Author Produced

Detección de la actividad de retrotransposición de Hot LINE-1 por PCR inverso de larga distancia

Cancer Research
 

Summary

En este artículo se describe un simple ensayo basado en PCR para supervisar la actividad de un retrotransposon activo LINE-1 y para mapear retrotransposiciones de novo en un genoma determinado. Usando la línea celular MCF7, demostramos aquí cómo este método se puede aplicar para detectar la actividad de un LINE-1 ubicado en 22q12.1.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Pradhan, B., Kauppi, L. Detection of Retrotransposition Activity of Hot LINE-1s by Long-Distance Inverse PCR. J. Vis. Exp. (149), e59880, doi:10.3791/59880 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Los elementos nucleares intercalados largos 1 (LINE-1) son la única familia de elementos genéticos móviles en el genoma humano que pueden moverse de forma autónoma. Lo hacen mediante un proceso llamado retrotransposición en el que transcriben para formar un arnm intermedio que, por consiguiente, se inserta en el genoma mediante transcripción inversa. A pesar de estar en silencio en las células normales, los LINE-1 son muy activos en diferentes tumores epiteliales. De novo Las inserciones de LINE-1 pueden conducir potencialmente la tumorigenesis, y por lo tanto es importante estudiar sistemáticamente la retrotransposición de LINE-1 en el cáncer. De los 150 LINE-1 de retrotransposición competentes presentes en el genoma humano, sólo un puñado de loci LINE-1, también conocidos como LINE-1 "calientes", representan la mayoría de la inserción de novo LINE-1 en diferentes tipos de cáncer. Hemos desarrollado un método simple basado en la reacción en cadena de la polimerasa (PCR) para monitorear la actividad de retrotransposición de estos LINE-1 calientes. Este método, basado en inversa de larga distancia (LDI)-PCR, aprovecha la transducción de 3o, un mecanismo mediante el cual un LINE-1 moviliza su región no repetitiva de flanqueo, que posteriormente se puede utilizar para identificar eventos de transducción de novo LINE-1 3 derivado de un caliente particular LINE-1.

Introduction

Los elementos nucleares intercalados largos (LINE-1) son una familia de elementos genéticos móviles llamados retrotransposons que pueden moverse independientemente de un lugar a otro a través de un mecanismo de copiar y pegar llamado retrotransposición. En el tiempo evolutivo, el genoma humano ha acumulado más de 500.000 copias de repeticiones de LINE-11. Sin embargo, la mayoría de las copias de LINE-1 presentes en el genoma están mutadas y, por lo tanto, no pueden moverse a través de la retrotransposición; sólo 150 copias tienen copia intacta de la secuencia de ADN necesaria para que se muevan2. En las células somáticas normales, la movilidad de estos LINE-1 sin restricciones por diferentes factores de host3. Estas restricciones se alivian en diferentes tumores epiteliales, causando LINE-1s a ser deprimido y dando lugar a muchas inserciones de novo en el genoma del tumor4. Se ha demostrado que algunas de estas inserciones de novo asociadas a tumores causan mutagénesis insercional en genes, lo que impulsa la progresión tumoral 5,6. Por lo tanto, es importante poder mapear inserciones novedosas en el genoma tumoral.

Los métodos existentes para detectar inserciones de novo LINE-1 utilizan (1) enfoque de secuenciación del genoma completo4,7,8, donde se utilizan diferentes algoritmos computacionales para encontrar inserciones de novo LINE-1 de los datos de WGS, o (2) secuenciación de próxima generación que se dirige al extremo de 3o de los jóvenes, potencialmente activos LINE-1s9,10,11,12,13. Sin embargo, encontrar inserciones novedosas entre varios miles de copias casi idénticas con estos métodos dista mucho de ser trivial, y el desafío se agrava aún más por la heterogeneidad tumoral y las alteraciones genómicas asociadas con la inserción LINE-14.

Los estudios que utilizan estos métodos existentes mostraron que sólo unos pocos LINE-1 representan la mayoría de las inserciones de novo LINE-1 observadas en tumores7,8. Por lo tanto, para responder si una muestra de tumor en particular muestra o no la actividad de LINE-1, basta con mapear eventos de retrotransposición causados por este puñado de loci LINE-1 altamente activos. En este artículo, describimos un método simple basado en la reacción en cadena de la polimerasa (PCR)14 que se puede utilizar para monitorear la actividad de un locus LINE-1 en particular en el primer intrón del gen TTC28 a 22q12.1 que es altamente activo en el cáncer colorrectal 7 , 8. Este locus LINE-1 se denominará TTC28-LINE-1 a lo largo del artículo. Este ensayo identifica específicamente los eventos de retroposición de novo LINE-1 que movilizan la secuencia no repetitiva en la región de 3o de la fuente LINE-1 por un mecanismo llamado transducción de 3o15. La transducción de 3 o se produce debido a la débil señal de poliadenilación LINE-1 (PAS) que hace que la maquinaria transcripcional la salte y termine en su lugar la transcripción en el PAS más fuerte aguas abajo, capturando así la secuencia no repetitiva de flanqueo ( a partir de ahora se conoce como la "etiqueta única") que luego se inserta en la ubicación de destino junto con la secuencia LINE-1. 16 demostraron recientemente que diferentes tipos de células pueden expresar diferentes loci LINE-1. A la luz de este hallazgo, este método se puede aplicar para monitorear la actividad de la LINE-1 más expresada que movilice su etiqueta única en el tipo de cáncer de interés.

El primer paso en LDI-PCR es la digestión del ADN genómico con una enzima de restricción que genera un fragmento de restricción que contiene el LINE-1 que se está ensayando (aquí, TTC28-LINE-1) y su etiqueta única (Figura1). El ADN digerido se transforma entonces mediante auto-ligación y PCR amplificado usando imprimaciones inversas ubicadas dentro de la etiqueta única. Al hacerlo, la fuente de longitud completa LINE-1 en su ubicación "nativa" siempre se amplifica y junto a ella, las inserciones LINE-1 de descendencia en diferentes loci de destino que contienen la etiqueta única también se amplificarán (Figura1), informando así retrotransposición de la LINE-1 en cuestión.

Protocol

Esta investigación fue aprobada por la Junta de Revisión Institucional y el comité de ética del Hospital Universitario de Helsinki. Se obtuvo el consentimiento informado firmado del sujeto para la muestra de sangre utilizada para demostrar este protocolo.

1. Diseñar imprimaciones inversas y seleccionar enzimas de restricción (bioinformática)

  1. Determinación de una etiqueta única asociada a LINE-1
    1. Descargue la secuencia TTC28-LINE-1 en formato FASTA desde una base de datos LINE-1 como L1Base17. El ID de la base L1 para TTC28-LINE-1 es 135.
    2. Incluya una secuencia de 5 kb que flanquee los extremos de 5o y 3o de la secuencia LINE-1 y anote en un procesador de textos.
      NOTA: Aquí la secuencia de flanqueo LINE-1 se anota en fuentemarrón, y la secuencia LINE-1 está en fuente gris (Archivo suplementario).
    3. Introduzca una secuencia descendente de 1 kb del PAS cognado de LINE-1 seleccionado en una herramienta de predicción PAS como polyadq18 o Dragon PolyA spotter19 y anote toda la señal de poliadenilación en esta ventana de 1 kb.
      NOTA: Si no hay PAS en la ventana de 1 kb, busque PAS en la siguiente ventana de 1 kb aguas abajo. El propio PAS débil de TTC28-LINE-1 se resalta en rosa y todos los demás PAS en la ventana de 1 kb aguas abajo se resaltan en rojo (Archivo suplementario).
    4. Anote la secuencia entre el final del PAS cognado de LINE-1 y el PAS más fuerte aguas abajo como "etiqueta única".
      NOTA: La "etiqueta única" de TTC28-LINE-1se resalta en amarillo (Archivo suplementario).
  2. Diseño de imprimaciones inversas
    1. Diseñe imprimadores de PCR inversos introduciendo la secuencia de "etiqueta única" en una herramienta de diseño de imprimación basada en web como Primer 3 (http://bioinfo.ut.ee/primer3-0.4.0/) o primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) de NCBI. Puesto que los pares de imprimación diseñados por estas herramientas se enfrentan entre sí facilitando la PCR convencional, utilice la función de complemento inverso para el par de imprimación para realizar PCR inverso.
      NOTA: Como las transducciones LINE-1 se truncan en gran medida en su extremo de 5o y el tamaño de la región transducida es muy variable, tienen como objetivo mantener la distancia entre las dos imprimaciones inversas mínimas, estableciendo el parámetro "Longitud del producto PCR" en NCBI primer-BLAST en el Mínimo. En el caso de múltiples PAS dentro de la etiqueta única, diseñe varios pares de imprimación que correspondan a diferentes PAS. Las imprimaciones de diseño cerca del PAS, ya que las inserciones LINE-1 se inician desde el extremo de 3o del ARN intermedio y el extremo de 5o se trunca nablemente. Aquí se diseñaron tres pares de imprimación, resaltados en azulado y verde, correspondientes a tres señales de poliadenilación fuertes en la etiqueta única de TTC28 LINE-1 (ArchivoSuplementario).
  3. Selección de enzimas de restricción
    1. Digerir la secuencia LINE-1 junto con sus flancos ascendentes y descendentes de 5 kb en silico utilizando una herramienta basada en web como RestrictionMapper. Esto dará una lista completa de enzimas de restricción que digiere esta región, generando diferentes fragmentos de restricción.
    2. Seleccione las enzimas de restricción que cortan el locus nativo de LINE-1 de la siguiente manera: en el extremo de 5o, ya sea aguas arriba de la LINE-1 's 5'end o far 5'end de la propia LINE-1, y en el extremo 3,o, aguas abajo de la etiqueta única de la LINE-1.
      NOTA: La enzima de restricción seleccionada debe ser insensible a la metilación del ADN, debe ser inactivable en calor y debe generar extremos "pegajosos" escalonados que sean complementarios entre sí. Con el fin de demostrar LDI-PCR, se utiliza la enzima de restricción SacIque corta el ADN en los sitios GAGCTC, resaltado aquí en verde claro, (Archivo suplementario).
    3. Tome nota del tamaño del fragmento de restricción realizado por las enzimas de restricción seleccionadas. Esto no debe ser más de 12 kb, ya que podría no ser amplificado eficientemente por PCR.

2. Fabricación de plantillas de ADN circulares para PCR inverso de larga distancia

  1. Extracción de ADN y evaluación de la calidad
    1. Extraer ADN genómico de muestras (tumor o sangre) utilizando kits de extracción de ADN disponibles comercialmente que pueden extraer ADN de buena calidad y alto peso molecular necesario para LDI-PCR de acuerdo con las instrucciones del fabricante. Alternativamente, el ADN de alto peso molecular también puede ser extraído por fenol:cloroformo20.
    2. Mida la concentración de ADN utilizando un fluorómetro de acuerdo con las instrucciones del fabricante, y ejecute 100 ng de ADN en un gel de agarosa del 1% (p/v) que contenga bromuro de etidio (0,5 g/ml) en 1 tampón Tris-acetato-EDTA (TAE) a 4,5 V/cm21 junto a la zona de hindIII-hindIII de hindIII Marcadores de peso molecular de ADN para comprobar la calidad y cantidad del ADN.
  2. Digestión del ADN genómico
    1. Hacer una mezcla de reacción de digestión (volumen final de 50 l) añadiendo 20 unidades de enzima de restricción SacI, 5 l de tampón de reacción de 10x (Tablade materiales),100 ng de ADN (hasta 44 l) en un tubo PCR de 0,2 ml en hielo (1 l de enzima de restricción de la mayoría de los fabricantes i s suficiente para digerir completamente 100 ng de ADN genómico). Mezcle la solución moviendo el tubo y centrífuga brevemente.
    2. Utilice un ciclor térmico para incubar la mezcla de reacción a 37 oC durante 1 h, seguido de una inactivación térmica a 65 oC durante 5 min.
  3. Autoligar el ADN genómico digerido
    1. A la mezcla de digestión de 50 l (después del paso 2.2.2), añadir 8 l de tampón de ligasa de ADN 10x T4, 1 l (5 unidades) de ligasa de ADN T4 y 21 l de agua ultrapura para hacer un volumen de reacción final de 80 l. Mezclar la solución moviendo los tubos moviendo los tubos , y centrífuga brevemente.
    2. Incubar en un ciclor térmico a 22oC durante 10 min, terminando con un paso de inactivación térmica a 65oC durante 10 min.

3. PCR inverso de larga distancia

  1. Determinación de la temperatura de recocido de imprimación por PCR gradiente
    1. Establezca un gradiente de temperatura de recocido de (A-4) a C, (A-2) a C, A, (A+2)oC, (A+4) oC, donde A es la temperatura de recocido teórico del par de imprimación calculado utilizando la herramienta basada en la web del proveedor comercial.
      NOTA: Es posible que los ciclos térmicos de algunos fabricantes no permitan ajustar el gradiente de temperatura manualmente. En ese caso, el ajuste de gradiente automático se puede utilizar con un rango de temperatura de (A-4) a (A+4) a C.
    2. Preparar una mezcla maestra para el PCR combinando y mezclando los siguientes componentes en un tubo de microcentrífuga de 1,5 ml: 4 ml de búfer de reacción de 5x, 0,4 ml de 10 mM dNTP, 5 ml de imprimación PCR de 2 m (adelante y marcha atrás, diseñado en el paso 1.3.1) , 0,2 l (0,1 U) de ADN polimerasa por reacción. Configure una reacción para cada temperatura de recocido en el gradiente.
    3. Para cada reacción, la alícuota de 19 ml de la mezcla maestra en tubos PCR de 0,2 ml y añadir 1 l (1,25 ng) de plantilla de ADN circular hecha en la sección 2.
      NOTA: Utilice ADN circular auto-ligado generado a partir del ADN sanguíneo normal como plantilla para evitar consumir ADN tumoral potencialmente precioso para este paso de optimización.
    4. Ejecutar el programa de PCR de gradiente en un ciclor térmico como se describe a continuación: (i) un ciclo de 3 min a 98 oC (desnaturalización); (ii) 35 ciclos de (10 s a 98 oC [desnaturalización], 20 s a la temperatura pendiente de [A-4] a [A+4] a [A+4] a [Annealing] y 1 a 6 min [30 s por kilobase del producto de PCR esperado] a 72 oC [extensión]); (iii) un ciclo de 10 min a 72 oC (extensión final).
    5. Ejecutar 6 l del producto PCR en gel de agarosa al 1%21 preparado en 1 tampón TAE a 4,5 V/cm y analizar los productos de PCR producidos a diferentes temperaturas de recocido.
    6. Seleccione la temperatura de recocido que produce un producto PCR que corresponde al tamaño esperado.
  2. Detección de la actividad de retrotransposición de novo LINE-1 en el genoma tumoral
    1. Realice LDI-PCR utilizando el par de imprimación PCR inverso en plantillas de ADN circular generadas a partir de muestras de tumores (sección 2). Siga las mismas instrucciones que para el GRADIENT e PCR (sección 3.1), pero esta vez reemplazando el gradiente de temperatura por la temperatura de recocido óptima.
    2. Analizar los productos de PCR mediante electroforesis de gel de agarosa como se hace en el paso 3.1.5. El producto PCR de tamaño conocido o el producto PCR "nativo" correspondiente a la LINE-1 en su locus nativo debe ser visible para cada reacción. De novo La transducción de LINE-1 3 en la muestra tumoral ensayada es detectable como productos de PCR de diferentes tamaños, junto con el producto PCR nativo en el gel de agarosa.

4. Secuenciación de productos LDI-PCR para revelar la identidad de los sitios de destino para la transducción de LINE-1 3

  1. Realizar la secuenciación de lectura larga de una sola molécula de todos los amplicons PCR generados en cada reacción LDI-PCR para identificar los sitios de integración objetivo de estos eventos de transducción LINE-1 3.
    NOTA: La clonación y la secuenciación de Sanger de los productos LDI-PCR también es un enfoque posible, aunque engorroso.
  2. Alinee las lecturas producidas por las plataformas de secuenciación de lectura larga de una sola molécula con el genoma de referencia utilizando tuberías de alineación de secuencia estándar. Analice las lecturas alineadas utilizando el software LDI-PCR14 para identificar las inserciones de novo LINE-1 y sus sitios de destino.

Representative Results

En el caso de TTC28-LINE-1, hay más de un PAS dentro de una ventana de 1 kb aguas abajo de su PAS cognado, por lo tanto la región entre el TTC28-LINE-1 PAS y el PAS más fuerte a 811 bp aguas abajo fue considerada como la etiqueta única para TTC28-LINE-1. Tres pares de imprimación PCR inversos fueron diseñados en esta etiqueta única que corresponden a diferentes PAS presentes14. Seleccionamos tres enzimas de restricción: (i) NsiI que corta 5o aguas arriba de TTC28-LINE-1 y 3' fuera de la etiqueta única, y (ii) SacI y (iii) PstI que cortan 5 ' dentro de la LINE-1 en su extremo lejano de 5 ', y 3 ' fuera de la etiqueta única. Estos generan fragmentos de restricción de 10,288 bp, 5,699 bp, y 6,305 bp respectivamente.

Para demostrar este método, realizamos LDI-PCR en ADN extraído de la línea celular MCF7. Esta línea celular de cáncer de mama se ha informado previamente para mostrar TTC28-LINE-1 actividad16. Para simplificar, hicimos una plantilla de ADN circular usando una enzima de restricción, SacI, de tres y realizamos un LDI-PCR usando un par de imprimación de tres (Tabla 1) para detectar inserciones de novo LINE-1 derivadas de TTC28- LÍNEA-1.

La buena calidad del ADN extraído de la línea celular MCF7 se aseguró mediante la electroforesis de gel de agarosa (Figura2). El ADN intacto de alto peso molecular muestra que el ADN genómico es de óptima calidad para este ensayo. Si un frotis es visible en su lugar, esto indica mala calidad del ADN extraído, lo que a su vez obstaculizará los procedimientos posteriores.

La Figura 3 muestra un resultado representativo de un experimento de PCR de gradiente, destinado a determinar la temperatura de recocido óptima del par de imprimación inversa TTC28-LINE-1. Para esta reacción se utilizó ADN genómico de sangre digerido con SacI, seguido de la autoligación para formar una plantilla circular de ADN. Un producto pcR muy específico de tamaño esperado (5.649 bp) a 62, 64 y 66 oC muestra que la temperatura de recocido óptima para este par de imprimación se encuentra dentro del rango de 62 a 66 oC.

Generamos una plantilla de ADN circular digiriendo el ADN genómico MCF7 con la enzima de restricción SacI seguida de la auto-ligación. La Figura 4 muestra que la transducción TTC28-LINE-1 3 se produce en las líneas celulares MCF7: las inserciones de novo se pueden detectar como productos LDI-PCR de diferentes tamaños junto con un producto PCR nativo de tamaño conocido (5.649 bp). Para identificar las coordenadas genómicas de los sitios de destino de novo, se pueden secuenciar los amplicons de PCR (ver sección 4 del protocolo).

Figure 1
Figura 1 : Visión general de LDI-PCR para detectar la transducción de LINE-1 3. Una plantilla de ADN circular se genera digiriendo primero (I) con una enzima de restricción y autoligadora (II) la genera. Este paso es seguido por PCR inverso (III) con imprimaciones de PCR inversas dirigidas a la etiqueta única de la LINE-1 de interés (secuencia entre el propio PAS más débil de LINE-1, en rosa, y PAS más fuerte aguas abajo, en rojo). Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2 : Evaluación de la calidad del ADN extraído. 100 ng de ADN extraído de la línea celular MCF7 y sangre de un individuo normal, que se utilizará como muestra de control, se corrieron junto con 1 l y 2 l de marcador de ADN/HindIII etiquetado como M. Por favor, haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3 : GRADIENTE PCR para determinar la temperatura óptima de recocido para imprimaciones PCR inversas (Tabla 1). El LDI-PCR que utiliza pares de imprimación inversos a una temperatura de recocido que oscila entre 56 y 66 oC muestra un producto de PCR distinto a 62 o 66 oC. La flecha verde indica la temperatura de recocido seleccionada para futuros experimentos. Plantilla de ADN circular generada por la digestión de ADN genómico de sangre de un individuo normal con SacI seguido de la auto-ligación se utilizó para este paso de optimización. M, marcador (1 kb más escalera de ADN). Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4 : LDI-PCR para identificar la transducción de LINE-1 3 TTC28 -LINE-1. Las plantillas de ADN circular generadas por la digestión de MCF7 y el ADN genómico de sangre (de individuos normales) con SacI seguido de la auto-ligación fueron amplificadas por imprimaciones inversas en temperatura de recocido óptima. El producto PCR "nativo", marcado con asterisco, de tamaño esperado (5.649 bp) se detectó tanto en el ADN MCF7 como en el ADN sanguíneo normal, mientras que MCF7 también produjo productos de PCR adicionales de diferentes tamaños, lo que indica retrotransposición de novo LINE-1. M, marcador (escalera de ADN de 1 kb). Haga clic aquí para ver una versión más grande de esta figura.

Primer nombre Secuencia (5o 3o)
L1_001 (rev) TTCACTAAGCATGTATGTGGAAAAC
L1_002 (fwd) CCCAAAATATACCCAATTACTGGCA

Tabla 1: Par de imprimación PCR inverso diseñado para la etiqueta única de TTC28 -LINE-1 14 .

Archivo suplementario. Haga clic aquí para descargar este archivo.

Discussion

Aquí describimos un método que se puede utilizar para identificar inserciones de novo LINE-1 derivadas de cualquier LINE-1 activo de interés. Hemos optimizado este método para una LINE-1 altamente activa, ubicada en 22q12.1, y previamente hemos demostrado que es altamente sensible en la detección de inserciones subclonales en el cáncer colorrectal14.

El éxito de LDI-PCR depende de la calidad del ADN genómico. Por lo tanto, hemos incluido un paso de control de calidad adicional para garantizar que al inicio del protocolo, el ADN de alto peso molecular está presente (paso 2.1.2). Recomendamos almacenar ADN genómico a -20 oC para el almacenamiento a largo plazo, y preparar alícuotas con el fin de evitar ciclos de congelación y descongelación. Se recomienda utilizar ADN genómico de sangre o tejido normal coincidente con el paciente para distinguir si la retrotransposición LINE-1 detectada es una línea germinal o un evento somático. Dado que los sitios de corte para las enzimas de restricción son estocásticos en el genoma, es posible que un sitio de inserción de novo LINE-1 en particular no alberga ningún sitio de corte para la enzima de restricción que se utiliza en sus alrededores. Por lo tanto, para aumentar la probabilidad de detectar la mayoría de las inserciones de novo LINE-1 en el ADN tumoral, se debe utilizar más de una enzima de restricción en reacciones separadas para generar diferentes bibliotecas de plantilla de ADN circular. Además, si la etiqueta única de la LINE-1 de interés tiene más de un PAS, el uso de pares de imprimación adyacentes a cada PAS mejora las posibilidades de detectar transducciones muy truncadas.

Aunque existen métodos elegantes para la detección en todo el genoma de inserciones de novo LINE-1, pueden ser abrumadores si el objetivo es sondear la competencia de retroposición de una LINE-1 en particular en un contexto celular específico. Para este propósito, LDI-PCR puede ser un enfoque económico y simple pero robusto para visualizar eventos de retroposición LINE-1. El enfoque de segmentación utilizado en este método es similar a TS-ATLAS22; sin embargo, LDI-PCR evita el uso de oligonucleótidos del vinculador y puede amplificar simultáneamente las uniones de 5o y 3o de inserción de novo LINE-1. La información relativa a las uniones de 5o y 3o de la inserción LINE-1, el lugar objetivo de integración, la cola de poliA y las modificaciones del sitio objetivo, todas las cuales son señas de identidad de la retrotransposición LINE-1, se puede obtener mediante el acoplamiento LDI-PCR con una sola molécula tecnologías de secuenciación de lectura prolongada. Las lecturas largas así generadas contienen la secuencia LINE-1 insertada, su etiqueta única y las secuencias de destino en una sola lectura, eludiendo las dificultades de mapeo de lecturas cortas en la región repetitiva.

Hay dos limitaciones principales al uso de LDI-PCR para la detección de la actividad LINE-1. El primero es inherente a la PCR: sólo puede amplificar fragmentos de hasta 10 kb de tamaño de forma fiable. Esto debe tenerse en cuenta al seleccionar enzimas de restricción, ya que el fragmento nativo no debe exceder este límite. En segundo lugar, este método sólo puede detectar eventos de retroposición que movilicen la región de flanqueo de 3o de la LÍNEA-1 por transducciones de 3o. Por lo tanto, la actividad de los LINE-1 que no exhiben 3 o transducción no se detectará utilizando este método. Además, a pesar de ser amplificados por LDI-PCR, algunos eventos de retroposición LINE-1 que (a) generan un objetivo de PCR de tamaño similar al de la ubicación "nativa" u otras retrotransposiciones o (b) son raros o subclonales, no pueden ser detectados por gel de agarosa Electroforesis. Estos eventos de retroposición LINE-1 se pueden capturar mediante la secuenciación del producto LDI-PCR utilizando tecnologías de secuenciación de lectura larga de molécula única14.

El flujo de trabajo descrito aquí se puede modificar fácilmente para detectar la actividad de otros LINE-1 "calientes" mediante el uso de una enzima de restricción adecuada y mediante el diseño de imprimaciones inversas dirigidas a estos LINE-1. Además de la detección de la transducción mediada por LINE-1 de 3o, este método se puede adaptar para detectar transducciones menos frecuentes mediadas por LINE-1 de 5o23. Se ha utilizado un método similar para identificar el sitio de integración de los reporteros de LINE-1 en ensayos basados en células24 y sitios de integración proviral en el cáncer25. Además de las inserciones LINE-1, este método también se puede utilizar para detectar otras aberraciones genómicas, como reordenamientos de ADN, donde la información relativa a la región propensa a reorganización preexistente26.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Nos gustaría dar las gracias a todos nuestros coautores en el artículo donde este método se describió por primera vez14, especialmente Tatiana Cajuso, Kimmo Palin, Outi Kilpivaara y Esa Pitk-nen por las valiosas discusiones mientras se desarrolla el método. L.K. está financiado por la Academia de Finlandia (números de subvención 25996, 292789, 306026 y 314394), la Fundación Sigrid Juselius y la Sociedad Finlandesa contra el Cáncer. B.P. es galardonado con la beca de doctorado de la Fundación de Investigación de la Universidad de Helsinki, una beca de tesis de la Sociedad Finlandesa contra el Cáncer y una beca de investigación doctoral de Ida Montinin S.Ti. También agradecemos a Teemu Masalin (Universidad de Helsinki) y Kul Shrestha del grupo de investigación de L.K. por ayudarnos con la producción de video.

Materials

Name Company Catalog Number Comments
1 Kb DNA Ladder New England Biolabs N3232L
10 mM dNTP ThermoFisher Scientific 18427013
Acetic acid ThermoFisher Scientific 64-19-7 Used to make TAE buffer
Agarose BioNordika BN-50004
Blood sample (frozen) Blood sample from a healthy individual for control PCR
ChemiDoc XRS+ System Bio-rad 1708265
DNA Gel Loading Dye (6X) ThermoFisher Scientific R0611
DNeasy Blood & Tissue Kits Qiagen 69504
Ethidium Bromide Bio-rad 161-0433
Ethylenediaminetetraacetic acid (EDTA) ThermoFisher Scientific 25102-12-9 Used to make TAE buffer
FastDigest buffer ThermoFisher Scientific B64
FastDigest SacI ThermoFisher Scientific FD1133
Generuler 1 Kb plus DNA Ladder ThermoFisher Scientific SM1331
Generuler Lambda DNA/HindIII Marker, 2 ThermoFisher Scientific SM0103
Mini-Sub Cell GT Cell Bio-rad 1704406
Phusion Green Hot Start II High-Fidelity DNA Polymerase ThermoFisher Scientific F537L
PowerPac Basic Power Supply Bio-rad 1645050
Quantus Fluorometer Promega E6150
T4 DNA Ligase ThermoFisher Scientific EL0011
Tear-A-Way 96/8, 96 Well PCR Plate 4titude 4ti-0750/TA
Tris(hydroxymethyl)aminomethane ThermoFisher Scientific 77-86-1 Used to make TAE buffer
Veriti Thermal Cycler Applied Bioscience 4375786

DOWNLOAD MATERIALS LIST

References

  1. Lander, E. S., et al. Initial sequencing and analysis of the human genome. Nature. 409, (6822), 860-921 (2001).
  2. Brouha, B., et al. Hot LINE-1s account for the bulk of retrotransposition in the human population. Proceedings of the National Academy of Sciences of the United States of America. 100, (9), 5280-5285 (2003).
  3. Goodier, J. L. Restricting retrotransposons: a review. Mobile DNA. 7, 16 (2016).
  4. Lee, E., et al. Landscape of somatic retrotransposition in human cancers. Science. 337, (6097), 967-971 (2012).
  5. Miki, Y., et al. Disruption of the APC gene by a retrotransposal insertion of L1 sequence in a colon cancer. Cancer Research. 52, (3), 643-645 (1992).
  6. Scott, E. C., et al. A hot L1 retrotransposon evades somatic repression and initiates human colorectal cancer. Genome Research. 26, (6), 745-755 (2016).
  7. Pitkanen, E., et al. Frequent L1 retrotranspositions originating from TTC28 in colorectal cancer. Oncotarget. 5, (3), 853-859 (2014).
  8. Tubio, J. M., et al. Mobile DNA in cancer. Extensive transduction of nonrepetitive DNA mediated by L1 retrotransposition in cancer genomes. Science. 345, (6196), 1251343 (2014).
  9. Badge, R. M., Alisch, R. S., Moran, J. V. ATLAS: a system to selectively identify human-specific L1 insertions. American Journal of Human Genetics. 72, (4), 823-838 (2003).
  10. Rodic, N., et al. Retrotransposon insertions in the clonal evolution of pancreatic ductal adenocarcinoma. Nature Medicine. 21, (9), 1060-1064 (2015).
  11. Ewing, A. D., Kazazian, H. H. Jr High-throughput sequencing reveals extensive variation in human-specific L1 content in individual human genomes. Genome Research. 20, (9), 1262-1270 (2010).
  12. Sanchez-Luque, F. J., Richardson, S. R., Faulkner, G. J. Retrotransposon Capture Sequencing (RC-Seq): A Targeted, High-Throughput Approach to Resolve Somatic L1 Retrotransposition in Humans. Methods in Molecular Biology. 1400, 47-77 (2016).
  13. Zhao, B., et al. Somatic LINE-1 retrotransposition in cortical neurons and non-brain tissues of Rett patients and healthy individuals. PLOS Genetics. 15, (4), e1008043 (2019).
  14. Pradhan, B., et al. Detection of subclonal L1 transductions in colorectal cancer by long-distance inverse-PCR and Nanopore sequencing. Scientific Reports. 7, (1), 14521 (2017).
  15. Moran, J. V., DeBerardinis, R. J., Kazazian, H. H. Jr Exon shuffling by L1 retrotransposition. Science. 283, (5407), 1530-1534 (1999).
  16. Philippe, C., et al. Activation of individual L1 retrotransposon instances is restricted to cell-type dependent permissive loci. Elife. 5, (2016).
  17. Penzkofer, T., et al. L1Base 2: more retrotransposition-active LINE-1s, more mammalian genomes. Nucleic Acids Research. 45, (D1), D68-D73 (2017).
  18. Tabaska, J. E., Zhang, M. Q. Detection of polyadenylation signals in human DNA sequences. Gene. 231, (1-2), 77-86 (1999).
  19. Kalkatawi, M., et al. Dragon PolyA Spotter: predictor of poly(A) motifs within human genomic DNA sequences. Bioinformatics. 29, (11), 1484 (2013).
  20. Sambrook, J., Russell, D. W. Purification of nucleic acids by extraction with phenol:chloroform. Cold Spring Harbor Protocols. 2006, (1), (2006).
  21. Green, M. R., Sambrook, J. Agarose Gel Electrophoresis. Cold Spring Harbor Protocols. 2019, (1), (2019).
  22. Macfarlane, C. M., et al. Transduction-specific ATLAS reveals a cohort of highly active L1 retrotransposons in human populations. Human Mutation. 34, (7), 974-985 (2013).
  23. Beck, C. R., Garcia-Perez, J. L., Badge, R. M., Moran, J. V. LINE-1 elements in structural variation and disease. Annual Review of Genomics and Human Genetics. 12, 187-215 (2011).
  24. Morrish, T. A., et al. DNA repair mediated by endonuclease-independent LINE-1 retrotransposition. Nature Genetics. 31, (2), 159-165 (2002).
  25. Li, J., et al. Leukaemia disease genes: large-scale cloning and pathway predictions. Nature Genetics. 23, (3), 348-353 (1999).
  26. Pradhan, B., et al. Detection and screening of chromosomal rearrangements in uterine leiomyomas by long-distance inverse PCR. Genes, Chromosomes and Cancer. 55, (3), 215-226 (2016).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics