Author Produced

Påvisning av Retrotransposition aktivitet av Hot LINE-1s ved langdistanse inverse PCR

Cancer Research
 

Summary

Denne artikkelen skisserer en enkel PCR-basert analyse for å overvåke aktiviteten til en aktiv LINE-1 retrotransposon og å kartlegge de Novo retrotranspositions i en gitt Genova. Ved hjelp av MCF7 cellelinjen, viser vi her hvordan denne metoden kan brukes til å oppdage aktiviteten til en linje-1 som ligger på 22q 12.1.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Pradhan, B., Kauppi, L. Detection of Retrotransposition Activity of Hot LINE-1s by Long-Distance Inverse PCR. J. Vis. Exp. (149), e59880, doi:10.3791/59880 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Long ispedd kjernefysiske elementer 1 (LINE-1s) er den eneste familien av mobile genetiske elementer i den menneskelige Genova som kan bevege seg selvstendig. De gjør det ved en prosess som kalles retrotransposition hvor de transkribere å danne en mRNA mellomliggende som deretter følgelig settes inn i Genova ved omvendt transkripsjon. Til tross for å være taus i normale celler, LINE-1s er svært aktive i ulike epitel svulster. De Novo LINE-1 innsettinger kan potensielt kjøre tumorigenesis, og dermed er det viktig å systematisk studere LINE-1 retrotransposition i kreft. Ut av ~ 150 retrotransposition-kompetent LINE-1s stede i den menneskelige Genova, bare en håndfull LINE-1 Loci, også referert til som "hot" LINE-1s, står for flertallet av de Novo line-1 innsetting i ulike krefttyper. Vi har utviklet en enkel polymerase kjedere reaksjon (PCR)-basert metode for å overvåke retrotransposition aktivitet i disse varme LINE-1s. Denne metoden, basert på langdistanse invers (LDI)-PCR, utnytter 3 ́ Transduction, en mekanisme der en linje-1 mobiliserer sin flankerer ikke-repeterende region, som senere kan brukes til å identifisere de Novo LINE-1 3 ́ Transduction hendelser som stammer fra en bestemt varm linje-1.

Introduction

Long ispedd kjernefysiske elementer (LINE-1s) er en familie av mobile genetiske elementer kalt retrotransposons som kan uavhengig flytte fra ett sted til et annet via en kopi-og-lim mekanisme kalt retrotransposition. Over evolusjonære tid, har den menneskelige Genova akkumulert mer enn 500 000 eksemplarer av LINE-1 gjentar1. Imidlertid, det meste av linjen-1 eksemplarene gave inne det Genova er mutert og herav kan ikke bevege via retrotransposition; bare ~ 150 eksemplarer har intakt kopi av DNA-sekvensen er nødvendig for dem å flytte2. I normale somatiske celler, mobilitet av disse LINE-1s er begrenset av ulike vert faktorer3. Disse begrensningene er lettet i forskjellige epitel svulster, forårsaker LINE-1s skal derepressed og resulterer i mange de Novo innsettinger i svulsten Genova4. Noen av disse tumor-assosiert de Novo innsettinger har vist å forårsake insertional mutagenese i gener, derav kjører tumorprogresjon5,6. Derfor er det viktig å kunne kartlegge romanen innsettinger i svulsten Genova.

Eksisterende metoder for å oppdage de Novo line-1 innsettinger bruk (1) hele Genova sekvensering tilnærming4,7,8, der ulike beregningsorientert algoritmer brukes til å finne de Novo line-1 innsettinger fra WGS data, eller (2) neste generasjons sekvensering som er rettet mot 3 ́ slutten av unge, potensielt aktive linje-1s9,10,11,12,13. Men å finne romanen innsettinger blant flere tusen nær-identiske kopier med disse metodene er langt fra trivielt, og utfordringen er ytterligere forverret av tumor heterogenitet og genomisk endringer knyttet til linje-1 innsetting4.

Studier som bruker disse eksisterende metodene viste at bare noen få linje-1s står for flertallet av de Novo line-1 innsettinger observert i svulster7,8. Derfor, for å svare på om en bestemt tumor prøven viser LINE-1 aktivitet, er det nok å kartlegge retrotransposition hendelser forårsaket av denne håndfull svært aktive LINE-1 Loci. I denne artikkelen beskriver vi en enkel polymerase kjedere reaksjon (PCR)-basert metode14 som kan brukes til å overvåke aktiviteten til en bestemt linje-1-geometrisk i den første Intronets opprinnelse av TTC28 -genet ved 22q 12.1, som er svært aktiv i tykktarmskreft 7 andre er , 8. denne linjen-1 geometrisk vil bli referert til som TTC28-linje-1 i hele artikkelen. Denne analysen identifiserer spesielt de Novo line-1-retrotransposition hendelser som mobilisere ikke-repeterende sekvens på 3 ́ flankerer-regionen på kildelinjen-1 av en mekanisme kalt 3 ́ Transduction15. 3 ́ Transduction oppstår på grunn av den svake linjen-1 polyadenylation signal (PAS) som fører til at transcriptional maskiner til å hoppe over det og i stedet avslutte transkripsjon på sterkere PAS nedstrøms, og dermed fange flankerer ikke-repeterende sekvens ( heretter referert til som "unik tag") som deretter settes inn i målplasseringen sammen med LINE-1 sekvensen. Philippe et al.16 nylig viste at ulike celletyper kan UTTRYKKE ulike line-1 Loci. I lys av dette funnet, kan denne metoden brukes til å overvåke aktiviteten til de mest uttrykte linje-1 som mobilisere deres unike koden i krefttype interesse.

Det første trinnet i LDI-PCR er fordøyelsen av genomisk DNA med et Begrensnings enzym som genererer en Begrensnings fragment som inneholder linje-1 som analyseres (her, TTC28-line-1) og dens unike kode (figur 1). Fordøyd DNA er deretter circularized av selv-ligation og PCR forsterket ved hjelp av inverse primere ligger innenfor den unike koden. Ved å gjøre dette, full-lengde kildelinje-1 på sitt "native" plassering er alltid forsterkes og sammen med det, avkom linje-1 innsettinger på ulike mål Loci som inneholder den unike koden vil også forsterkes (figur 1), og dermed rapportering retrotransposition aktivitet av LINE-1 i spørsmålet.

Protocol

Denne forskningen ble godkjent av den institusjonelle gjennomgang Board og etikk komité Helsingfors universitetssykehus. Signert informert samtykke ble innhentet fra faget for Blodprøven brukes til å demonstrere denne protokollen.

1. Designing inverse primere og velge restriksjon enzymer (bioinformatikk)

  1. Bestemme en linje-1 tilknyttet unik kode
    1. Last ned TTC28-line-1-SEKVENSEN i FASTA-format fra en linje-1-database, for eksempel L1Base17. L1base-IDen for TTC28-line-1 er 135.
    2. Ta med 5 kb sekvens flankerer både 5 ́ og 3 ́ ender av LINE-1-sekvensen og Kommenter den i et tekstbehandlingsprogrammet.
      Merk: her LINE-1 flankerer sekvensen er kommentert i brun skrift, og LINE-1 sekvensen er i grå skrift (tilleggsfil).
    3. Skriv 1 kb sekvens nedstrøms av valgte LINE-1 ' s beslektet PAS i et PAS prediksjon verktøy som polyadq18 eller Dragon PolyA spotter19 og kommentere alle polyadenylation signalet i dette 1 kb vinduet.
      Merk: Hvis det ikke er PAS i 1 kb-vinduet, Søk etter PAS i neste 1 kb vinduet nedstrøms. TTC28-line-1 ' s egen svake pas er uthevet i rosa og alle de andre pas i 1 kb vinduet nedstrøms er uthevet i rødt (tilleggsfil).
    4. Kommenter sekvensen mellom slutten av LINE-1 ' s beslektet PAS og den sterkeste PAS nedstrøms som "unik tag".
      Merk: "unik tag" av TTC28-line-1 er uthevet i gult (supplerende fil).
  2. Designing inverse primere
    1. Design inverse PCR-primere ved å skrive inn "unik tag" sekvens i en Web-basert primer-designer verktøy som primer 3 (http://bioinfo.ut.ee/primer3-0.4.0/) eller NCBI ' s primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). Siden primer parene designet av disse verktøyene står overfor hverandre tilrettelegging konvensjonelle PCR, bruker omvendt-komplement funksjon for primer paret å utføre inverse PCR.
      Merk: som linje-1-transductions er sterkt avkortet ved deres 5 ́ ende og størrelsen på transduced regionen er svært variabel, har som mål å holde avstanden mellom de to inverse primere minimal, ved å sette "PCR produkt lengde" parameter i NCBI primer-BLAST til Minimum. I tilfelle av flere PAS innenfor den unike koden, designe flere primer parene som tilsvarer ulike PASs. Design primere nær PAS, som linje-1 innsettinger initiere fra 3 ́end av RNA mellomliggende og 5 ́ enden er ulik avkortet. Her tre primer parene ble utformet, uthevet i lyse og grønne, tilsvarende tre sterke polyadenylation signaler i den unike koden for TTC28 linje-1 (supplerende fil).
  3. Velge Begrensnings enzymer
    1. Fordøye LINE-1 sekvensen sammen med sin 5 kb oppstrøms og nedstrøms flanken i silisiummangan ved hjelp av Web-basert verktøy som RestrictionMapper. Dette vil gi en omfattende liste over begrensning enzymer som fordøyer denne regionen, genererer ulike begrensning fragmenter.
    2. Velg Begrensnings enzymer som skjærer det opprinnelige geometriske stedet på linje-1 som følger: ved 5 ́ slutt, enten oppstrøms av LINE-1 ' s 5 ́end eller langt 5 ́end av LINE-1 selv, og på 3 ́ slutten, nedstrøms av LINE-1 ' s unike tag.
      Merk: den valgte begrensningen enzymet bør være ufølsom for DNA metylering, bør være varme-inactivatable, og bør generere forskjøvet "klebrig" ender som er komplementære til hverandre. For å demonstrere LDI-PCR, SACjeg restriksjon enzym som kutter DNA på GAGCTC nettsteder, uthevet her i lys grønn, brukes (supplerende fil).
    3. Legg merke til begrensningen fragment størrelse laget av utvalgte restriksjon enzymer. Dette bør ikke være lengre enn 12 kb som det ikke kan være effektivt forsterkes av PCR.

2. Making sirkulære DNA-maler for langdistanse inverse PCR

  1. DNA-ekstraksjon og kvalitetsvurdering
    1. Pakk genomisk DNA fra prøver (tumor eller blod) ved hjelp av kommersielt tilgjengelige DNA-ekstraksjon kits som kan trekke ut god kvalitet, høy molekylvekt DNA nødvendig for LDI-PCR i henhold til produsentens instruksjoner. Alternativt kan høy molekylvekt DNA også trekkes ut av fenol: kloroform20.
    2. Mål DNA-konsentrasjonen ved hjelp av en fluorometer i henhold til produsentens instruksjoner, og Kjør 100 ng av DNA på 1% (w/v) agarose gel som inneholder etidiumbromid bromide (0,5 μg/mL) i 1x Tris-acetate-EDTA (TAE) buffer på 4,5 V/cm21 sammen λ-HindIII DNA molekylvekt markører for å sjekke DNA kvalitet og kvantitet.
  2. Fordøye genomisk DNA
    1. Lag en fordøyelse reaksjons miks (endelig volum på 50 μL) ved å tilsette 20 enheter SACi Begrensnings enzym, 5 μL av 10x reaksjonsbuffer (tabell over materialer), 100 ng av DNA (opptil 44 μL) i en 0,2 ml PCR-rør på is (1 μL av Begrensnings enzym fra de fleste produsenter i er tilstrekkelig til å fullstendig fordøye 100 ng av genomisk DNA). Bland løsningen ved å sveipe røret, og sentrifuger kort.
    2. Bruk en termisk cycler til å ruge reaksjonsblandingen ved 37 ° c i 1 time, etterfulgt av at varmen inaktive ved 65 ° c i 5 min.
  3. Self-ligating den fordøyd genomisk DNA
    1. Til 50 μL fordøyelse blanding (etter trinn 2.2.2), tilsett 8 μL av 10x T4 DNA ligase buffer, 1 μL (5 enheter) av T4 DNA-ligase og 21 μL av ultrarent vann for å lage et endelig reaksjons volum på 80 μL. Bland løsningen ved å sveipe rørene og sentrifuge kort.
    2. Ruge i en termisk cycler ved 22 ° c i 10 min, avslutning med en varme deaktivering trinn ved 65 ° c i 10 min.

3. langdistanse inverse PCR

  1. Bestemme primer annealing temperatur ved gradient PCR
    1. Angi en annealing temperatur gradering av (A-4) ° c, (A-2) ° c, A, (A + 2) ° c, (A + 4) ° c der A er den teoretiske annealing temperaturen til primer-paret som beregnes ved hjelp av den kommersielle leverandørens nettbaserte verktøy.
      Merk: termisk cyclers fra enkelte produsenter tillater kanskje ikke innstilling av temperaturstigning manuelt. I så fall kan den automatiske graderings innstillingen brukes med et temperaturområde på (A-4) ° c til (A + 4) ° c.
    2. Forbered en mester miks for PCR ved å kombinere og blande følgende komponenter i et 1,5 mL mikrosentrifugen rør: 4 μL av 5x reaksjonsbuffer, 0,4 μL av 10 mM dNTP, 5 μL av PCR-primer på 2 μM (forover og bakover, utformet i trinn 1.3.1) , 0,2 μL (0,1 U) av DNA-polymerase per reaksjon. Sett opp en reaksjon for hver annealing temperatur i graderingen.
    3. For hver reaksjon, alikvot 19 μL av Master blandingen i 0,2 mL PCR-rør og tilsett 1 μL (1,25 ng) av sirkulær DNA-mal laget i del 2.
      Merk: Bruk sirkulær selv ligaturer DNA generert fra normalt blod-DNA som mal for å unngå å konsumere potensielt dyrebare tumor DNA for dette optimaliserings trinnet.
    4. Kjør gradient PCR-programmet på en termisk cycler som beskrevet nedenfor: (i) en syklus av 3 min ved 98 ° c (denaturering); (II) 35 sykluser av (10 s ved 98 ° c [denaturering], 20 s ved temperaturstigning på [A-4] til [A + 4] ° c [annealing] og 1 − 6 min [30 s per kilobase av forventet PCR-produkt] ved 72 ° c [forlengelse]); (III) en syklus på 10 min ved 72 ° c (endelig forlengelse).
    5. Kjør 6 μL av PCR-produktet i 1% agarose gel21 fremstilt i 1x Tae-buffer på 4,5 V/cm og analyser PCR-produktene ved forskjellige annealing temperaturer.
    6. Velg den annealing temperaturen som gir et PCR-produkt som tilsvarer den forventede størrelsen.
  2. Oppdage de Novo line-1 retrotransposition aktivitet i svulsten Genova
    1. Utfør LDI-PCR ved hjelp av det inverse PCR primer paret på sirkulære DNA-maler generert fra tumor prøver (del 2). Følg samme instruksjoner som for gradient PCR (seksjon 3,1), men denne gangen erstatte temperaturen gradient med optimal annealing temperatur.
    2. Analyser PCR-produktene ved å agarose gel-elektroforese som utført i trinn 3.1.5. PCR-produkt av kjent størrelse eller det "innfødte" PCR-produktet som tilsvarer linje-1 på sitt opprinnelige geometriske lokale, bør være synlig for hver reaksjon. De Novo LINE-1 3 ́ Transduction i tumor prøve analyseres oppdages som PCR-produkter av ulik størrelse, sammen med det innfødte PCR-produktet i agarose gel.

4. sekvensering LDI-PCR produkter for å avdekke identiteten til målnettsteder for LINE-1 3 ́ Transduction

  1. Utfør en lang lese sekvens av alle PCR-amplicons som ble generert i hver LDI-PCR-reaksjon for å identifisere mål integrasjons stedene i disse LINE-1 3 ́ Transduction hendelsene.
    Merk: kloning og sanger sekvensering av LDI-PCR-produkter er også en mulig, om enn tungvint, tilnærming.
  2. Juster leser produsert av enkelt-molekylet lang lese sekvensering plattformer til referanse Genova ved hjelp av standard sekvens justering rørledninger. Analyser de justerte leser ved hjelp av LDI-PCR-programvare14 for å identifisere de Novo line-1 innsettinger og dens målområder.

Representative Results

I tilfelle av TTC28-line-1, det er mer enn en pas innenfor et 1 kb vindu nedstrøms av sin beslektet Pas, derav regionen mellom TTC28-line-1 pas og sterkeste pas på 811 BP nedstrøms ble betraktet som den unike koden for TTC28-line-1. Tre inverse PCR primer parene ble utformet på denne unike koden som tilsvarer ulike PASs til stede14. Vi valgte tre Begrensnings enzymer: (i) NSIjeg som skjærer 5 ́ oppstrøms av TTC28-line-1 og 3 ́ utenfor den unike taggen, og (II) SACi og (III) PSTi som cut 5 ́ innenfor line-1 i sin langt 5 ́ slutt, og 3 ́ utenfor den unike taggen. Disse genererer begrensning fragmenter av 10 288 BP, 5 699 BP, og 6 305 BP henholdsvis.

For å demonstrere denne metoden, utførte vi LDI-PCR på DNA utvunnet fra MCF7 cellelinje. Denne brystkreft cellelinjen har tidligere blitt rapportert å vise TTC28-line-1 aktivitet16. For enkelhets skyld gjorde vi en sirkulær DNA mal ved hjelp av en restriksjon enzym, SACi, av tre og UTFØRTE en LDI-PCR ved hjelp av en primer par av tre (tabell 1) for å oppdage de Novo line-1 innsettinger stammer fra TTC28- LINJE-1.

God kvalitet på DNA utvunnet fra MCF7 cellelinje ble sikret ved agarose gel elektroforese (figur 2). Intakt høy molekylvekt DNA viser at genomisk DNA er av optimal kvalitet for denne analysen. Hvis en flekk er synlig i stedet, indikerer dette dårlig kvalitet på utvunnet DNA, som igjen vil hemme nedstrøms prosedyrer.

Figur 3 viser et representativt resultat av en gradient PCR eksperiment, som tar sikte på å bestemme den optimale annealing temperatur på TTC28-line-1 inverse primer par. Blood genomisk DNA fordøyd med SACI, etterfulgt av selv-ligation å danne en sirkulær DNA mal, ble brukt til denne reaksjonen. Et svært spesifikt PCR-produkt av forventet størrelse (5 649 BP) ved 62, 64 og 66 ° c viser at den optimale annealing temperaturen for dette primer paret ligger innenfor området 62 − 66 ° c.

Vi genererte en sirkulær DNA mal ved å fordøye MCF7 genomisk DNA med SACjeg begrensning enzym etterfulgt av selv-ligation. Figur 4 viser at TTC28-line-1 3 ́ Transduction forekommer i MCF7 cellelinjer: de NOVO INNSETTINGER kan påvises som LDI-PCR produkter av VARIERENDE størrelse sammen med et innfødt PCR produkt av kjente størrelse (5 649 BP). For å identifisere genomisk koordinater for de Novo Target-områdene kan PCR-amplicons være et sekvensielt (se protokoll avsnitt 4).

Figure 1
Figur 1 : Oversikt over LDI-PCR for å oppdage line-1 3 ́ Transduction. En sirkulær DNA mal er generert av første fordøye (I) det med en restriksjon enzym og selv-ligating (II) det. Dette trinnet etterfølges av invers PCR (III) med inverse PCR-primere som er rettet mot den unike koden til LINE-1 av interesse (sekvens mellom LINE-1 ' s egen svakere PAS, i rosa og sterkere PAS nedstrøms, i rødt). Vennligst klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2 : Kvalitetsvurdering av UTVUNNET DNA. 100 ng av DNA utvunnet fra MCF7 cellelinje og blod fra en normal person, som vil bli brukt som en kontroll prøve, ble kjørt sammen med 1 μL og 2 μL av λ DNA/HindIII markør merket som M. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3 : Gradient PCR for å fastslå optimal annealing temperatur for INVERSE PCR-primere (tabell 1). LDI-PCR ved hjelp av inverse primer par ved annealing temperatur fra 56 til 66 ° c viser et distinkt PCR-produkt ved 62 − 66 ° c. Grønn pil indikerer den valgte annealing temperatur for fremtidige eksperimenter. Sirkulær DNA mal generert ved å fordøye blod genomisk DNA fra en vanlig person med SACjeg fulgt av selv-ligation ble brukt for dette optimaliserings trinnet. M, markør (1 kb pluss DNA stige). Vennligst klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4 : LDI-PCR for å identifisere line-1 3 ́ Transduction som stammer fra TTC28 -Linje 1. Sirkulær DNA maler generert av fordøye MCF7 og blod (fra normal individuelle) genomisk DNA med SACjeg fulgte av selv-ligation ble forsterket av inverse primere i optimal annealing temperatur. "Native" PCR produkt, merket med stjerne, av forventet størrelse (5 649 BP) ble påvist i både MCF7 DNA og normal blod DNA, mens MCF7 også produserte flere PCR produkter av varierende størrelse, indikerer de Novo line-1 retrotransposition. M, markør (1 kb DNA stige). Vennligst klikk her for å se en større versjon av dette tallet.

Primer navn Sekvens (5 ́ → 3 ́)
L1_001 (rev) TTCACTAAGCATGTATGTGGAAAAC
L1_002 (Fwd) CCCAAAATATACCCAATTACTGGCA

Tabell 1: omvendt PCR primer par designet for den unike merke TTC28 -Line-1 14 priser og priser .

Tilleggsfil. Vennligst klikk her for å laste ned denne filen.

Discussion

Her beskriver vi en metode som kan brukes til å identifisere de Novo line-1 innsettinger stammer fra alle aktive line-1 av interesse. Vi har optimalisert denne metoden for en svært aktiv LINE-1, som ligger på 22q 12.1, og tidligere vist det å være svært følsom i å oppdage sub-klonal innsettinger i tykktarmskreft14.

Suksessen til LDI-PCR avhenger av kvaliteten på genomisk DNA. Derfor har vi tatt med en ekstra kvalitetskontroll trinn for å sikre at ved starten av protokollen, høy molekylvekt DNA er til stede (trinn 2.1.2). Vi anbefaler at du oppbevarer genomisk DNA ved-20 ° c for langtidslagring, og for å forberede alikvoter for å unngå sykluser med frysing og tine. Bruke genomisk DNA fra blod eller pasient-matchet normalt vev er sterkt anbefalt å skille om LINE-1 retrotransposition oppdaget er en germline eller en somatiske hendelse. Siden kuttet nettsteder for begrensning enzymer er Stokastisk i Genova, er det mulig at en bestemt de Novo line-1 innsetting området kanskje ikke havna noen kutt nettsteder for begrensning enzymet brukes i nærheten. Derfor å øke sannsynligheten for å oppdage flertallet av de Novo line-1 innsettinger i tumor DNA, mer enn en restriksjon enzym bør brukes i separate reaksjoner for å generere ulike biblioteker av sirkulær DNA mal. Videre, hvis den unike koden på LINE-1 av interesse har mer enn én PAS, deretter bruke primer parene ved siden av hver PAS forbedrer sjansene for å oppdage sterkt avkortet transductions.

Selv om elegante metoder for Genova-bred deteksjon av de Novo line-1 innsettinger eksisterer, kan de være overveldende hvis målet er å undersøke retrotransposition kompetanse på en bestemt linje-1 i en bestemt cellulær kontekst. For dette formålet, LDI-PCR kan være en billig og enkel, men robust tilnærming for å visualisere LINE-1 retrotransposition hendelser. Målrettingsmetoden som brukes i denne fremgangsmåten, ligner på TS-ATLAS22. LDI-PCR unngår imidlertid å bruke linker oligonukleotider og kan forsterke både 5 ́ og 3 ́ kryss på de Novo line-1 innsetting samtidig. Informasjon om både 5 ́ og 3 ́ knutepunkter for linje-1-innsetting, målstedet for integrasjon, polyA hale og mål-site modifikasjoner, som alle er kjennetegnene på LINE-1 retrotransposition, kan fås ved kobling LDI-PCR med ett-molekyl lang-lese sekvensering teknologiene. Lange leser dermed generert inneholder satt LINE-1 sekvens, dens unike koden og målet sekvenser i en enkelt lese, omgå vanskeligheter med kartlegging korte leser i repeterende regionen.

Det er to store begrensninger ved bruk av LDI-PCR for påvisning av linje 1-aktivitet. Den første er iboende til PCR: det kan bare pålitelig forsterke fragmenter opp til 10 kB i størrelse. Dette bør vurderes ved valg av Begrensnings enzym (er), da det innfødte fragmentet ikke bør overskride denne grensen. For det andre kan denne metoden bare oppdage retrotransposition hendelser som mobilisere 1 ' s 3 ́ flankerer region av 3 ́ transductions. Derfor vil ikke aktiviteten til de LINE-1s som ikke viser 3 ́ Transduction bli oppdaget ved hjelp av denne metoden. I tillegg, til tross for å bli forsterket av LDI-PCR, noen linje-1 retrotransposition hendelser som (a) genererer et PCR-mål på tilsvarende størrelse som "native" sted eller andre retrotranspositions eller (b) er sjeldne eller subclonal, kan ikke oppdages av agarose gel elektroforese. Slike linje-1 retrotransposition hendelser kan fanges opp av sekvensering LDI-PCR-produktet ved hjelp av enkelt molekyl lang lese sekvensering teknologier14.

Arbeidsflyten beskrevet her kan enkelt endres for å oppdage aktiviteten til andre "hot" LINE-1s ved hjelp av en passende begrensning enzym og ved å designe inverse primere målretting disse LINE-1s. I tillegg til deteksjon av LINE-1 mediert 3 ́ Transduction, kan denne metoden tilpasses til å oppdage mindre hyppige linje-1 mediert 5 ́ transductions23. Lignende metode har blitt brukt til å identifisere integreringen området LINE-1 journalister i celle-baserte analyser24 og proviral integrering nettsteder i kreft25. I tillegg til linje-1 innsettinger, kan denne metoden også utnyttes til å oppdage andre genomisk avvik, som DNA rearrangements, der informasjon om omorganisering-liggende regionen pre-eksisterer26.

Disclosures

Forfatterne har ingenting å avsløre.

Acknowledgments

Vi vil gjerne takke alle våre co-forfattere i artikkelen der denne metoden ble først beskrevet14, spesielt Tatiana Cajuso, Kimmo Palin, outi Kilpivaara og ESA Pitkänen for verdifulle diskusjoner mens utvikle metoden. L.K. er finansiert av akademiet i Finland (gi nummer 25996, 292789, 306026 og 314394), Sigrid Juselius Foundation, og det finske Kreftforeningen. B.P. er mottaker av University of Helsinki Research Foundation PhD studentship, en finsk Cancer Society avhandling stipend, og en doktorgradsforskning stipend fra Ida Montinin Säätiö. Vi takker også Teemu Masalin (Universitetet i Helsingfors) og kul Shrestha fra L.K. forskningsgruppe for å hjelpe oss med video produksjon.

Materials

Name Company Catalog Number Comments
1 Kb DNA Ladder New England Biolabs N3232L
10 mM dNTP ThermoFisher Scientific 18427013
Acetic acid ThermoFisher Scientific 64-19-7 Used to make TAE buffer
Agarose BioNordika BN-50004
Blood sample (frozen) Blood sample from a healthy individual for control PCR
ChemiDoc XRS+ System Bio-rad 1708265
DNA Gel Loading Dye (6X) ThermoFisher Scientific R0611
DNeasy Blood & Tissue Kits Qiagen 69504
Ethidium Bromide Bio-rad 161-0433
Ethylenediaminetetraacetic acid (EDTA) ThermoFisher Scientific 25102-12-9 Used to make TAE buffer
FastDigest buffer ThermoFisher Scientific B64
FastDigest SacI ThermoFisher Scientific FD1133
Generuler 1 Kb plus DNA Ladder ThermoFisher Scientific SM1331
Generuler Lambda DNA/HindIII Marker, 2 ThermoFisher Scientific SM0103
Mini-Sub Cell GT Cell Bio-rad 1704406
Phusion Green Hot Start II High-Fidelity DNA Polymerase ThermoFisher Scientific F537L
PowerPac Basic Power Supply Bio-rad 1645050
Quantus Fluorometer Promega E6150
T4 DNA Ligase ThermoFisher Scientific EL0011
Tear-A-Way 96/8, 96 Well PCR Plate 4titude 4ti-0750/TA
Tris(hydroxymethyl)aminomethane ThermoFisher Scientific 77-86-1 Used to make TAE buffer
Veriti Thermal Cycler Applied Bioscience 4375786

DOWNLOAD MATERIALS LIST

References

  1. Lander, E. S., et al. Initial sequencing and analysis of the human genome. Nature. 409, (6822), 860-921 (2001).
  2. Brouha, B., et al. Hot LINE-1s account for the bulk of retrotransposition in the human population. Proceedings of the National Academy of Sciences of the United States of America. 100, (9), 5280-5285 (2003).
  3. Goodier, J. L. Restricting retrotransposons: a review. Mobile DNA. 7, 16 (2016).
  4. Lee, E., et al. Landscape of somatic retrotransposition in human cancers. Science. 337, (6097), 967-971 (2012).
  5. Miki, Y., et al. Disruption of the APC gene by a retrotransposal insertion of L1 sequence in a colon cancer. Cancer Research. 52, (3), 643-645 (1992).
  6. Scott, E. C., et al. A hot L1 retrotransposon evades somatic repression and initiates human colorectal cancer. Genome Research. 26, (6), 745-755 (2016).
  7. Pitkanen, E., et al. Frequent L1 retrotranspositions originating from TTC28 in colorectal cancer. Oncotarget. 5, (3), 853-859 (2014).
  8. Tubio, J. M., et al. Mobile DNA in cancer. Extensive transduction of nonrepetitive DNA mediated by L1 retrotransposition in cancer genomes. Science. 345, (6196), 1251343 (2014).
  9. Badge, R. M., Alisch, R. S., Moran, J. V. ATLAS: a system to selectively identify human-specific L1 insertions. American Journal of Human Genetics. 72, (4), 823-838 (2003).
  10. Rodic, N., et al. Retrotransposon insertions in the clonal evolution of pancreatic ductal adenocarcinoma. Nature Medicine. 21, (9), 1060-1064 (2015).
  11. Ewing, A. D., Kazazian, H. H. Jr High-throughput sequencing reveals extensive variation in human-specific L1 content in individual human genomes. Genome Research. 20, (9), 1262-1270 (2010).
  12. Sanchez-Luque, F. J., Richardson, S. R., Faulkner, G. J. Retrotransposon Capture Sequencing (RC-Seq): A Targeted, High-Throughput Approach to Resolve Somatic L1 Retrotransposition in Humans. Methods in Molecular Biology. 1400, 47-77 (2016).
  13. Zhao, B., et al. Somatic LINE-1 retrotransposition in cortical neurons and non-brain tissues of Rett patients and healthy individuals. PLOS Genetics. 15, (4), e1008043 (2019).
  14. Pradhan, B., et al. Detection of subclonal L1 transductions in colorectal cancer by long-distance inverse-PCR and Nanopore sequencing. Scientific Reports. 7, (1), 14521 (2017).
  15. Moran, J. V., DeBerardinis, R. J., Kazazian, H. H. Jr Exon shuffling by L1 retrotransposition. Science. 283, (5407), 1530-1534 (1999).
  16. Philippe, C., et al. Activation of individual L1 retrotransposon instances is restricted to cell-type dependent permissive loci. Elife. 5, (2016).
  17. Penzkofer, T., et al. L1Base 2: more retrotransposition-active LINE-1s, more mammalian genomes. Nucleic Acids Research. 45, (D1), D68-D73 (2017).
  18. Tabaska, J. E., Zhang, M. Q. Detection of polyadenylation signals in human DNA sequences. Gene. 231, (1-2), 77-86 (1999).
  19. Kalkatawi, M., et al. Dragon PolyA Spotter: predictor of poly(A) motifs within human genomic DNA sequences. Bioinformatics. 29, (11), 1484 (2013).
  20. Sambrook, J., Russell, D. W. Purification of nucleic acids by extraction with phenol:chloroform. Cold Spring Harbor Protocols. 2006, (1), (2006).
  21. Green, M. R., Sambrook, J. Agarose Gel Electrophoresis. Cold Spring Harbor Protocols. 2019, (1), (2019).
  22. Macfarlane, C. M., et al. Transduction-specific ATLAS reveals a cohort of highly active L1 retrotransposons in human populations. Human Mutation. 34, (7), 974-985 (2013).
  23. Beck, C. R., Garcia-Perez, J. L., Badge, R. M., Moran, J. V. LINE-1 elements in structural variation and disease. Annual Review of Genomics and Human Genetics. 12, 187-215 (2011).
  24. Morrish, T. A., et al. DNA repair mediated by endonuclease-independent LINE-1 retrotransposition. Nature Genetics. 31, (2), 159-165 (2002).
  25. Li, J., et al. Leukaemia disease genes: large-scale cloning and pathway predictions. Nature Genetics. 23, (3), 348-353 (1999).
  26. Pradhan, B., et al. Detection and screening of chromosomal rearrangements in uterine leiomyomas by long-distance inverse PCR. Genes, Chromosomes and Cancer. 55, (3), 215-226 (2016).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics