गर्भनाल रक्त से 3 डी त्वचा Organoid का उत्पादन-व्युत्पन्न प्रेरित Pluripotent स्टेम सेल

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

हम एक प्रोटोकॉल है कि पता चलता है कि कैसे प्रेरित pluripotent स्टेम सेल के अंतर को keratinocytes और fibroblasts और एक 3 डी त्वचा organoid उत्पंन, इन keratinocytes और फाइब्रोब्लास्ट का उपयोग करने का प्रस्ताव है । इस प्रोटोकॉल एक humanized चूहों मॉडल पैदा करने का एक अतिरिक्त कदम शामिल हैं । तकनीक यहां प्रस्तुत dermatologic अनुसंधान में सुधार होगा ।

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Kim, Y., Ju, J. H. Generation of 3D Skin Organoid from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (146), e59297, doi:10.3791/59297 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

त्वचा शरीर के सबसे बड़े अंग है और कई कार्य किया है । त्वचा शारीरिक अवरोध और शरीर के रक्षक के रूप में कार्य करती है तथा शारीरिक क्रियाओं को नियंत्रित रखती है । जटिल मानव समस्याओं को हल करने के उद्देश्य से प्रकृति के मॉडलों, प्रणालियों और तत्वों की नकल बायोमिमेटिक्स है । त्वचा बायोमिमेटिक्स में इन विट्रो रोग अनुसंधान के लिए और vivo पुनर्योजी चिकित्सा में एक उपयोगी उपकरण है । मानव प्रेरित pluripotent स्टेम सेल (iPSCs) असीमित प्रसार और तीन रोगाणु परतों के लिए भेदभाव की क्षमता की विशेषता है । मानव iPSCs विभिन्न प्राथमिक कोशिकाओं से उत्पन्न होते हैं, जैसे रक्त कोशिकाओं, keratinocytes, फाइब्रोब्लास्ट, और अधिक. उनमें से, गर्भनाल रक्त mononuclear कोशिकाओं (CBMCs) allogeneic पुनर्योजी चिकित्सा के नजरिए से एक वैकल्पिक कोशिका स्रोत के रूप में उभरा है । Cbmcs पुनर्योजी चिकित्सा में उपयोगी है क्योंकि मानव ल्युकोसैट प्रतिजन (एचएलए) टाइपिंग सेल बैंकिंग प्रणाली के लिए आवश्यक है । हम केराटिनोसाइट्स और फाइब्रोब्लास्ट में सीबीएमसी-आईपीएससी के विभेदन के लिए और 3 डी त्वचा आर्गेनॉइड के उत्पादन के लिए एक विधि प्रदान करते हैं । CBMC-iPSC-व्युत्पंन keratinocytes और फाइब्रोब्लास्ट एक प्राथमिक कोशिका रेखा के समान लक्षण है । 3d त्वचा ऑर्गेनॉइड एक त्वचीय परत पर एक एपिडर्मल परत overlaying द्वारा उत्पंन कर रहे हैं । इस 3D त्वचा organoid प्रत्यारोपण द्वारा, एक humanized चूहों मॉडल उत्पंन होता है । इस अध्ययन से पता चलता है कि एक 3 डी मानव ipsc-व्युत्पंन त्वचा अंगाभ एक उपंयास, विट्रो में dermatologic अनुसंधान के लिए वैकल्पिक उपकरण और vivo में हो सकता है ।

Introduction

त्वचा शरीर की सबसे बाहरी सतह को कवर और आंतरिक अंगों की रक्षा करता है । त्वचा रोगजनकों के खिलाफ की रक्षा करने, अवशोषित और जल भंडारण, शरीर के तापमान को विनियमित करने, और शरीर अपशिष्ट2उत्सर्जन सहित विभिंन कार्य किया है । त्वचा grafts त्वचा स्रोत के आधार पर वर्गीकृत किया जा सकता है; एक और दाता से त्वचा का उपयोग कर grafts allografts कहा जाता है, और grafts रोगी की अपनी त्वचा का उपयोग कर रहे हैं autografts । हालांकि एक autograft पसंदीदा अपने कम अस्वीकृति जोखिम के कारण उपचार है, त्वचा बायोप्सी गंभीर घावों या त्वचा कोशिकाओं की एक अपर्याप्त संख्या के साथ रोगियों पर प्रदर्शन करने के लिए मुश्किल हैं । गंभीर रूप से जलने के साथ रोगियों में, तीन बार त्वचा कोशिकाओं की संख्या के लिए बड़े क्षेत्रों को कवर करने के लिए आवश्यक हैं । एक मरीज के शरीर से त्वचा कोशिकाओं की सीमित उपलब्धता के परिणामस्वरूप ऐसी स्थितियां उत्पन्न होती हैं, जहां एलोजन प्रत्यारोपण आवश्यक होता है । जब तक यह आम तौर पर लगभग 13सप्ताह के बाद मेजबान की प्रतिरक्षा प्रणाली द्वारा अस्वीकार कर दिया है ऑटोलॉगस प्रत्यारोपण किया जा सकता है एक allograft अस्थाई रूप से प्रयोग किया जाता है । रोगी की प्रतिरक्षा प्रणाली द्वारा अस्वीकृति पर काबू पाने के लिए, grafts रोगी4के रूप में एक ही प्रतिरक्षा पहचान के साथ एक स्रोत से आना चाहिए ।

मानव iPSCs स्टेम सेल थेरेपी के लिए कोशिकाओं का एक उभरता स्रोत है5। मानव iPSCs दैहिक कोशिकाओं से उत्पन्न कर रहे हैं, OCT4, SOX2, Klf4, और सी-Myc6जैसे कारकों reprogramming का उपयोग कर. मानव ipscs का उपयोग करके भ्रूण स्टेम कोशिकाओं (escs)7,8के नैतिक और प्रतिरक्षा मुद्दों पर काबू । मानव iPSCs की pluripotency है और तीन रोगाणु परतों में अंतर कर सकते हैं9. एचएलए, पुनर्योजी चिकित्सा में एक महत्वपूर्ण कारक की उपस्थिति, प्रतिरक्षा प्रतिक्रिया और10अस्वीकृति की संभावना निर्धारित करता है । रोगी से प्राप्त iPSCs का उपयोग सेल की समस्याओं का समाधान-स्रोत सीमा और प्रतिरक्षा प्रणाली अस्वीकृति । CBMCs भी पुनर्योजी चिकित्सा11के लिए एक वैकल्पिक सेल स्रोत के रूप में उभरा है । अनिवार्य एचएलए टाइपिंग, जो CBMC बैंकिंग के दौरान होता है, आसानी से अनुसंधान और प्रत्यारोपण के लिए इस्तेमाल किया जा सकता है । इसके अलावा, समयुग्मजी हला-प्रकार ipscs व्यापक रूप से विभिंन रोगियों के लिए लागू कर सकते है12। एक सीबीएमसी-ipsc बैंक सेल थेरेपी और एलोजेनिक पुनर्योजी चिकित्सा के लिए एक उपंयास और कुशल रणनीति12,13,14है । इस अध्ययन में, हम CBMC-iPSCs का उपयोग करें, keratinocytes और fibroblasts में विभेदित, और स्तरित 3 डी त्वचा परतों उत्पन्न. इस अध्ययन के परिणामों से पता चलता है कि सीबीएमसी-ipsc-व्युत्पन्न 3d त्वचा अंगाभ में इन विट्रो के लिए एक उपंयास उपकरण है और vivo में dermatologic अनुसंधान ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

पशुओं को शामिल करने वाली सभी प्रक्रियाएं प्रयोगशाला पशु कल्याण अधिनियम, प्रयोगशाला पशुओं की देखभाल और उपयोग के लिए मार्गदर्शक, और संस्थागत पशु देखभाल द्वारा प्रदान किए गए कृंतक प्रयोगों के लिए दिशा-निर्देशों और नीतियों के अनुसार निष्पादित की गई थीं और कोरिया के कैथोलिक विश्वविद्यालय के स्कूल ऑफ मेडिसिन के उपयोग समिति (IACUC) । अध्ययन प्रोटोकॉल को कोरिया के कैथोलिक विश्वविद्यालय के संस्थागत समीक्षा बोर्ड (CUMC-2018-0191-01) द्वारा अनुमोदित किया गया था । IACUC और प्रयोगशाला पशुओं के विभाग (डोला) कोरिया के कैथोलिक विश्वविद्यालय के, Songeui परिसर कोरिया खाद्य और औषधि प्रशासन के २०१७ में कोरियाई उत्कृष्टता पशु प्रयोगशाला सुविधा और मूल्यांकन के लिए अधिग्रहीत एसोसिएशन मांयता प्राप्त है और प्रयोगशाला एनिमल केयर इंटरनेशनल (AAALAC) के प्रत्यायन २०१८ में अंतर्राष्ट्रीय पूर्ण प्रत्यायन ।

1. प्रेरित pluripotent स्टेम सेल से त्वचा कोशिका विभेदन

  1. मध्यम तैयारी
    नोट: 3 महीने तक के लिए एक अंधेरे वातावरण में 4 डिग्री सेल्सियस पर सभी मध्यम स्टोर । बंध्याकरण के लिए उपयोग करने से पहले एक ०.२२ μm पॉलीथर्सल्फवन फिल्टर सिस्टम का उपयोग करके सभी माध्यम को फ़िल्टर करें । सभी मध्यम ५०० मिलीलीटर की कुल मात्रा में उपलब्ध था ।
    1. KDM1 (केराटिनोसाइट विभेदन मध्यम 1) तैयार करें । मिक्स Dulbecco के संशोधित ईगल मध्यम (DMEM)/f12 मध्यम (3:1) के साथ 2% भ्रूण गोजातीय सीरम (FBS), ०.३ mmol/L L-ascorbic एसिड, 5 μg/एमएल इंसुलिन, और 24 μg/एमएल adenine ।
    2. KDM2 (केराटिनोसाइट विभेदन मध्यम 2) तैयार करें । मिक्स परिभाषित keratinocyte सीरम मुक्त मध्यम ( सामग्री की तालिकादेखें) के साथ ०.३ mmol/l l-ascorbic एसिड, 5 μg/एमएल इंसुलिन, और 10 Μg/एमएल adenine ।
      नोट: निर्धारित keratinocyte सीरम मुक्त माध्यम के विकास और keratinocyte के विस्तार का समर्थन करने के लिए अनुकूलित है ।
    3. KDM3 (केराटिनोसाइट विभेदन मध्यम 3) तैयार करें । मिक्स परिभाषित keratinocyte सीरम मुक्त मध्यम और keratinocyte सीरम मुक्त माध्यम (1:1) विवरण के लिए सामग्री की तालिका देखें ।
      नोट: Keratinocyte सीरम-मुक्त मध्यम वृद्धि और keratinocyte के रखरखाव के लिए अनुकूलित है ।
    4. FDM1 तैयार (फाइकोब्लास्ट विभेदन मध्यम 1) । मिक्स DMEM/F12 मध्यम (3:1) 5% FBS, 5 μg/एमएल इंसुलिन, ०.१८ mM adenine, और 10 एनजी/एमएल एपिडर्मल विकास कारक (EGF) के साथ ।
    5. FDM2 तैयार (फाइकोब्लास्ट विभेदन मध्यम 2) । मिक्स dmem/F12 मध्यम (1:1) 5% fbs और 1% अनावश्यक अमीनो एसिड के साथ ।
    6. EP1 तैयार करें (उपकला माध्यम 1) । मिक्स DMEM/F12 (3:1) 4 मिमी एल ग्लूटामीन, ४० μM adenine, 10 μg/एमएल transferrin, 10 μg/एमएल इंसुलिन, और ०.१% FBS के साथ ।
    7. EP2 तैयार करें (उपकला माध्यम 2) । मिक्स EP1 और १.८ मिमी कैल्शियम क्लोराइड ।
    8. EP3 तैयार करें (उपकला माध्यम 3, कॉर्निफिकेशन मीडियम) । 4 मिमी एल-ग्लूटेमीन, ४० μM adenine, 10 μg/एमएल transferrin, 10 μg/एमएल इंसुलिन, 2% FBS, और १.८ mM कैल्शियम क्लोराइड के साथ F12 मध्यम मिक्स ।
  2. भ्रूणीय पिंड जनन
    1. पिछले अध् ययन12में दर्शाए गए प्रोटोकॉल का प्रयोग करते हुए सीबीएमसी-आईपीएससी जनरेट करें ।
    2. कोट संस्कृति व्यंजन, vitronectin का उपयोग कर । 5 मिलीलीटर कोट करने के लिए एक १०० mm पकवान तैयार ।
      1. पिघलना और ५० μL ०.५ मिलीग्राम/एमएल vitronectin (अंतिम एकाग्रता: 5 μg/mL) के साथ 5 मिलीलीटर बाँझ फॉस्फेट-buffered खारा (PBS) के साथ पुन: निलंबित । व्यंजन के लिए समाधान जोड़ें और कमरे के तापमान (आरटी) के लिए 1 h. use से पहले कोटिंग सामग्री (बाहर शुष्क करने के लिए नहीं) महाप्राण के लिए सेबेट ।
    3. Vitronectin-लेपित १०० mm प्लेट करने के लिए CBMC व्युत्पन्न iPSCs को बनाए रखने और Ipscs माध्यम (E8) दैनिक 10% CO2के साथ ३७ डिग्री सेल्सियस पर बदल जाते हैं ।
    4. पिछले अध्ययन15 में दिखाए गए प्रोटोकॉल का उपयोग कर भ्रूणीय निकायों (ebs) उत्पन्न करें (संक्षेप में इस प्रकार वर्णित). जब तक कक्षों ८०% संगम तक पहुँच चुके हैं, तो मध्यम बदलकर iPSCs का विस्तार करें । ८०% संगम पर, माध्यम निकालें और PBS के साथ धोने ।
    5. कोशिकाओं को 1 मि. मी. एथीलेन्डिऐमीनेटेटिक अम्ल (EDTA) के साथ उपचार करें । 2 मिनट के लिए 5% CO2 के साथ ३७ ° c पर इनक्यूबेट और फसल E8 माध्यम के 3 मिलीलीटर का उपयोग कर कोशिकाओं । 2 मिनट के लिए २५० x g पर कोशिकाओं को अपकेंद्रित्र ।
    6. Supernatant और E8 माध्यम से 5 मिलीलीटर की कोशिकाओं को लागू महाप्राण । एक hemocytometer का उपयोग कर कोशिकाओं गिनती और 1 x 106 कोशिकाओं को स्थानांतरित करने के लिए एक नई 15 मिलीलीटर शंक्वाकार ट्यूब । 2 मिनट के लिए २५० x g पर कोशिकाओं को अपकेंद्रित्र ।
    7. 10 μm rho-एसोसिएटेड काइनेज (रॉक) अवरोध करनेवाला के साथ EB गठन माध्यम के २.५ मिलीलीटर के साथ स्थानांतरित कोशिकाओं को फिर से निलंबित । एक noncoated संस्कृति प्लेट ढक्कन पर एक 10-100 μl मल्टीचैनल पिपेट का उपयोग कर 1 x 104 कोशिकाओं (25 μl/ड्रॉप) ड्रॉप । 1 x 106 कोशिकाओं से फार्म १०० ebs (1 x 104 कोशिकाओं/ डिश पर बारी और ढक्कन करने के लिए छोटी बूंद पर लटका ।
      नोट: रखरखाव और भेदभाव की प्रक्रिया में लगाव कदम के दौरान रॉक अवरोध करनेवाला की जरूरत है । केवल EB एकत्रीकरण चरण में रॉक निरोधक जोड़ें ।
    8. 1 दिन के लिए 5% CO2 के साथ ३७ ° c पर बूंदों सेते ।
    9. अगले दिन, १०० EBs फसल और विभेदन के लिए उंहें इस्तेमाल करते हैं । IPSC मध्यम (E8 मध्यम) या PBS के साथ थाली के ढक्कन बाहर धोने और एक ५० मिलीलीटर शंक्वाकार ट्यूब के लिए इसकी सामग्री फसल । 1 मिनट के लिए आर टी में उंहें व्यवस्थित करने के लिए EBs बनाए रखें । Supernatant महाप्राण, E8 माध्यम से EBs निलंबित, और उंहें एक ९० मिमी पेट्री पकवान में भेदभाव तक बनाए रखने के ।
  3. केरटिनोसाइट्स में सीबीएमसी-आईपीएससी का विभेदन
    नोट: सीएमसी-आईपीएससी से केराटिनोसाइट विभेदन की एक योजना के लिए, चित्रा 1देखें ।
    1. फसल १०० EBs एक ५० मिलीलीटर शंकु ट्यूब iPSC माध्यम या PBS के साथ । 1 मिनट के लिए आर टी में बनाए रखने के नीचे EBs बसने । सुनिश्चित करें कि वे शंक्वाकार नली के तल पर बसा हुआ है । Supernatant और 1 एनजी के साथ E8 माध्यम के साथ EBs resuspend और 1ng/ EBs एक ९० mm पेट्री डिश के लिए स्थानांतरण और उंहें ३७ डिग्री सेल्सियस पर 5% 1 दिन के लिए2 सह के साथ बनाए रखने ।
    2. कोट संस्कृति व्यंजन, प्रकार चतुर्थ कोलेजन का उपयोग कर । प्रकार चतुर्थ कोलेजन के 5 मिलीलीटर कोट एक १०० mm पकवान तैयार ।
      1. पिघलना और ०.०५ एन एचसीएल के साथ प्रकार चतुर्थ कोलेजन समाधान (अंतिम एकाग्रता: ५० μg/mL) को निलंबित । व्यंजन के लिए समाधान जोड़ें और 1 के लिए आर टी पर सेबेट () का उपयोग करने से पहले कोटिंग सामग्री (बाहर सूखी नहीं) ।
        नोट: प्लेटों का उपयोग करने से पहले, किसी भी एसिड को दूर करने के लिए PBS के साथ 3x व्यंजन धोने ।
    3. फसल EBs (चरण 1.3.1) एक ५० मिलीलीटर शंक्वाकार ट्यूब के लिए और उंहें 1 मिनट के लिए आरटी में बनाए रखने के लिए उंहें नीचे बसा । सुनिश्चित करें कि वे शंक्वाकार ट्यूब के तल पर बसा, supernatant महाप्राण, और 10 μM रॉक अवरोध करनेवाला के साथ KDM1 के 6 मिलीलीटर में EBs resuspend । प्रकार चतुर्थ कोलेजन-लेपित १०० mm पकवान को EBs स्थानांतरण ।
      नोट: रॉक अवरोध करनेवाला केवल EB अनुलग्नक चरण में जोड़ें ।
    4. दिन के बीच 0 – 8, मध्यम हर दूसरे दिन के लिए 3 μm रेटिनॉइक एसिड (आरए) और 25 एनजी/एमएल प्रत्येक BMP4 और egf के साथ KDM1 करने के लिए बदल जाते हैं । 5% CO2के साथ ३७ ° c पर ebs बनाए रखें ।
    5. 9 दिनों के बीच 12, मध्यम हर दूसरे दिन बदलने के लिए 3 μM RA, 25 एनजी/एमएल BMP4, और 20 एनजी/एमएल EGF के साथ KDM2 करने के लिए ।
    6. 13 दिनों के बीच-30, मध्यम हर दूसरे दिन बदलने के लिए 10 एनजी/एमएल BMP4 और 20 एनजी/एमएल EGF के साथ KDM3 के लिए ।
  4. फाइब्रोब्लास्ट में सीबीएमसी-आईपीएससी का विभेदन
    नोट: CBMC-iPSCs से फाइकोब्लास्ट विभेदन की एक योजना के लिए, चित्रा 2देखें.
    1. कोट संस्कृति व्यंजन, तहखाने झिल्ली मैट्रिक्स का उपयोग कर । 5 मिलीलीटर कोट करने के लिए एक १०० mm पकवान तैयार ।
      1. Thaw के तहखाने झिल्ली मैट्रिक्स (अंतिम एकाग्रता: ६०० एनजी/एमएल) और यह DMEM/F12 माध्यम के साथ पतला । बर्तन के लिए समाधान जोड़ें और ३७ डिग्री सेल्सियस पर सेने के लिए 30 मिनट के लिए उपयोग करने से पहले कोटिंग सामग्री Aspirate (बाहर सूखी नहीं) ।
    2. फसल १०० EBs एक ५० मिलीलीटर शंक्वाकार ट्यूब के लिए iPSC माध्यम या PBS के साथ एक पिपेट का उपयोग कर । 1 मिनट के लिए आर टी में बनाए रखने के नीचे EBs बसने । सुनिश्चित करें कि वे शंक्वाकार नली के तल पर बसा हुआ है । सुपरनेटंट को हटा दें ।
    3. 10 μm रॉक निरोधक के साथ FDM1 के 6 मिलीलीटर में एक १,००० μl पिपेट का उपयोग कर ebs resuspend । EBs स्थानांतरण (मध्यम के साथ) एक तहखाने झिल्ली मैट्रिक्स-लेपित १०० mm पकवान और के साथ ३७ डिग्री सेल्सियस पर इनक्यूबेट 5% CO2। 3 दिनों के लिए हर दूसरे दिन FDM1 ताज़ा करें ।
      नोट: केवल ईब अनुलग्नक चरण में रॉक अवरोध करनेवाला जोड़ें ।
    4. 4 और 6 दिनों के बीच FDM1 करने के लिए ०.५ एनएम हड्डी संरचनाविकासी प्रोटीन 4 (BMP 4) जोड़ें ।
    5. 7 दिन में, मध्यम बदलने के लिए 1 सप्ताह के लिए हर दूसरे दिन FDM2 ।
    6. 14 दिन में, 1 मिमी EDTA के 1 मिलीलीटर जोड़ें और 5% 2 के लिए 2 सह के साथ ३७ ° c पर इंक्यूबेट । 2 मिनट के लिए २५० x g पर FDM2 और अपकेंद्रित्र के 3 मिलीलीटर के साथ कोशिकाओं फसल. supernatant निकालें और FDM1 के 5 मिलीलीटर में कोशिकाओं को फिर से निलंबित ।
    7. एक hemocytometer का उपयोग कर कोशिकाओं गिनती, FDM1 माध्यम से 2 x 106 कोशिकाओं को फिर से निलंबित, और noncoated पकवान के लिए कोशिकाओं को हस्तांतरण । 5% CO2 के साथ ३७ ° c पर कोशिकाओं को बनाए रखने और हर दूसरे दिन माध्यम बदल जाते हैं ।
    8. कोट संस्कृति व्यंजन, प्रकार मैं कोलेजन का उपयोग कर । 5 मिलीलीटर कोट करने के लिए एक १०० mm पकवान तैयार । तनु प्रकार मैं कोलेजन समाधान (अंतिम एकाग्रता: ५० μg/एमएल) ०.०२ N एसिटिक एसिड में । व्यंजन के लिए समाधान और 1 एच के लिए आरटी में सेबेट जोड़ें उपयोग करने से पहले कोटिंग सामग्री (बाहर सूखी नहीं) ।
      नोट: प्लेटों का उपयोग करने से पहले, PBS के साथ 3x व्यंजन धोने के लिए एसिड को दूर ।
    9. 21 दिन, 1 मिमी EDTA के 1 मिलीलीटर जोड़ें और 5% 2 के लिए 2 सह के साथ ३७ ° c पर इंक्यूबेट । 2 मिनट के लिए २५० x g पर FDM1 और अपकेंद्रित्र के 3 मिलीलीटर के साथ कोशिकाओं फसल । supernatant निकालें और FDM1 के 5 मिलीलीटर में कोशिकाओं को फिर से निलंबित । एक hemocytometer का उपयोग कर कोशिकाओं गिनती और स्थानांतरण 2 x 106 प्रकार मैं कोलेजन-लेपित १०० MM पकवान FDM1 माध्यम से कोशिकाओं । 5% CO2 के साथ ३७ ° c पर कोशिकाओं को बनाए रखने और हर दूसरे दिन माध्यम बदल जाते हैं ।
    10. 28 दिन, 1 मिमी EDTA के 1 मिलीलीटर जोड़ें और 5% 2 के लिए 2 सह के साथ ३७ ° c पर इंक्यूबेट । 2 मिनट के लिए २५० x g पर FDM1 और अपकेंद्रित्र के 3 मिलीलीटर के साथ कोशिकाओं फसल. supernatant निकालें और FDM1 के 5 मिलीलीटर में कोशिकाओं को फिर से निलंबित । एक hemocytometer का उपयोग कर कोशिकाओं गिनती और 2 एक्स 106 कोशिकाओं FDM1 माध्यम से एक noncoated पकवान के लिए स्थानांतरण । 5% CO2 के साथ ३७ ° c पर सेल बनाए रखें और हर दूसरे दिन माध्यम बदल जाते हैं ।
      नोट: iPSC-फाइब्रोब्लास्ट व्युत्पंन एक प्राथमिक fibroblasts सेल लाइन और 10 मार्ग तक पारित होने की तरह उत्पंन करना । इस अध्ययन में, हम iPSC का इस्तेमाल किया और आगे के विश्लेषण के लिए दो से पांच मार्ग के fibroblasts व्युत्पंन ।

2. hiPSC-व्युत्पन्न विभेदित कोशिकाओं के आवेदन

  1. 3d त्वचा अंगाभ के उत्पादन
    1. तटस्थ प्रकार मैं बर्फ पर कोलेजन, निर्माता की सिफारिशों के बाद तैयार करते हैं । अंतिम एकाग्रता के रूप में, उपयोग 3 मिलीग्राम/एमएल प्रकार मैं कोलेजन के लिए (स्टॉक एकाग्रता प्रकार मैं कोलेजन है ३.४७ मिलीग्राम/एमएल), और सुनिश्चित करें कि मिश्रण का अंतिम मात्रा 5 मिलीलीटर है । 10x PBS (अंतिम वॉल्यूम/10 = ०.५ मिलीलीटर) की मात्रा की गणना । प्रकार मैं कोलेजन की मात्रा की गणना करने के लिए इस्तेमाल किया जा (अंतिम खंड एक्स अंतिम कोलेजन एकाग्रता स्टॉक कोलेजन = 5 मिलीलीटर x 3 मिलीग्राम/एमएल/३.४७ मिलीग्राम/एमएल = ४.३२ मिलीलीटर) । 1 छ नव्भ् की आयतन की गणना कीजिए (कोलैजेन की मात्रा x ०.०२३ मिलीलीटर = ०.१ मिलीलीटर) । डीएच2ओ की मात्रा की गणना (अंतिम मात्रा-कोलैजेन की मात्रा 10X pbs की मात्रा-1 एन naoh की मात्रा = 5 मिलीलीटर-४.३२ मिलीलीटर-0.5 मिलीलीटर-०.१ मिलीलीटर = ०.०८ मिलीलीटर) । ट्यूब की सामग्री को मिक्स और उपयोग करने के लिए तैयार जब तक बर्फ पर रखने के लिए ।
    2. IPSC के लिए EDTA के 1 मिलीलीटर जोड़ें-चरण 1.4.10 से फाइब्रोब्लास्ट व्युत्पंन और 5% 2 के लिए 2 मिनट के साथ ३७ डिग्री सेल्सियस पर सेक्यूबेट । अलग कोशिकाओं को हार्वेस्ट, एक hemocytometer का उपयोग कोशिकाओं गिनती, और एक नए 15 मिलीलीटर शंक्वाकार ट्यूब के लिए 2 x 105 कोशिकाओं को स्थानांतरित । 2 मिनट के लिए २५० x g पर अपकेंद्रित्र और supernatant हटा दें । Ipsc-FDM1 के मिलीलीटर १.५ में फाइब्रोब्लास्ट व्युत्पंन और प्रकार मैं कोलेजन समाधान (1:1) neutralized की कोशिकाओं को फिर से निलंबित ।
      नोट: बुलबुले से बचने के लिए धीरे से घोल मिलाएं ।
    3. एक 6-अच्छी तरह microplate पर झिल्ली डालने प्लेस, डालने के लिए मिश्रण हस्तांतरण, और 30 मिनट के लिए आर टी पर सेबेट ।
      नोट: प्लेटें स्थानांतरित नहीं करते ।
    4. जेलेनेशन की पुष्टि होने के बाद इसमें 2 एमएल मीडियम को इंसर्ट के ऊपर और 3 एमएल को अच्छी तरह से बॉटम में डालें । 5-7 दिनों के लिए 5% CO2 के साथ ३७ ° c पर फाइब्रोब्लास्ट और कोलेजन के मैट्रिक्स सेबेट, जब तक जेलीकरण पूरा हो गया है और अब अनुबंध ।
    5. पूरा gelation के बाद, iPSC-keratinocytes व्युत्पंन (चरण 1.3.6 से) EDTA का उपयोग अलग । 2 मिनट के लिए 5% CO2 के साथ ३७ डिग्री सेल्सियस पर edta और इंक्यूबेट के 1 मिलीलीटर जोड़ें । अलग कोशिकाओं को फसल, एक hemocytometer का उपयोग कर उंहें गिनती, और एक नए 15 मिलीलीटर शंक्वाकार ट्यूब के लिए 1 x 106 कोशिकाओं को स्थानांतरित । 2 मिनट के लिए २५० x g पर अपकेंद्रित्र ।
    6. Supernatant निकालें और 1 x 106 कोशिकाओं 50-100 μl में कम कैल्शियम उपकला मध्यम 1 (EP1) की ।
    7. मैट्रिक्स में सभी माध्यम महाप्राण (चरण 2.1.5 देखें) और बीज 1 x 10 iPSC के6 कोशिकाओं-प्रत्येक फाइकोब्लास्ट परत पर keratinocytes व्युत्पंन । 30 मिनट के लिए 5% सह2 के साथ ३७ ° c पर थाली सेते ।
      नोट-थाली को न हिलाइए और केराटिनोसाइट को अटैचमेंट के लिए किसी भी माध्यम को न जोड़ें ।
    8. डालें के ऊपर से EP1 के 2 मिलीलीटर और EP1 के 3 मिलीलीटर को कुएं के नीचे से जोड़ें ।
    9. 2 दिनों के बाद, झिल्ली डालने की थाली में सभी माध्यम महाप्राण और 2 दिनों के लिए सामान्य कैल्शियम EP2 के लिए मध्यम बदल जाते हैं ।
    10. 2 दिनों के बाद, सभी मध्यम महाप्राण और एक हवा तरल इंटरफेस उत्पन्न करने के लिए केवल नीचे करने के लिए cornification माध्यम के 3 मिलीलीटर जोड़ें.
    11. 5% CO2 के साथ ३७ डिग्री सेल्सियस पर 14 दिनों के लिए 3 डी त्वचा अंगाभ को बनाए रखने और हर दूसरे दिन माध्यम बदल जाते हैं । डालने के किनारे काटने से 3 डी त्वचा अंगाभ फसल, और धुंधला और त्वचा भ्रष्टाचार का एक और अध्ययन के लिए इसका इस्तेमाल करते हैं ।
  2. त्वचा कलम
    1. एक मानक का उपयोग करते हुए, institutionally अनुमोदित विधि, मंजूरी पर साँस लेना संज्ञाहरण प्रदर्शन/ त्वचा भ्रष्टाचार के लिए, प्रत्येक चूहे के पृष्ठीय त्वचा के फर दाढ़ी ।
    2. माउस की त्वचा के 1 सेमी x 2 सेमी अनुभाग निकालें, संदंश के साथ घुमावदार कैंची का उपयोग कर ।
    3. दोष साइट और टांका रेशम टांके के साथ एक टाई ओवर ड्रेसिंग विधि का उपयोग करने पर सीएमसी-ipsc-व्युत्पन्न 3 डी त्वचा अंगाभ प्लेस ।
    4. 2 सप्ताह के लिए चूहों का निरीक्षण करें और उंहें ऊतकीय विश्लेषण के लिए बलिदान । पिछले अध्ययनों में धुंधला प्रोटोकॉल सत्यापित किया गया था

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

त्वचा, एपिडर्मिस और डर्मिस के अधिकांश भाग के लिए बना है । केराटिनोसाइट्स एपिडर्मिस का मुख्य कोशिका प्रकार है, और फाइब्रोब्लास्ट डर्मिस के मुख्य कोशिका प्रकार हैं । केराटिनोसाइट विभेदन की योजना को चित्र 1में दर्शाया गया है । सीबीएमसी-आईपीसीएससी को विट्रोक्टिन-कोटेड डिश में रखा गया था (चित्रा 1बी) । इस अध्ययन में, हमने सीबीएमसी-आईपीएससी को केरेटिनोसाइट्स में विभेदित किया और ईबी फॉर्मेशन का उपयोग करके फाइब्रोब्लास्ट किया । हम एक समान और keratinocytes और फाइब्रोब्लास्ट के नियंत्रित भेदभाव को सुनिश्चित करने के लिए फांसी ड्रॉप विधि का उपयोग कर EBs उत्पन्न (चित्रा 1सी). EBs प्रकार चतुर्थ कोलेजन-keratinocyte विभेदन के लिए लेपित प्लेटों से जुड़े थे, और मध्यम दैनिक बदल गया था । सीबीएमसी-आईपीएससी आरए, BMP4, और EGF के साथ इलाज किया गया । सीबीएमसी-आईपीएससी को केराटिनोसाइट्स में विभेदित किया गया था । भेदभाव के दौरान, cbmc-ipsc-प्राप्त keratinocytes के आकारिकी समय के साथ बदल (अनुपूरक चित्रा 1).

CBMC-iPSC-प्राप्त keratinocytes प्राथमिक keratinocytes के समान morphologies है (चित्रा 1डी). Pluripotent मार्कर OCT4 के जीन अभिव्यक्ति CBMC में downregulated किया गया था-iPSC-keratinocytes व्युत्पंन । प्रवेशिका अनुक्रम सारणी 1में दर्शाए गए हैं । Keratinocyte मार्कर की अभिव्यक्ति Np63, KRT5, और KRT14 में वृद्धि हुई थी CBMC-iPSC-keratinocyte व्युत्पंन (चित्रा 1एफ) । Np63 और KRT14 की अभिव्यक्ति द्वारा इम्यूनोहिस्टोकेमिस्ट्री (चित्रा 1) द्वारा सीबीएमसी-ipsc-व्युत्पन्न keratinocytes की पुष्टि की गई । इन परिणामों की पुष्टि की है कि सीबीएमसी-iPSC-keratinocytes व्युत्पंन प्राथमिक keratinocytes की विशेषताओं है ।

फाइकोब्लास्ट विभेदन की योजना को चित्र 2में दर्शाया गया है । हम भी एक vitronectin-लेपित पकवान में सीबीएमसी-iPSCs बनाए रखा और फाइकोब्लास्ट विभेदन के लिए इस्तेमाल EB गठन (चित्रा 2बी, सी) । हम EBs तहखाने मैट्रिक्स लेपित प्लेटों के लिए संलग्न है और हर दूसरे दिन माध्यम बदल दिया है । Outgrowth कोशिकाओं noncoated और प्रकार मैं कोलेजन-लेपित प्लेटों को हस्तांतरित किया गया । सीबीएमसी-आईपीएससी को फाइब्रोब्लास्ट में विभेदित किया गया था । भिंनता के दौरान, CBMC की आकृति विज्ञान-iPSC-फाइब्रोब्लास्ट व्युत्पंन समय के साथ बदल (अनुपूरक चित्रा 2) ।

CBMC-iPSC-व्युत्पन्न फाइब्रोब्लास्ट प्राथमिक फाइब्रोब्लास्ट के समान morphologies है (चित्रा 2डी). Pluripotent स्टेम सेल मार्कर OCT4 की अभिव्यक्ति CBMC में downregulated-iPSC-फाइब्रोब्लास्ट व्युत्पंन था । COL1A1, COL1A2, COL3A1, और CD44 के फाइब्रोब्लास्ट मार्कर CBMC में upregulated थे-iPSC-फाइब्रोब्लास्ट व्युत्पन्न (चित्रा 2एफ). प्रवेशिका अनुक्रम सारणी 1में दर्शाए गए हैं । इसके अलावा, CBMC-iPSC-व्युत्पंन फाइब्रोब्लास्ट प्रतिरक्षा और fibronectin की अभिव्यक्ति द्वारा immunohistochemistry द्वारा पुष्टि की गई थी (चित्रा 2). इन परिणामों का सुझाव है कि सीबीएमसी-iPSC-फाइब्रोब्लास्ट व्युत्पंन प्राथमिक फाइब्रोब्लास्ट के समान हैं ।

हम एक 3 डी त्वचा का उपयोग कर अंगाभ उत्पंन cbmc-ipsc-keratinocytes और फाइब्रोब्लास्ट व्युत्पंन । 3डी स्किन ऑर्गेज् म के बनने की योजना को चित्र 3में दर्शाया गया है । हम एक झिल्ली डालने थाली पर एक 3 डी त्वचा अंगाभ उत्पंन । 3 डी संस्कृति के लिए, CBMC-iPSC-फाइब्रोब्लास्ट प्रकार मैं कोलेजन और CBMC-iPSC-keratinocytes व्युत्पंन के साथ मढ़ा साथ स्तरीकृत थे व्युत्पंन । सीएमसी-iPSC-प्राप्त keratinocytes बोने के बाद, मध्यम 2 दिनों के लिए एक सामांय कैल्शियम एकाग्रता के लिए बदल गया था । 2 दिनों के बाद, एक उच्च कैल्शियम एकाग्रता मध्यम हवा तरल इंटरफेस संस्कृति के गठन के लिए केवल निचले कक्ष के लिए जोड़ा गया था । वायु-द्रव अंतराफलक संस्कृति ने केराटिनोसाइट्स की परिपक्वता और स्तरीकरण को प्रेरित किया । 3डी कल्चर के दौरान 3डी स्किन ऑर्गेनोइड की मोटाई बढ़ाई गई । इन परिणामों की पुष्टि की है कि 3 डी त्वचा अंगाभ से उत्पंन किया गया था ipsc-keratinocytes और हेमेटोक्सिलिन और eosin (H & E) धुंधला (चित्रा 3सी)

Cbmc-ipsc-व्युत्पन्न 3 डी त्वचा अंगाभ का उपयोग करना, हम चूहों के लिए 3 डी त्वचा अंगोइड कलम बांधने से एक humanized चूहों मॉडल (चित्रा 3बी) उत्पन्न. 1 सेमी x 2 सेमी डिफेक्ट को प्रेरित किया गया, और प्रत्यारोपण के लिए टाई-ओवर पद्धति का प्रयोग किया गया । 2 सप्ताह के बाद, प्रत्यारोपित त्वचा कुशलता चूहों को grafted था, और हम एच & ई और immunocytochemical विश्लेषण (चित्रा 3डी) द्वारा इस की पुष्टि की । Keratinocyte परिपक्वता और loricrin और KRT14 के एपिडर्मल विभेदन मार्कर cbmc में व्यक्त किया गया-ipsc-3 डी त्वचा ऑर्गेनॉइड व्युत्पंन (चित्रा 3) । CBMC-iPSC-3 डी त्वचा ऑर्गेनॉइड व्युत्पंन कार्यात्मक विभेदित थे, कुशलता से चूहों पर grafted, और प्रभावी ढंग से चूहों त्वचा दोष चंगा ।

Figure 1
चित्रा 1 : केराटिनोसाइट का विभेदन सीबीएमसी-आईपीएससी । () केराटिनोसाइट विभेदन की योजना सीबीएमसी-आईपीएससी से । ( और ) सीबीएमसी-आईपीएससी (पैनल बी) और आईपीएससी-व्युत्पन्न ईबीएस (पैनल सी) की आकारिकी । () सीबीएमसी-आईपीएससी द्वारा व्युत्पन्न केराटिनोसाइट्स की आकारिकी । () Np63 (लाल) और KRT14 (हरा) का इम्यूनोसाइटोरासायनिक विश्लेषण, जिसमें डी पी ए धुंधला (नीला) होता है । स्केल पट्टियां = १०० μm । () ipsc-व्युत्पंन keratinocyte (Ipsc-Ks) के pluripotent मार्कर और keratinocyte मार्कर की जीन अभिव्यक्ति । रेखांकन पांच स्वतंत्र नमूनों की SEM के साथ मतलब दिखा । छात्रों की टी-परीक्षण का उपयोग करते हुए सांख्यिकीय महत्व के लिए समूहों के बीच अंतर की जांच की गई । T-परीक्षण को अप्राचलिक मात्रात्मक डेटासेट का विश्लेषण करने के लिए लागू किया गया था, और एक-पुच्छ p-मान परिकलित किया गया था (*p < ०.०५, * *p < ०.०१, * * *p < ०.००१ इंगित सांख्यिकीय महत्व) । इस आंकड़े का बड़ा संस्करण देखने के लिए कृपया यहां क्लिक करें ।

Figure 2
चित्रा 2 : सीबीएमसी-आईपीएससी का फाइकोब्लास्ट विभेदन । () सीबीएमसी-आईपीएससी से फाइकोब्लास्ट विभेदन की योजना । ( और ) सीबीएमसी-आईपीएससी (पैनल बी) और आईपीएससी-व्युत्पन्न ईबीएस (पैनल सी) की आकारिकी । () सीबीएमसी-आईपीएससी द्वारा व्युत्पन्न फाइब्रोब्लास्ट की आकारिकी । () (लाल) और फाइब्रॉईक्टिन (लाल), के साथ एक साथ dapi धुंधला (नीला) का प्रतिरक्षा रासायनिक विश्लेषण । स्केल पट्टियां = १०० μm । (F) ipsc-व्युत्पन्न फाइकोब्लास्ट (Ipsc-Fs) के pluripotent मार्कर और फाइकोब्लास्ट मार्कर की जीन अभिव्यक्ति. रेखांकन पांच स्वतंत्र नमूनों की SEM के साथ मतलब दिखा । छात्रों की टी-परीक्षण का उपयोग करते हुए सांख्यिकीय महत्व के लिए समूहों के बीच अंतर की जांच की गई । T-परीक्षण को अप्राचलिक मात्रात्मक डेटासेट का विश्लेषण करने के लिए लागू किया गया था, और एक-पुच्छ p-मान परिकलित किया गया था (*p < ०.०५, * *p < ०.०१, * * *p < ०.००१ इंगित सांख्यिकीय महत्व) । इस आंकड़े का बड़ा संस्करण देखने के लिए कृपया यहां क्लिक करें ।

Figure 3
चित्रा 3 : Cbmc की पीढ़ी-ipsc-व्युत्पंन त्वचा अंगाभ और humanized चूहों मॉडल । () आईपीएससी-व्युत्पन्न त्वचा आर्गेनॉइड (आईएसओ) उत्पादन प्रक्रिया का योजनाबद्ध आरेख । () चूहों में आईएसओ की प्रत्यारोपण प्रक्रिया । () आईएसओ इन विट्रो का हिस्टोलॉजिकल एनालिसिस । () विवो में प्रत्यारोपित आईएसओ का हिस्टोलॉजिकल एनालिसिस । (-एच) इम्यूनोसाइटोकेमिकल का विश्लेषण loricrin और KRT14. नकली नियंत्रण (पैनल ), प्रत्यारोपित आईएसओ (पैनल एफ, loricrin), चूहों त्वचा (नकारात्मक नियंत्रण, पैनल जी), प्रत्यारोपित आईएसओ (पैनल एच, KRT14) । स्केल पट्टियां = २०० μm । इस आंकड़े का बड़ा संस्करण देखने के लिए कृपया यहां क्लिक करें ।

Supplementary Figure 1
अनुपूरक चित्रा 1: iPSC की आकारिकी-keratinocytes व्युत्पंन । इस आंकड़े का बड़ा संस्करण देखने के लिए कृपया यहां क्लिक करें ।

Supplementary Figure 2
अनुपूरक चित्रा 2: iPSC की आकारिकी-फाइब्रोब्लास्ट व्युत्पन्न. इस आंकड़े का बड़ा संस्करण देखने के लिए कृपया यहां क्लिक करें ।

लक्ष्य नाम दिशा प्राइमर अनुक्रम (5 '-3 ') आकार (आधार जोड़े) Refseq_ID
OCT4 आगे
उल्टा
ACCCCTGGTGCCGTGAA
GGCTGAATACCTTCCCAAATA
१९० NM_ 203289.5
PAX6 आगे
उल्टा
GTCCATCTTTGCTTGGGAAA
TAGCCAGGTTGCGAAGAACT
११० NM_ 000280.4
SOX1 आगे
उल्टा
कैकाक्सीग्गागेग्गासीएए
GGTACTTGTAATCCGGGTGC
१३३ NM_ 005986.2
Np63 आगे
उल्टा
GGAAAACAATGCCCAGACTC
GTGGAATACGTCCAGGTC
२९४ NM_ 001114982.1
KRT5 आगे
उल्टा
ACCGTTCCTGTAACAGCCAC
GCGGGAGACAGGGGGTGATG
१९८ NM_ 000424.3
KRT14 आगे
उल्टा
GCAGTCATCCAGAGATGTGACC
GGGATCTTCCAGTGGGATCT
१८१ NM_ 000526.4
CD44 आगे
उल्टा
AAGGTAGCAAACAACC
AGCTTTTTCTTCTGCCCACA
१५१ NM_ 001202556.1
COL1A1 आगे
उल्टा
CCCCTGGAAAGATGGAGATG
TCCAAACCTGAAACCTCTG
१४८ NM_ 000088.3
COL1A2 आगे
उल्टा
गाग्गागागासकटग्काएसीसी
TGCCCTCAGCAACAGTTCA
७७ NM_ 000089.3
COL3A1 आगे
उल्टा
सीजीसीसीसीटीसीसीटीएजीटीजी
TTCTGAGGACCAGTAGGGCA
१६१ NM_ 000090.3
विमेन्इन आगे
उल्टा
गगागाक्टीग्गट्टगग
TCCAGCTTCCTGTAGGT
१७० NM_ 003380.5
GAPDH आगे
उल्टा
ACCCACTCCTCCACCTTTGA
CTGTTGCTGTAGCCAAATTCGT
११० NM_ 002046.5

तालिका 1: परिमाणात्मक रीयल-टाइम पॉलीमरेज चेन रिएक्शन के लिए उपयोग किए जाने वाले प्राइमर्स के अनुक्रम ।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

मानव iPSCs व्यक्तिगत पुनर्योजी चिकित्सा के लिए एक नया विकल्प के रूप में सुझाव दिया गया है17। रोगी से व्युत्पंन व्यक्तिगत ipscs रोगी विशेषताओं है कि रोग मॉडलिंग, दवा स्क्रीनिंग, और ऑटोलॉगस प्रत्यारोपण के लिए इस्तेमाल किया जा सकता है प्रतिबिंबित18,19। रोगी-प्राप्त ipscs का उपयोग भी प्राथमिक कोशिकाओं के बारे में समस्याओं को दूर कर सकते हैं, पर्याप्त सेल नंबर की कमी है, और प्रतिरक्षा प्रतिक्रियाओं5,17,19. हालांकि, व्यक्तिगत iPSCs का उत्पादन समय, लागत और श्रम प्रतिबंधों के कारण आर्थिक रूप से व्यवहार्य नहीं है । एचएलए-होमोजाइगोस सीबीएमसी-व्युत्पन्न आईपीएससी एक नई संभावना के रूप में उभरा है । एचएलए-होमोजाइगोस आईपीएससी आर्थिक रूप से मूल्यवान हो सकता है और8,11,12,13रोगियों की एक बड़ी संख्या के लिए लागू किया जा सकता है । इसके अलावा, CBMCs के एचएलए टंकण सेल बैंक के भंडारण के दौरान होता है, जिससे उंहें अनुसंधान और प्रत्यारोपण के लिए उपयोग करने के लिए आसान बना । सीबीएमसी-ipscs को कार्डियोमाइटोसाइट्स, hepatocytes, और chondrocytes में अंतर करने के लिए प्रोटोकॉल16,20,21,22,23सूचित किया गया है ।

एपिडर्मल और त्वचीय परतें त्वचा के घटक हैं । एपिडर्मिस में केराटिनोसाइट्स होते हैं और डर्मिस में फाइब्रोब्लास्ट होते हैं । इसलिए हमने क्रमशः सीबीएमसी-आईपीएससी को केराटिनोसाइट्स और फाइब्रोब्लास्ट में विभेदित किया । भिंनता के लिए, वर्दीधारी, अच्छी तरह से नियंत्रित, और अनुकूलित ebs हैंगिंग ड्रॉप विधि15,24द्वारा जनरेट किए गए थे । प्रकार चतुर्थ कोलेजन तहखाने झिल्ली का एक प्रमुख घटक है । Keratinocyte विभेदन के लिए, EBs प्रकार चतुर्थ कोलेजन-लेपित व्यंजन से जुड़े थे । सीबीएमसी-ipsc-प्राप्त keratinocytes एक cobblestone की तरह आकारिकी (चित्रा 1डी) था । केराटिनोसाइट मार्करों Np63 और KRT14 iPSC-Ks में व्यक्त किया गया (चित्रा 1ई, एफ). कि परिणाम की पुष्टि की है कि आरए और BMP4 keratinocyte मार्कर के upregulation प्रेरित किया । इसके अलावा, सीबीएमसी-iPSCs प्राथमिक keratinocytes के समान keratinocytes में विभेदित किया गया ।

फाइकोब्लास्ट विभेदन के लिए, EBs तहखाने झिल्ली मैट्रिक्स लेपित प्लेटों से जुड़े थे, और विभेदित कोशिकाओं serially noncoated और प्रकार मैं कोलेजन-लेपित प्लेटों पर passaged थे । एक क्रमिक उपसंस्कृति को फाइकोब्लास्ट विभेदन निर्दिष्ट करने के लिए प्रेरित किया गया । फाइब्रोब्लास्ट एक extracellular मैट्रिक्स (ECM) है कि प्रवास और आसंजन कार्यों का उत्पादन किया । फाइब्रोब्लास्ट भी प्रचुर कोलाजेनघटकों का उत्पादन करते हैं । सीबीएमसी-iPSC-फाइब्रोब्लास्ट से व्युत्पन्न, फाइब्रोकोरक सतह मार्कर CD44 बढ़ गया था । कोलेजन की अभिव्यक्ति iPSC-Fs में upregulated था (चित्रा 2एफ) । आईएससी-एफएस में फाइब्रॉईक्टिन और विमेन्तिन की अभिव्यक्ति को बढ़ाया गया (चित्रा 2) ।

विभेदित keratinocytes और फाइब्रोब्लास्ट का उपयोग करना, हम CBMC उत्पंन-iPSC-त्वचा ऑर्गेनॉइड व्युत्पंन (चित्रा 3) । हम एक उच्च कैल्शियम माध्यम है कि CBMC की स्तरित परतों-iPSC-व्युत्पंन त्वचा ऑर्गेनॉइड प्रेरित के साथ एक हवा तरल अंतरफलक संस्कृति का इस्तेमाल किया । कैल्शियम की उच्च एकाग्रता vivo में और विट्रो में keratinocyte परिपक्वता के लिए आवश्यक था, जबकि हवा तरल इंटरफेस बहुस्तरीय स्तर26,27,28विकसित करने के लिए इस्तेमाल किया गया था । हम असली त्वचा की नकल करने के लिए इस विधि का इस्तेमाल किया, और ऊतकीय विश्लेषण से पता चला है कि त्वचा (चित्रा 3सी) स्तरीकृत था । घाव भरने की क्षमता की पुष्टि करने के लिए, हम चूहों त्वचा में आईएसओ प्रत्यारोपित, टाई पर ड्रेसिंग विधि (चित्रा 3डी) का उपयोग कर । प्रत्यारोपण के बाद, त्वचा ऑर्गेनॉइड कुशलता से grafted और चूहों त्वचा पर्याप्त रूप से चंगा किया गया । KRT14 को स्तरित स्क्वैमस और नॉनस्क्वैमस उपकला के बेसल परत में व्यक्त किया गया था । Loricrin स्तर कॉर्नियम के एक मुख्य घटक में पाया जाता है मरणासन्न विभेदक और keratinized उपकला कोशिकाओं29,30। प्रतिरोपित त्वचा में लोरिप्रिन के एपिडर्मल विभेदन मार्कर को व्यक्त किया गया । KRT14 और loricrin की अभिव्यक्ति की पुष्टि की है कि त्वचा अंगाभ पूरी तरह से परिपक्व था, और विभेदन immunohistochemical धुंधला द्वारा प्रदर्शन किया गया था (चित्रा 3) ।

इस अध्ययन में, हम keratinocytes और फाइब्रोब्लास्ट, मानव त्वचा के मुख्य कोशिका प्रकार में सीबीएमसी-iPSCs अंतर करने के लिए एक प्रोटोकॉल विकसित की है । हम पुष्टि की है कि cbmc-ipsc-keratinocytes और फाइब्रोब्लास्ट व्युत्पंन प्राथमिक कोशिका लाइनों के समान फीनोटाइप दिखाया । इन विभेदित कोशिकाओं का उपयोग करना, हम एक 3 डी त्वचा अंगाभ उत्पंन और यह मंजूरी में grafted/ इस मूल तकनीक पहले १९२९ में ब्लेयर और ब्राउन द्वारा वर्णित किया गया था और सामांयतः31,३२कलम बांधने की त्वचा के लिए प्रयोग किया जाता है । इस विधि भ्रष्टाचार को स्थानांतरित करने से रोका, घाव करने के लिए एक अच्छा आसंजन इष्ट, और इस प्रकार त्वरित ऊतक हीलिंग । हिस्टोलॉजिकल विश्लेषण की पुष्टि की है कि 3 डी त्वचा अंगाभ एक मानव त्वचा फेनोटाइप है कि सफलतापूर्वक 2 सप्ताह से अधिक स्तरित और परिपक्व में नकल की । त्वचा कलम बांधने का कार्य आम तौर पर सिलिकॉन बुलबुला चैंबर३३,३४द्वारा keratinocytes और fibroblasts की एकल कोशिकाओं का उपयोग किया जाता है । इस प्रणाली को भ्रष्टाचार के लिए आसान है, लेकिन हम भ्रष्टाचार के बाद प्रत्यारोपण दक्षता के लिए मनाया के लिए और अधिक समय की जरूरत है । प्लास्टिक या सिलिकॉन चैंबर चूहों की त्वचा के खिलाफ एक बाधा के रूप में कार्य करता है । 3 डी त्वचा ऑर्गेनॉइड सिस्टम-व्युत्पन्न iPSCs एक प्लास्टिक या सिलिकॉन चैंबर का उपयोग नहीं करते । इस प्रणाली में, प्रत्यारोपण कुशल था; हालांकि चूहों की प्राकृतिक चिकित्सा प्रक्रिया को ब्लॉक करना मुश्किल था । तो, चूहों की त्वचा प्रत्यारोपण के बाद एक लंबे समय के लिए आईएसओ के कई हिस्सों को कवर किया । इस विधि का एक हिस्सा है कि सुधार किया जाना चाहिए यहां प्रस्तुत की है ।

अंत में, सीबीएमसी-iPSCs त्वचा grafts के लिए एक संभावित सेल स्रोत हैं । इन प्रोटोकॉल का उपयोग करना, cbmc-ipsc-प्राप्त keratinocytes, fibroblasts, और एक 3 डी त्वचा अंगाभ त्वचाविज्ञान, दवा और कॉस्मेटिक स्क्रीनिंग से संबंधित अध्ययन में इस्तेमाल किया जा सकता है, और पुनर्योजी दवा ।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों के पास खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

यह काम कोरिया हेल्थकेयर प्रौद्योगिकी आर & डी परियोजना, स्वास्थ्य, कल्याण और परिवार मामलों के मंत्रालय, कोरिया गणराज्य (H16C2177, H18C1178) से एक अनुदान द्वारा समर्थित किया गया था ।

Materials

Name Company Catalog Number Comments
Adenine Sigma A2786 Component of differentiation medium for fibroblast
AggreWell Medium (EB formation medium) STEMCELL 05893 EB formation
Anti-Fibronectin antibody abcam ab23750 Fibroblast marker
Anti-KRT14 antibody abcam ab7800 Keratinocyte marker
Anti-Loricrin antibody abcam ab85679 Stratum corneum marker
Anti-p63 antibody abcam ab124762 Keratinocyte marker
Anti-Vimentin antibody Santa cruz sc-7558 Fibroblast marker
BAND AID FLEXIBLE FABRIC Johnson & Johnson - Bandage
Basement membrane matrix (Matrigel) BD 354277 Component of differentiation medium for fibroblast
BLACK SILK suture AILEEE SK617 Skin graft
CaCl2 Sigma C5670 Component of epithelial medium for 3D skin organoid
Collagen type I BD 354236 3D skin organoid
Collagen type IV Santa-cruz sc-29010 Component of differentiation medium for keratinocyte
Defined keratinocyte-Serum Free Medium Gibco 10744-019 Component of differentiation medium for keratinocyte
DMEM, high glucose Gibco 11995065 Component of differentiation medium
DMEM/F12 Medium Gibco 11330-032 Component of differentiation medium
Essential 8 medium Gibco A1517001 iPSC medium
FBS, Qualified Corning 35-015-CV Component of differentiation medium for fibroblast and keratinocyte
Glutamax Supplement  Gibco 35050061 Component of differentiation medium for fibroblast
Insulin Invtrogen 12585-014 Component of differentiation medium for fibroblast and keratinocyte
Iris standard curved scissor Professional PC-02.10 Surgical instrument
Keratinocyte Serum Free Medium Gibco 17005-042 Component of differentiation medium for keratinocyte
L-ascorbic acid 2-phosphata sesquimagnesium salt hydrate Sigma A8960 Component of differentiation medium for keratinocyte
MEM Non-Essential Amino Acid Gibco 1140050 Component of differentiation medium for fibroblast
Meriam Forceps Thumb 16 cm HIROSE HC 2265-1 Surgical instrument
NOD.CB17-Prkdc SCID/J The Jackson Laboratory 001303 Mice strain for skin graft
Petri dish 90 mm Hyundai Micro H10090 Plastic ware
Recombinant Human BMP-4 R&D 314-BP Component of differentiation medium for keratinocyte
Recombinant human EGF protein R&D 236-EG Component of differentiation medium for keratinocyte
Retinoic acid Sigma R2625 Component of differentiation medium for keratinocyte
T/C Petridish 100 mm, 240/bx TPP 93100 Plastic ware
Transferrin Sigma T3705 Component of epithelial medium for 3D skin organoid
Transwell-COL collagen-coated membrane inserts  Corning CLS3492 Plastic ware for 3D skin organoid 
Vitronectin Life technologies A14700 iPSC culture
Y-27632 Dihydrochloride peprotech 1293823 iPSC culture

DOWNLOAD MATERIALS LIST

References

  1. Vincent, J. F., Bogatyreva, O. A., Bogatyrev, N. R., Bowyer, A., Pahl, A. K. Biomimetics: its practice and theory. Journal of The Royal Society Interface. 3, (9), 471-482 (2006).
  2. Madison, K. C. Barrier function of the skin: "la raison d'etre" of the epidermis. Journal of Investigative Dermatology. 121, (2), 231-241 (2003).
  3. Chen, M., Przyborowski, M., Berthiaume, F. Stem cells for skin tissue engineering and wound healing. Critical Reviews in Biomedical Engineering. 37, (4-5), 399-421 (2009).
  4. Dixit, S., et al. Immunological challenges associated with artificial skin grafts: available solutions and stem cells in future design of synthetic skin. Journal of Biological Engineering. 11, 49 (2017).
  5. Yamanaka, S. Induced pluripotent stem cells: past, present, and future. Cell Stem Cell. 10, (6), 678-684 (2012).
  6. Yamanaka, S. Pluripotency and nuclear reprogramming. Philosophical Transactions of the Royal Society B: Biological Sciences. 363, (1500), 2079-2087 (2008).
  7. Scheiner, Z. S., Talib, S., Feigal, E. G. The potential for immunogenicity of autologous induced pluripotent stem cell-derived therapies. Journal of Biological Chemistry. 289, (8), 4571-4577 (2014).
  8. Zimmermann, A., Preynat-Seauve, O., Tiercy, J. M., Krause, K. H., Villard, J. Haplotype-based banking of human pluripotent stem cells for transplantation: potential and limitations. Stem Cells and Development. 21, (13), 2364-2373 (2012).
  9. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, (4), 663-676 (2006).
  10. Terasaki, P. I. A brief history of HLA. Immunologic Research. 38, (1-3), 139-148 (2007).
  11. Haase, A., et al. Generation of induced pluripotent stem cells from human cord blood. Cell Stem Cell. 5, (4), 434-441 (2009).
  12. Rim, Y. A., et al. Recent progress of national banking project on homozygous HLA-typed induced pluripotent stem cells in South Korea. Journal of Tissue Engineering and Regenerative Medicine. 12, (3), 1531-1536 (2018).
  13. Nakatsuji, N., Nakajima, F., Tokunaga, K. HLA-haplotype banking and iPS cells. Nature Biotechnology. 26, (7), 739-740 (2008).
  14. Pappas, D. J., et al. Proceedings: human leukocyte antigen haplo-homozygous induced pluripotent stem cell haplobank modeled after the california population: evaluating matching in a multiethnic and admixed population. Stem Cells Translational Medicine. 4, (5), 413-418 (2015).
  15. Lin, Y., Chen, G. Embryoid body formation from human pluripotent stem cells in chemically defined E8 media. StemBook. Available from: https://www.stembook.org/node/6632 (2008).
  16. Kim, Y., et al. Establishment of a complex skin structure via layered co-culture of keratinocytes and fibroblasts derived from induced pluripotent stem cells. Stem Cell Research & Therapy. 9, (1), 217 (2018).
  17. Diecke, S., Jung, S. M., Lee, J., Ju, J. H. Recent technological updates and clinical applications of induced pluripotent stem cells. The Korean Journal of Internal Medicine. 29, (5), 547-557 (2014).
  18. Shi, Y., Inoue, H., Wu, J. C., Yamanaka, S. Induced pluripotent stem cell technology: a decade of progress. Nature Reviews Drug Discovery. 16, (2), 115-130 (2017).
  19. Yoshida, Y., Yamanaka, S. Recent stem cell advances: induced pluripotent stem cells for disease modeling and stem cell-based regeneration. Circulation. 122, (1), 80-87 (2010).
  20. Pham, T. L., Nguyen, T. T., Van Bui, A., Nguyen, M. T., Van Pham, P. Fetal heart extract facilitates the differentiation of human umbilical cord blood-derived mesenchymal stem cells into heart muscle precursor cells. Cytotechnology. 68, (4), 645-658 (2016).
  21. Stecklum, M., et al. Cell differentiation mediated by co-culture of human umbilical cord blood stem cells with murine hepatic cells. In Vitro Cellular & Developmental Biology - Animal. 51, (2), 183-191 (2015).
  22. Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. Journal of Visualized Experiments. (124), e55988 (2017).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Application of Cord Blood and Cord Blood-derived Induced Pluripotent Stem Cells for Cartilage Regeneration. Cell Transplantation. (2018).
  24. Shevde, N. K., Mael, A. A. Techniques in embryoid body formation from human pluripotent stem cells. Methods in Molecular Biology. 946, 535-546 (2013).
  25. Shamis, Y., et al. iPSC-derived fibroblasts demonstrate augmented production and assembly of extracellular matrix proteins. In Vitro Cellular & Developmental Biology - Animal. 48, (2), 112-122 (2012).
  26. Bikle, D. D., Xie, Z., Tu, C. L. Calcium regulation of keratinocyte differentiation. Expert Review of Endocrinology & Metabolism. 7, (4), 461-472 (2012).
  27. Bernstam, L. I., Vaughan, F. L., Bernstein, I. A. Keratinocytes grown at the air-liquid interface. In Vitro Cellular & Developmental Biology. 22, (12), 695-705 (1986).
  28. Prunieras, M., Regnier, M., Woodley, D. Methods for cultivation of keratinocytes with an air-liquid interface. Journal of Investigative Dermatology. 81, 1 Suppl 28-33 (1983).
  29. Steven, A. C., Bisher, M. E., Roop, D. R., Steinert, P. M. Biosynthetic pathways of filaggrin and loricrin--two major proteins expressed by terminally differentiated epidermal keratinocytes. Journal of Structural Biology. 104, (1-3), 150-162 (1990).
  30. Hohl, D., et al. Characterization of human loricrin. Structure and function of a new class of epidermal cell envelope proteins. Journal of Biological Chemistry. 266, (10), 6626-6636 (1991).
  31. Bern, R., et al. Original and modified technique of tie-over dressing: Method and application in burn patients. Burns. 44, (5), 1357-1360 (2018).
  32. Joyce, C. W., Joyce, K. M., Kennedy, A. M., Kelly, J. L. The Running Barbed Tie-over Dressing. Plastic and Reconstructive Surgery - Global Open. 2, (4), 137 (2014).
  33. Wang, C. K., Nelson, C. F., Brinkman, A. M., Miller, A. C., Hoeffler, W. K. Spontaneous cell sorting of fibroblasts and keratinocytes creates an organotypic human skin equivalent. Journal of Investigative Dermatology. 114, (4), 674-680 (2000).
  34. Yang, R., et al. Generation of folliculogenic human epithelial stem cells from induced pluripotent stem cells. Nature Communications. 5, 3071 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics