Geração de organoides pele 3D do cordão hemoderivados induzida por células-tronco pluripotentes

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Propomos um protocolo que mostra como diferenciar pluripotentes induzidas células-tronco derivadas de queratinócitos e fibroblastos e gerar uma pele 3D organoides, usando estes queratinócitos e fibroblastos. Este protocolo contém uma etapa adicional de gerar um modelo de ratos humanizados. A técnica aqui apresentada vai melhorar pesquisa dermatológica.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Kim, Y., Ju, J. H. Generation of 3D Skin Organoid from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (146), e59297, doi:10.3791/59297 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

A pele é o maior órgão do corpo e tem muitas funções. A pele atua como uma barreira física e protetor do corpo e regula as funções corporais. A biomimética é a imitação dos modelos, sistemas e elementos da natureza com a finalidade de resolver problemas humanos complexos1. Pele a biomimética é uma ferramenta útil para investigação de doença in vitro e in vivo medicina regenerativa. Células-tronco humanas pluripotentes induzidas (iPSCs) têm a característica de proliferação ilimitada e a capacidade de diferenciação de três camadas germinativas. IPSCs humanas são gerados a partir de várias células primárias, tais como as células do sangue, queratinócitos, fibroblastos e muito mais. Entre eles, células mononucleares de sangue de cordão (CBMCs) surgiram como uma fonte alternativa de célula na perspectiva da medicina regenerativa alogênico. CBMCs são úteis na medicina regenerativa, porque leucocitário humano (HLA) de antígeno digitando é essencial para a célula, sistema bancário. Nós fornecemos um método para a diferenciação de CBMC-iPSCs em queratinócitos e fibroblastos e para a geração de uma pele 3D organoides. Fibroblastos e queratinócitos CBMC-iPSC derivados têm características semelhantes a uma linha celular primária. Os organoids 3D da pele são gerados pela sobreposição de uma camada epidérmica em uma camada dérmica. Transplantando essa pele 3D organoides, é gerado um modelo de ratos humanizados. Este estudo mostra que um organoides 3D pele humana iPSC-derivado podem ser uma ferramenta de novela, alternativa para pesquisa dermatológica in vitro e in vivo.

Introduction

Pele cobre a superfície mais externa do corpo e protege os órgãos internos. A pele tem várias funções, incluindo proteção contra patógenos, absorver e armazenar água, regular a temperatura do corpo e excretando corpo perca2. Enxertos de pele podem ser classificados dependendo da fonte de pele; enxertos de pele de outro doador são denominados aloenxertos, e enxertos usando a pele do próprio paciente são autoenxertos. Embora um autograft é o tratamento preferido devido ao seu risco de rejeição baixa, biópsias de pele são difíceis de serem realizadas em pacientes com lesões graves ou um número insuficiente de células da pele. Em pacientes com queimaduras graves, três vezes o número de células da pele é necessário para cobrir grandes áreas. A disponibilidade limitada de células da pele do corpo do paciente resulta em situações em que o transplante de allogenous é necessário. Um aloenxerto é usado temporariamente até transplante autólogo pode ser realizado desde que geralmente é rejeitada pelo sistema imunológico do hospedeiro após aproximadamente 1 semana3. Para superar a rejeição pelo sistema imunológico do paciente, enxertos devem ser provenientes de uma fonte com a mesma identidade imunológica do paciente4.

IPSCs humanas são uma fonte emergente das células para terapia de células-tronco5. IPSCs humanas são gerados a partir de células somáticas, usando reprogramação fatores como OCT4, SOX2, Klf4 e c-Myc6. Usar iPSCs humana supera as questões éticas e imunológicas das células-tronco embrionárias (CES)7,8. IPSCs humanas ter pluripotência e pode diferenciar-se em três camadas germinativas9. A presença de HLA, um fator crítico na medicina regenerativa, determina a resposta imune e a possibilidade de rejeição10. O uso de derivados de paciente iPSCs resolve os problemas de rejeição de limitação e sistema imunológico de células-fonte. CBMCs também têm surgido como uma fonte alternativa de célula para medicina regenerativa11. HLA obrigatório digitar, que ocorre durante a operação bancária CBMC, facilmente pode ser usado para pesquisa e transplante de órgãos. Além disso, homozigotos HLA-tipo iPSCs pode aplicar amplamente vários pacientes12. Um banco CBMC-iPSC é uma estratégia eficiente para terapia celular e medicina regenerativa alogênico12,13,14e romance. Neste estudo, utilizamos CBMC-iPSCs, diferenciadas em queratinócitos e fibroblastos e gerar camadas estratificadas pele 3D. Os resultados deste estudo sugerem que um organoides CBMC-iPSC-derivado de pele 3D é uma nova ferramenta de pesquisa dermatológica in vitro e in vivo.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Todos os procedimentos que envolvam animais foram realizados de acordo com a lei de bem-estar de animais de laboratório, o guia para o cuidado e o uso de animais de laboratório, e as diretrizes e políticas para a experimentação de roedor fornecido pelo cuidado Animal institucional e Use o Comité (IACUC) da escola de medicina da Universidade Católica da Coreia. O protocolo de estudo foi aprovado pelo Conselho de revisão institucional da Universidade Católica da Coreia (CUMC-2018-0191-01). O IACUC e o departamento de laboratório animais (DOLA) da Universidade Católica da Coreia, Songeui Campus credenciados as instalações de laboratório Animal de excelência de Coreia da Coreia Food and Drug Administration em 2017 e adquirida Associação para avaliação e Acreditação de acreditação total Internacional de laboratório Animal conta internacional (AAALAC) em 2018.

1. pele diferenciação celular de células-tronco pluripotentes induzidas

  1. Preparação média
    Nota: Guarde todos os média a 4 ° C em um ambiente escuro por até 3 meses. Filtro médio todos usando um sistema de filtro de polietersulfona 0,22 μm antes do uso para a esterilização. Todos médio estava disponível em um volume total de 500 mL.
    1. Preparar o KDM1 (meio de diferenciação queratinócito 1). Médio (DMEM modificado águia do mix Dulbecco) / F12 médio (3:1), com 2% de soro fetal bovino (FBS), 0,3 mmol/L ácido L-ascórbico, 5 μg/mL insulina e 24 adenina µ g/mL.
    2. Preparar o KDM2 (meio de diferenciação queratinócito 2). Mix definido queratinócito soro livre médio (veja a Tabela de materiais) com 0,3 mmol/l ácido L-ascórbico, 5 μg/mL insulina e adenina de 10 μg/mL.
      Nota: Queratinócito definidos soro livre médio é otimizado para suportar o crescimento e a expansão dos queratinócitos.
    3. Preparar o KDM3 (meio de diferenciação de queratinócitos 3). Mix definidos queratinócito soro livre médio e meio livre de soro do queratinócito (1:1) consulte a Tabela de materiais para obter detalhes.
      Nota: Queratinócito soro livre médio é otimizado para o crescimento e a manutenção de queratinócitos.
    4. Preparar o FDM1 (meio de diferenciação de fibroblastos 1). Meio de mistura DMEM/F12 (3:1) com 5% FBS, 5 μg/mL insulina, adenina de 0,18 mM e 10 ng/mL fator de crescimento epidérmico (EGF).
    5. Preparar o FDM2 (meio de diferenciação de fibroblastos 2). Meio de mistura DMEM/F12 (1:1) com 5% FBS e 1% não essenciais aminoácidos.
    6. Preparar o EP1 (epitelial médio 1). DMEM/F12 Mix (3:1) com 4 mM L-glutamina, 40 adenina μM, 10 transferrina μg/mL, insulina de 10 μg/mL e 0,1% FBS.
    7. Preparar o EP2 (epitelial médio 2). Misture o EP1 e 1,8 mM de cloreto de cálcio.
    8. Preparar o EP3 (epitelial médio 3, cornificação médio). Meio de mistura F12 com 4 mM L-glutamina, 40 adenina μM, 10 transferrina μg/mL, insulina de 10 μg/mL, 2% FBS e 1,8 mM de cloreto de cálcio.
  2. Geração de corpo embrionário
    1. Gere CBMC-iPSCs usando o protocolo mostrado no estudo anterior12.
    2. Pratos de cultura de casaco, usando a vitronectina. Prepare-se 5 mL para revestir um prato de 100 mm.
      1. Descongelar e ressuspender 50 μL de vitronectina 0,5 mg/mL (concentração final: 5 µ g/mL) com 5 mL de salina tampão fosfato (PBS). Adicionar a solução para os pratos e incubar a temperatura ambiente (RT) por 1 h. aspirado o material de revestimento antes do uso (para não secar).
    3. Manter as iPSCs CBMC-derivado para a vitronectina revestido 100 mm da placa e mudar o meio de iPSC (E8) diariamente a 37 ° C, com 10% de CO2.
    4. Gere corpos embrionários (EBs) usando o protocolo demonstrado em um estudo anterior15 (descrito resumidamente como segue). Expanda iPSCs, alterando o meio até que as células têm alcançado confluência de 80%. Na confluência de 80%, remover o meio e lave com PBS.
    5. Trate as células com 1 mL de ácido de 1 mM ácido etilenodiaminotetracético (EDTA). Incubar a 37 ° C com 5% de CO2 por 2 min e colher as células usando 3 mL do meio de E8. Centrifugar as células a 250 x g por 2 min.
    6. Aspirar o sobrenadante e aplicar 5 mL de meio de E8 de células. Contar as células usando um hemocytometer e transferir 1 x 106 células para um novo tubo cônico de 15 mL. Centrifugar as células a 250 x g por 2 min.
    7. Ressuspender as células transferidas com 2,5 mL de meio de formação EB com inibidor de quinase Rho-associado (ROCK) 10 μM. 1 x 104 células (25 µ l/gota) na tampa do prato cultura noncoated usando uma pipeta de canais múltiplos de 10 – 100 μL de cair. Formulário 100 EBs de 1 x 106 células (1 x 104 células/1 EB). Vire o prato e segure a tampa da gota.
      Nota: Inibidor ROCK é necessária durante a etapa de penhora no processo de diferenciação e manutenção. Adicione o inibidor ROCK apenas na fase de agregação de EB.
    8. Incube a 37 ° C com 5% CO2 gotas para 1 dia.
    9. No dia seguinte, colher a 100 EBs e usá-los para diferenciação. Lavar a tampa da placa com meio de iPSC (meio de E8) ou PBS e colher o seu conteúdo para um tubo cónico de 50 mL. Manter o EBs em RT para 1 min para acalmá-los. Aspire o sobrenadante e ressuspender o EBs com E8 médio mantê-los em um prato de Petri de 90 milímetros até a diferenciação.
  3. Diferenciação de CBMC-iPSCs em queratinócitos
    Nota: Para um esquema da diferenciação queratinócito da CBMC-iPSCs, consulte a Figura 1A.
    1. EBs de colheita a 100 para um tubo cônico de 50 mL, com média de iPSC ou PBS. Manter em RT para 1 min assentar o EBs. Certifique-se que eles resolvem na parte inferior do tubo cónico. Aspirar o sobrenadante e ressuspender o EBs com E8 médio com 1 ng/mL Proteína morfogenética óssea 4 (BMP4). Transferir o EBs para uma placa de Petri de 90 mm e mantê-los a 37 ° C com 5% de CO2 por 1 dia.
    2. Casaco de pratos de cultura, usando o colágeno tipo IV. Prepare-se 5 mL de colágeno de tipo IV para revestir um prato de 100 mm.
      1. Descongelar e ressuspender o tipo solução de colágeno IV (concentração final: 50 µ g/mL) com 0,05 N HCl. Adicione a solução para os pratos e incubar a RT por 1 h. aspirar o material de revestimento antes do uso (para não secar).
        Nota: Antes de utilizar as placas, lavar os pratos 3 x com PBS para remover qualquer ácido.
    3. Colher o EBs (etapa 1.3.1) para um tubo cónico de 50 mL e mantê-las em RT para 1 min para acalmá-los. Certifique-se que resolver na parte inferior do tubo cónico, aspirar o sobrenadante e ressuspender o EBs em 6 mL de KDM1 com inibidor ROCK 10 µM. Transferi o EBs para o prato de 100mm revestido de colágeno tipo IV.
      Nota: Adicione o inibidor ROCK apenas na fase de fixação de EB.
    4. Entre os dias 8 – 0, altere o meio de todos os outros dias para KDM1 com ácido retinoico de 3 µM (RA) e 25 ng/mL cada de BMP4 e EGF. Manter o EBs a 37 ° C com 5% de CO2.
    5. Entre os dias 9 a 12, altere o meio todos os dias para KDM2 com 3 µM RA, 25 ng/mL BMP4 e 20 ng/mL EGF.
    6. Entre os dias 13 a 30, altere o meio de todos os outros dias para KDM3 com 10 ng/mL BMP4 e 20 ng/mL EGF.
  4. Diferenciação de CBMC-iPSC em fibroblastos
    Nota: Para um esquema de diferenciação de fibroblastos de CBMC-iPSCs, ver Figura 2.
    1. Pratos de cultura de casaco, usando a matriz de membrana basal. Prepare-se 5 mL para revestir um prato de 100 mm.
      1. Descongelar a matriz da membrana basal (concentração final: 600 ng/mL) e diluir com meio DMEM/F12. Adicionar a solução para os pratos e incubar a 37 ° C por 30 min. aspirado o material de revestimento antes do uso (para não secar).
    2. EBs de colheita a 100 para um tubo cônico de 50 mL com uma pipeta com iPSC médio ou PBS. Manter em RT para 1 min assentar o EBs. Certifique-se de que casos são fechados na parte inferior do tubo cónico. Remova o sobrenadante.
    3. Ressuspender o EBs utilizando uma pipeta de 1.000 µ l em 6 mL de FDM1 com inibidor ROCK 10 µM. Transferir o EBs (com médio) para um prato de 100mm matriz-revestido de membrana basal e incubar a 37 ° C com 5% de CO2. Atualize o FDM1 todos os dias por 3 dias.
      Nota: Apenas adicione o inibidor ROCK na fase de fixação de EB.
    4. Adicione 0,5 nM Proteína morfogenética óssea (BMP-4) de 4 para o FDM1 entre os dias 4 e 6.
    5. No dia 7, altere o meio para FDM2 todos os dias durante 1 semana.
    6. No dia 14, adicionar 1 mL de 1 mM de EDTA e incubar a 37 ° C com 5% de CO2 por 2 min. colher as células com 3 mL de FDM2 e centrifugar a 250 x g por 2 min. Retire o sobrenadante e ressuspender as células em 5 mL de FDM1.
    7. Contar as células usando um hemocytometer, Ressuspender 2 x 106 células com FDM1 médio e transferir as células para o prato noncoated. Manter as células a 37 ° C com 5% de CO2 e mudar o meio de todos os outros dias.
    8. Pratos de cultura de casaco, usando colágeno tipo I. Prepare-se 5 mL para revestir um prato de 100 mm. Diluir a solução de colágeno do tipo I (concentração final: 50 µ g/mL) em 0,02 N de ácido acético. Adicionar a solução para os pratos e incubar a RT por 1 h. aspirado o material de revestimento antes do uso (para não secar).
      Nota: Antes de utilizar as placas, lavar os pratos 3 x com PBS para remover o ácido.
    9. No dia 21, adicionar 1 mL de 1 mM de EDTA e incubar a 37 ° C com 5% de CO2 por 2 min. colher as células com 3 mL de FDM1 e centrifugar a 250 x g por 2 min. Retire o sobrenadante e ressuspender as células em 5 mL de FDM1. Contar as células usando um hemocytometer e a transferência de 2 x 106 células para o tipo eu prato de colágeno-revestido 100 mm com média de FDM1. Manter as células a 37 ° C com 5% de CO2 e mudar o meio de todos os outros dias.
    10. No dia 28, adicionar 1 mL de 1 mM de EDTA e incubar a 37 ° C com 5% de CO2 por 2 min. colher as células com 3 mL de FDM1 e centrifugar a 250 x g por 2 min. Retire o sobrenadante e ressuspender as células em 5 mL de FDM1. Contar as células usando um hemocytometer e transferir 2 x 106 células para um prato de noncoated com FDM1 médio. Manter a célula a 37 ° C com 5% de CO2 e mudar o meio de todos os outros dias.
      Nota: iPSC-derivado de fibroblastos proliferam como uma linhagem de células de fibroblastos primários e passagem até 10 passagens. Neste estudo, usamos fibroblastos iPSC-derivado de dois a cinco passagens para posterior análise.

2. a aplicação do hiPSC-derivado de células diferenciadas

  1. Geração de organoides pele 3D
    1. Preparar neutralizado tipo eu colágeno no gelo, seguindo as recomendações do fabricante. Como a concentração final, use 3 mg/mL de colágeno tipo I (concentração das ações de tipo I colágeno é 3,47 mg/mL) e certifique-se que o volume final da mistura é de 5 mL. Calcular o volume de 10 x PBS (volume final/10 = 0,5 mL). Calcular o volume de colágeno a ser usado tipo I (volume final x concentração de colágeno final / estoque de concentração de colágeno = 5 mL x 3 mg / mL / 3,47 mg / mL = 4,32 mL). Calcular o volume de 1 N de NaOH (volume de colágeno deve ser usado x 0,023 mL = 0,1 mL). Calcular o volume de dH2O (volume do volume final - volume de colágeno - de 10 x PBS - volume de 1 NaOH N = 5 mL - 4,32 mL-0,5 mL 0,1 mL = 0,08 mL). Misturar o conteúdo do tubo e mantê-lo no gelo até estar pronto para usar.
    2. Adicionar 1 mL de EDTA para os fibroblastos iPSC-derivado da etapa 1.4.10 e incubar a 37 ° C com 5% de CO2 por 2 min. colher as células desanexadas, contar as células usando um hemocytometer e 2 x 105 células de transferência para um novo tubo cônico de 15 mL. Centrifugar a 250 x g por 2 min e retirar o sobrenadante. Ressuspender as células de fibroblastos derivados de iPSC em 1,5 mL de FDM1 e neutralizou o tipo eu solução de colágeno (1:1).
      Nota: Misture a solução com cuidado para evitar bolhas.
    3. Coloque a inserção da membrana em uma 6-poços microplacas, transfira a mistura para a inserção e incubar a RT por 30 min.
      Nota: Não mova as placas.
    4. Depois de confirmar a gelificação, adicione 2 mL do meio para o topo da inserção e 3 mL para o fundo do poço. Incube a matriz de fibroblastos e colágeno a 37 ° C com 5% CO2 por 5-7 dias, até a gelificação é completa e não mais contratos.
    5. Após a gelificação completa, desanexar os queratinócitos iPSC-derivado (da etapa 1.3.6) usando EDTA. Adicione 1 mL de EDTA e incubar a 37 ° C com 5% de CO2 por 2 min. colher as células desanexadas, contá-los usando um hemocytometer e 1 x 106 células de transferência para um novo tubo cônico de 15 mL. Centrifugar a 250 x g por 2 min.
    6. Remover o sobrenadante e ressuspender 1 x 106 células em 50-100 µ l de meio epitelial de baixo cálcio 1 (EP1).
    7. Aspire todos médio na matriz (veja a etapa 2.1.5) e 1 x 106 células de queratinócitos em cada camada de fibroblastos iPSC-derivado de sementes. Incube a placa a 37 ° C com 5% de CO2 por 30 min.
      Nota: Não mova a placa e não adicionar qualquer meio de penhora de queratinócitos.
    8. Adicione 2 mL de EP1 para o topo da inserção e 3 mL de EP1 para o fundo do poço.
    9. Depois de 2 dias, aspirar todos meio em placa de inserção de membrana e mudar o meio de cálcio normal EP2 para 2 dias.
    10. Depois de 2 dias, aspirar todos médio e adicionar 3 mL do meio de cornificação somente a parte inferior para gerar uma interface ar-líquido.
    11. Manter a pele 3D organoides por até 14 dias a 37 ° C com 5% de CO2 e mudar o meio de todos os outros dias. Colha a pele 3D organoides cortando a borda de inserção e usá-lo para um estudo adicional de coloração e enxerto de pele.
  2. Enxerto de pele
    1. Realizar a anestesia por inalação em camundongos NOD/scid (masculinos, 6 semanas de idade), usando um método padrão, aprovado institucionalmente. Para enxerto de pele, raspe o pelo da pele dorsal de cada rato.
    2. Remova uma seção 1 x 2 cm da pele do rato, usando tesouras curvas com fórceps.
    3. Coloque os organoides CBMC-iPSC-derivado de pele 3D para o local do defeito e sutura usando um método de gravata-sobre curativo com suturas de seda.
    4. Observar os ratos por 2 semanas e sacrificá-los para análise histológica. O protocolo de coloração foi verificado em anteriores estudos16.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Pele é composta, na maior parte, a epiderme e a derme. Os queratinócitos são o tipo principal de células da epiderme, e fibroblastos são o tipo de célula principal da derme. O esquema de diferenciação queratinócito é mostrado na Figura 1A. CBMC-iPCSc foram mantidos em um prato vitronectina-revestido (Figura 1B). Neste estudo, nós diferenciados CBMC-iPSCs em queratinócitos e fibroblastos usando formação EB. Geramos EBs usando o enforcamento cair método para garantir uma uniforme e controlada de diferenciação dos queratinócitos e fibroblastos (Figura 1C). EBs foram anexados para o tipo de placas com revestimento em colagénio IV para diferenciação de queratinócitos, e o meio foi alterado diariamente. CBMC-iPSCs foram tratados com RA, BMP4 e EGF. CBMC-iPSCs foram diferenciadas de queratinócitos. Durante a diferenciação, a morfologia dos queratinócitos CBMC-iPSC-derivado mudou ao longo do tempo (complementar a Figura 1).

CBMC-iPSC-derivadas de queratinócitos têm morfologias semelhantes a queratinócitos primários (Figura 1D). A expressão do gene do marcador pluripotentes OCT4 foi ativador em queratinócitos CBMC-iPSC-derivado. Sequências da primeira demão são mostradas na tabela 1. A expressão de marcadores de queratinócitos Np63, KRT5 e KRT14 foi aumentada em queratinócitos CBMC-iPSC-derivado (Figura 1-F). CBMC-iPSC-derivadas de queratinócitos foram confirmados pela expressão de Np63 e KRT14 por imuno-histoquímica (Figura 1E). Estes resultados confirmaram que os queratinócitos CBMC-iPSC-derivado as características dos queratinócitos primários.

O esquema de diferenciação de fibroblastos é mostrado na Figura 2. Nós também mantido CBMC-iPSCs em um prato vitronectina-revestido e usado formação EB para diferenciação de fibroblastos (Figura 2B, C). Nós anexados a EBs placas com revestimento em matriz da membrana basal e mudou o meio de todos os outros dias. Células de consequência foram transferidas para noncoated e placas com revestimento em colágeno do tipo I. CBMC-iPSCs foram diferenciadas de fibroblastos. Durante a diferenciação, a morfologia dos fibroblastos CBMC-iPSC-derivado mudou ao longo do tempo (complementar a Figura 2).

CBMC-iPSC-derivado de fibroblastos têm morfologias semelhantes a fibroblastos primários (Figura 2D). A expressão do marcador de células-tronco pluripotentes OCT4 foi ativador em fibroblastos CBMC-iPSC-derivado. Marcadores de fibroblasto de COL1A1 e COL1A2, COL3A1 e CD44 foram upregulated em fibroblastos CBMC-iPSC-derivado (Figura 2-F). Sequências da primeira demão são mostradas na tabela 1. Também, fibroblastos CBMC-iPSC derivados foram confirmados pela expressão de vimentina e fibronectina por imuno-histoquímica(Figura 2). Estes resultados sugerem que a CBMC-iPSC-derivado de fibroblastos são semelhantes aos fibroblastos primários.

Geramos um organoides pele 3D usando o CBMC-iPSC-derivadas de queratinócitos e fibroblastos. O esquema de formação de organoides a pele 3D é mostrado na Figura 3. Geramos um organoides pele 3D em uma placa de inserção de membrana. Para a cultura 3D, fibroblastos CBMC-iPSC derivados foram estratificadas com tipo eu colágeno e sobrepostos com queratinócitos CBMC-iPSC-derivado. Após a semeadura os queratinócitos CBMC-iPSC-derivado, o meio foi alterado para uma concentração de cálcio normal por 2 dias. Depois de 2 dias, um meio de concentração elevada de cálcio foi adicionado apenas para a câmara baixa para a formação da cultura da interface ar-líquido. A cultura da interface ar-líquido induzido a maturação e estratificação dos queratinócitos. A espessura de organoides a pele 3D foi aumentada durante a cultura 3D. Estes resultados confirmaram que os organoides pele 3D foi gerado a partir de iPSC-derivado de queratinócitos e fibroblastos por hematoxilina e eosina (H & E) coloração (Figura 3C).

Usando a pele 3D CBMC-iPSC-derivado organoides, geramos um modelo de ratos humanizados (Figura 3B) transplantando os organoides pele 3D para os ratos. Foi induzido a um defeito de 1 x 2 cm, e foi utilizado o método de gravata-over para transplante. Depois de 2 semanas, a pele transplantada foi enxertada eficientemente aos ratos, e confirmamos isso por H & E e immunocytochemical análise (Figura 3-D). Maturação de queratinócitos e os marcadores de diferenciação epidérmica de loricrin e KRT14 foram expressos em organoids a pele 3D CBMC-iPSC-derivado (Figura 3E). As CBMC-iPSC-derivado de pele 3D organoids eram funcionalmente diferenciadas, eficientemente enxertados em ratos e efetivamente curado defeitos da pele de ratos.

Figure 1
Figura 1 : Queratinócito diferenciação de CBMC-iPSCs. (A) esquema de diferenciação de queratinócitos do CBMC-iPSCs. (B e C) morfologia do CBMC-iPSCs (painel B) e derivados de iPSC EBs (painel C). (D) a morfologia de queratinócitos CBMC-iPSC-derivado. (E) análise de Immunocytochemical de Np63 (vermelho) e KRT14 (verde), juntamente com DAPI coloração (azul). As barras de escala = 100 μm. (F) a expressão gênica do marcador pluripotentes e queratinócito marcadores de iPSC-derivado de queratinócitos (iPSC-Ks). Os gráficos mostram a média com SEM das cinco amostras independentes. Diferenças entre os grupos foram examinadas para a significância estatística usando o Student t-teste. O t-teste foi aplicado para analisar conjuntos de dados quantitativos não paramétricos e a uni-caudal p-valor foi calculado (*p < 0.05, * *p < 0,01, * * *p < 0,001 indicado significância estatística). Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2 : Diferenciação de fibroblastos de CBMC-iPSCs. (A) esquema de diferenciação de fibroblastos de CBMC-iPSCs. (B e C) morfologia do CBMC-iPSCs (painel B) e derivados de iPSC EBs (painel C). (D) morfologia dos fibroblastos CBMC-iPSC-derivado. (E) análise de Immunocytochemical de vimentina (vermelha) e fibronectina (vermelha), juntamente com DAPI coloração (azul). As barras de escala = 100 μm. (F) a expressão gênica do marcador pluripotentes e marcadores de fibroblasto de iPSC-derivado do fibroblasto (iPSC-Fs). Os gráficos mostram a média com SEM das cinco amostras independentes. Diferenças entre os grupos foram examinadas para a significância estatística usando o Student t-teste. O t-teste foi aplicado para analisar conjuntos de dados quantitativos não paramétricos e a uni-caudal p-valor foi calculado (*p < 0.05, * *p < 0,01, * * *p < 0,001 indicado significância estatística). Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3 : Geração de pele CBMC-iPSC-derivado organoides e modelo de ratos humanizados. (A) diagrama esquemático do processo de geração de iPSC-derivado pele organoides (iSO). (B) transplante processo da iSO em camundongos. (C) a análise histológica da iSO in vitro. (D) a análise histológica da iSO transplantado em vivo. (E-H) Análise de Immunocytochemical de loricrin e KRT14. ZOMBE de controle (painel E) iSO transplantado (painel F, loricrin), pele de camundongos (controlo negativo, painel G), iSO transplantado (painel H, KRT14). As barras de escala = 200 μm. Clique aqui para ver uma versão maior desta figura.

Supplementary Figure 1
Complementar Figura 1: morfologia de iPSC-derivado queratinócitos. Clique aqui para ver uma versão maior desta figura.

Supplementary Figure 2
Complementar Figura 2: morfologia dos fibroblastos derivados de iPSC. Clique aqui para ver uma versão maior desta figura.

Nome de destino Direção Sequência da primeira demão (5' - 3') Tamanho (pares de Base) Refseq_ID
OCT4 Para a frente
Inverter
ACCCCTGGTGCCGTGAA
GGCTGAATACCTTCCCAAATA
190 NM_203289.5
PAX6 Para a frente
Inverter
GTCCATCTTTGCTTGGGAAA
TAGCCAGGTTGCGAAGAACT
110 NM_000280.4
SOX1 Para a frente
Inverter
CACAACTCGGAGATCAGCAA
GGTACTTGTAATCCGGGTGC
133 NM_005986.2
Np63 Para a frente
Inverter
GGAAAACAATGCCCAGACTC
GTGGAATACGTCCAGGTGGC
294 NM_001114982.1
KRT5 Para a frente
Inverter
ACCGTTCCTGGGTAACAGAGCCAC
GCGGGAGACAGACGGGGTGATG
198 NM_000424.3
KRT14 Para a frente
Inverter
GCAGTCATCCAGAGATGTGACC
GGGATCTTCCAGTGGGATCT
181 NM_000526.4
CD44 Para a frente
Inverter
AAGGTGGAGCAAACACAACC
AGCTTTTTCTTCTGCCCACA
151 NM_001202556.1
COL1A1 Para a frente
Inverter
CCCCTGGAAAGAATGGAGATG
TCCAAACCACTGAAACCTCTG
148 NM_000088.3
COL1A2 Para a frente
Inverter
GGATGAGGAGACTGGCAACC
TGCCCTCAGCAACAAGTTCA
77 NM_000089.3
COL3A1 Para a frente
Inverter
CGCCCTCCTAATGGTCAAGG
TTCTGAGGACCAGTAGGGCA
161 NM_000090.3
Vimentina Para a frente
Inverter
GAGAACTTTGCCGTTGAAGC
TCCAGCAGCTTCCTGTAGGT
170 NM_003380.5
GAPDH Para a frente
Inverter
ACCCACTCCTCCACCTTTGA
CTGTTGCTGTAGCCAAATTCGT
110 NM_002046.5

Tabela 1: Sequências de primers utilizados para reação em cadeia da polimerase em tempo real quantitativa.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

IPSCs humanas têm sido sugeridos como uma nova alternativa para a medicina regenerativa personalizada17. IPSCs personalizados derivado de paciente refletem características de paciente que podem ser usadas para modelagem de doença, triagem de drogas e transplante autólogo18,19. O uso de derivados de paciente iPSCs também pode superar problemas relativos as células primárias, a falta de números de celular adequada e reações imunes5,17,19. No entanto, a geração de iPSCs personalizado não é economicamente viável devido ao tempo, custo e restrições de trabalho. HLA-homozigotos CBMC-derivado iPSCs têm emergido como uma nova possibilidade. IPSCs HLA-homozigotos pode ser economicamente valioso e pode ser aplicado a um grande número de pacientes8,11,12,13. Além disso, tipagem de HLA de CBMCs ocorre durante o armazenamento de banco de célula, tornando-os assim fácil de usar para transplantação e investigação. Protocolos para diferenciar CBMC-iPSCs em cardiomyocytes, hepatócitos, condrócitos e têm sido relatados16,20,21,22,23.

Camadas epidérmicas e dérmicas são componentes da pele. Consiste em queratinócitos da epiderme e a derme é composta de fibroblastos. Então, nós diferenciados CBMC-iPSCs em queratinócitos e fibroblastos, respectivamente. A diferenciação, uniformizados, bem controlados e otimizados EBs foram gerados pelo enforcamento cair método15,24. Colágeno do tipo IV é um componente importante da membrana do porão. Para diferenciação de queratinócitos, EBs foram anexados para o tipo de pratos de colágeno-revestido de IV. CBMC-iPSC-derivadas de queratinócitos tinham uma paralelepípedo, como morfologia (Figura 1D). Queratinócito marcadores Np63 e KRT14 foram expressos em iPSC-Ks (Figura 1E, F). Que resultado confirmou que o RA e BMP4 induziram o upregulation dos marcadores de queratinócitos. Além disso, CBMC-iPSCs foram diferenciadas em queratinócitos semelhantes ao primários queratinócitos.

Para diferenciação de fibroblastos, EBs foram anexadas a membrana basal matriz-revestido de placas, e as células diferenciadas em série foram passadas para o noncoated e placas com revestimento em colágeno do tipo I. Uma subcultura serial foi induzida a especificar a diferenciação de fibroblastos. Fibroblastos produziram uma matriz extracelular (ECM) que tinha funções de migração e adesão. Fibroblastos também produzem colágeno abundante componentes25. Em fibroblastos CBMC-iPSC-derivado, o marcador de superfície de fibroblasto CD44 foi aumentado. A expressão do colágeno foi upregulated em iPSC-Fs (Figura 2-F). A expressão da fibronectina e vimentina foi aumentada em iPSC-Fs(Figura 2).

Usando o diferenciada de queratinócitos e fibroblastos, geramos organoids pele CBMC-iPSC-derivado(Figura 3). Nós usamos uma cultura da interface ar-líquido com um meio de alto-cálcio que induzido por camadas estratificadas de pele CBMC-iPSC-derivado organoids. A alta concentração de cálcio era necessária para a maturação de queratinócitos in vivo e in vitro, enquanto a interface ar-líquido foi usada para desenvolver várias camadas de estratos de27,26,28. Nós usamos este método para imitar a análise real da pele e histológica mostrou que a pele foi estratificada (Figura 3C). Para confirmar a capacidade de cicatrização de feridas, nós transplantado o iSO da pele de ratos, usando o método curativo de gravata-sobre (Figura 3-D). Após transplante, organoids a pele eficientemente foram enxertados e curado da pele de ratos adequadamente. KRT14 foi expressa na camada basal do epitélio escamoso e nonsquamous de estratificação. Loricrin é um componente principal do estrato córneo encontrado no terminal diferenciadas e marginalizadas células epiteliais29,30. O marcador de diferenciação epidérmica de loricrin foi expressa na pele transplantada. A expressão do KRT14 e loricrin confirmou que a pele organoides foi totalmente maduro, e diferenciação foi demonstrada por imuno-histoquímica coloração (Figura 3E).

Neste estudo, nós desenvolvemos um protocolo para diferenciar CBMC-iPSCs em queratinócitos e fibroblastos, os tipos de células principais da pele humana. Confirmamos que o CBMC-iPSC-derivadas de queratinócitos e fibroblastos mostraram fenótipos similares às linhas de célula primária. Usando essas células diferenciadas, geramos uma pele 3D organoides e é enxertado em camundongos NOD/scid, usando o método de gravata-sobre vestir. Esta técnica original foi descrita primeiramente em 1929 por Blair e Brown e foi comumente usada para enxerto de pele31,32. Esse método impede que o enxerto movendo-se, favoreceu uma boa aderência à ferida e assim acelerou a cicatrização tecidual. A análise histológica confirmou que a pele 3D organoides imitam um fenótipo de pele humana que com êxito estratificada e amadureceu durante 2 semanas. Enxerto de pele é geralmente executado usando células únicas de queratinócitos e fibroblastos por silício câmara de bolha33,34. Este sistema é fácil de enxerto, mas precisávamos de mais tempo para observada a eficiência de transplante após enxerto. A câmara de plástico ou silicone funciona como uma barreira contra a pele de ratos. As pele 3D organoides derivado sistema iPSCs não usar uma câmara de plástico ou silicone. Neste sistema, o transplante foi eficiente; no entanto, foi difícil bloquear o processo natural de cura de ratos. Então, pele dos ratos coberto muitas partes da iSO por um longo tempo após o transplante. Esta é uma parte do método apresentado aqui que deve ser melhorado.

Em conclusão, CBMC-iPSCs são uma fonte potencial de célula para enxertos de pele. Usando esses protocolos, CBMC-iPSC-derivadas de queratinócitos, fibroblastos e uma pele 3D organoides podem ser usado em estudos relacionados à dermatologia, drogas e cosmética triagem e medicina regenerativa.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada para divulgar.

Acknowledgments

Este trabalho foi financiado por um subsídio da Coreia saúde tecnologia R & D projeto, Ministério da saúde, bem-estar e assuntos de família, República da Coreia (H16C2177, H18C1178).

Materials

Name Company Catalog Number Comments
Adenine Sigma A2786 Component of differentiation medium for fibroblast
AggreWell Medium (EB formation medium) STEMCELL 05893 EB formation
Anti-Fibronectin antibody abcam ab23750 Fibroblast marker
Anti-KRT14 antibody abcam ab7800 Keratinocyte marker
Anti-Loricrin antibody abcam ab85679 Stratum corneum marker
Anti-p63 antibody abcam ab124762 Keratinocyte marker
Anti-Vimentin antibody Santa cruz sc-7558 Fibroblast marker
BAND AID FLEXIBLE FABRIC Johnson & Johnson - Bandage
Basement membrane matrix (Matrigel) BD 354277 Component of differentiation medium for fibroblast
BLACK SILK suture AILEEE SK617 Skin graft
CaCl2 Sigma C5670 Component of epithelial medium for 3D skin organoid
Collagen type I BD 354236 3D skin organoid
Collagen type IV Santa-cruz sc-29010 Component of differentiation medium for keratinocyte
Defined keratinocyte-Serum Free Medium Gibco 10744-019 Component of differentiation medium for keratinocyte
DMEM, high glucose Gibco 11995065 Component of differentiation medium
DMEM/F12 Medium Gibco 11330-032 Component of differentiation medium
Essential 8 medium Gibco A1517001 iPSC medium
FBS, Qualified Corning 35-015-CV Component of differentiation medium for fibroblast and keratinocyte
Glutamax Supplement  Gibco 35050061 Component of differentiation medium for fibroblast
Insulin Invtrogen 12585-014 Component of differentiation medium for fibroblast and keratinocyte
Iris standard curved scissor Professional PC-02.10 Surgical instrument
Keratinocyte Serum Free Medium Gibco 17005-042 Component of differentiation medium for keratinocyte
L-ascorbic acid 2-phosphata sesquimagnesium salt hydrate Sigma A8960 Component of differentiation medium for keratinocyte
MEM Non-Essential Amino Acid Gibco 1140050 Component of differentiation medium for fibroblast
Meriam Forceps Thumb 16 cm HIROSE HC 2265-1 Surgical instrument
NOD.CB17-Prkdc SCID/J The Jackson Laboratory 001303 Mice strain for skin graft
Petri dish 90 mm Hyundai Micro H10090 Plastic ware
Recombinant Human BMP-4 R&D 314-BP Component of differentiation medium for keratinocyte
Recombinant human EGF protein R&D 236-EG Component of differentiation medium for keratinocyte
Retinoic acid Sigma R2625 Component of differentiation medium for keratinocyte
T/C Petridish 100 mm, 240/bx TPP 93100 Plastic ware
Transferrin Sigma T3705 Component of epithelial medium for 3D skin organoid
Transwell-COL collagen-coated membrane inserts  Corning CLS3492 Plastic ware for 3D skin organoid 
Vitronectin Life technologies A14700 iPSC culture
Y-27632 Dihydrochloride peprotech 1293823 iPSC culture

DOWNLOAD MATERIALS LIST

References

  1. Vincent, J. F., Bogatyreva, O. A., Bogatyrev, N. R., Bowyer, A., Pahl, A. K. Biomimetics: its practice and theory. Journal of The Royal Society Interface. 3, (9), 471-482 (2006).
  2. Madison, K. C. Barrier function of the skin: "la raison d'etre" of the epidermis. Journal of Investigative Dermatology. 121, (2), 231-241 (2003).
  3. Chen, M., Przyborowski, M., Berthiaume, F. Stem cells for skin tissue engineering and wound healing. Critical Reviews in Biomedical Engineering. 37, (4-5), 399-421 (2009).
  4. Dixit, S., et al. Immunological challenges associated with artificial skin grafts: available solutions and stem cells in future design of synthetic skin. Journal of Biological Engineering. 11, 49 (2017).
  5. Yamanaka, S. Induced pluripotent stem cells: past, present, and future. Cell Stem Cell. 10, (6), 678-684 (2012).
  6. Yamanaka, S. Pluripotency and nuclear reprogramming. Philosophical Transactions of the Royal Society B: Biological Sciences. 363, (1500), 2079-2087 (2008).
  7. Scheiner, Z. S., Talib, S., Feigal, E. G. The potential for immunogenicity of autologous induced pluripotent stem cell-derived therapies. Journal of Biological Chemistry. 289, (8), 4571-4577 (2014).
  8. Zimmermann, A., Preynat-Seauve, O., Tiercy, J. M., Krause, K. H., Villard, J. Haplotype-based banking of human pluripotent stem cells for transplantation: potential and limitations. Stem Cells and Development. 21, (13), 2364-2373 (2012).
  9. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, (4), 663-676 (2006).
  10. Terasaki, P. I. A brief history of HLA. Immunologic Research. 38, (1-3), 139-148 (2007).
  11. Haase, A., et al. Generation of induced pluripotent stem cells from human cord blood. Cell Stem Cell. 5, (4), 434-441 (2009).
  12. Rim, Y. A., et al. Recent progress of national banking project on homozygous HLA-typed induced pluripotent stem cells in South Korea. Journal of Tissue Engineering and Regenerative Medicine. 12, (3), 1531-1536 (2018).
  13. Nakatsuji, N., Nakajima, F., Tokunaga, K. HLA-haplotype banking and iPS cells. Nature Biotechnology. 26, (7), 739-740 (2008).
  14. Pappas, D. J., et al. Proceedings: human leukocyte antigen haplo-homozygous induced pluripotent stem cell haplobank modeled after the california population: evaluating matching in a multiethnic and admixed population. Stem Cells Translational Medicine. 4, (5), 413-418 (2015).
  15. Lin, Y., Chen, G. Embryoid body formation from human pluripotent stem cells in chemically defined E8 media. StemBook. Available from: https://www.stembook.org/node/6632 (2008).
  16. Kim, Y., et al. Establishment of a complex skin structure via layered co-culture of keratinocytes and fibroblasts derived from induced pluripotent stem cells. Stem Cell Research & Therapy. 9, (1), 217 (2018).
  17. Diecke, S., Jung, S. M., Lee, J., Ju, J. H. Recent technological updates and clinical applications of induced pluripotent stem cells. The Korean Journal of Internal Medicine. 29, (5), 547-557 (2014).
  18. Shi, Y., Inoue, H., Wu, J. C., Yamanaka, S. Induced pluripotent stem cell technology: a decade of progress. Nature Reviews Drug Discovery. 16, (2), 115-130 (2017).
  19. Yoshida, Y., Yamanaka, S. Recent stem cell advances: induced pluripotent stem cells for disease modeling and stem cell-based regeneration. Circulation. 122, (1), 80-87 (2010).
  20. Pham, T. L., Nguyen, T. T., Van Bui, A., Nguyen, M. T., Van Pham, P. Fetal heart extract facilitates the differentiation of human umbilical cord blood-derived mesenchymal stem cells into heart muscle precursor cells. Cytotechnology. 68, (4), 645-658 (2016).
  21. Stecklum, M., et al. Cell differentiation mediated by co-culture of human umbilical cord blood stem cells with murine hepatic cells. In Vitro Cellular & Developmental Biology - Animal. 51, (2), 183-191 (2015).
  22. Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. Journal of Visualized Experiments. (124), e55988 (2017).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Application of Cord Blood and Cord Blood-derived Induced Pluripotent Stem Cells for Cartilage Regeneration. Cell Transplantation. (2018).
  24. Shevde, N. K., Mael, A. A. Techniques in embryoid body formation from human pluripotent stem cells. Methods in Molecular Biology. 946, 535-546 (2013).
  25. Shamis, Y., et al. iPSC-derived fibroblasts demonstrate augmented production and assembly of extracellular matrix proteins. In Vitro Cellular & Developmental Biology - Animal. 48, (2), 112-122 (2012).
  26. Bikle, D. D., Xie, Z., Tu, C. L. Calcium regulation of keratinocyte differentiation. Expert Review of Endocrinology & Metabolism. 7, (4), 461-472 (2012).
  27. Bernstam, L. I., Vaughan, F. L., Bernstein, I. A. Keratinocytes grown at the air-liquid interface. In Vitro Cellular & Developmental Biology. 22, (12), 695-705 (1986).
  28. Prunieras, M., Regnier, M., Woodley, D. Methods for cultivation of keratinocytes with an air-liquid interface. Journal of Investigative Dermatology. 81, 1 Suppl 28-33 (1983).
  29. Steven, A. C., Bisher, M. E., Roop, D. R., Steinert, P. M. Biosynthetic pathways of filaggrin and loricrin--two major proteins expressed by terminally differentiated epidermal keratinocytes. Journal of Structural Biology. 104, (1-3), 150-162 (1990).
  30. Hohl, D., et al. Characterization of human loricrin. Structure and function of a new class of epidermal cell envelope proteins. Journal of Biological Chemistry. 266, (10), 6626-6636 (1991).
  31. Bern, R., et al. Original and modified technique of tie-over dressing: Method and application in burn patients. Burns. 44, (5), 1357-1360 (2018).
  32. Joyce, C. W., Joyce, K. M., Kennedy, A. M., Kelly, J. L. The Running Barbed Tie-over Dressing. Plastic and Reconstructive Surgery - Global Open. 2, (4), 137 (2014).
  33. Wang, C. K., Nelson, C. F., Brinkman, A. M., Miller, A. C., Hoeffler, W. K. Spontaneous cell sorting of fibroblasts and keratinocytes creates an organotypic human skin equivalent. Journal of Investigative Dermatology. 114, (4), 674-680 (2000).
  34. Yang, R., et al. Generation of folliculogenic human epithelial stem cells from induced pluripotent stem cells. Nature Communications. 5, 3071 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics