., Sobolewski, M. D., et al. Clonally expanded CD4 + T cells can produce infectious HIV-1 in vivo. Proceedings of the National Academy of Sciences. 113, (7), 1883-1888 (2016).
  22. Chen, H. C., Martinez, J. P., Zorita, E., Meyerhans, A., Filion, G. J. Position effects influence HIV latency reversal. Nature Structural and Molecular Biology. 24, (1), 47-54 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics