Sequencing lille ikke-kodning RNA fra formalin-fast væv og serum-afledte Exosomer fra Kastrations resistente prostata cancer patienter

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Terapi resistens ofte udvikler hos patienter med fremskreden prostatakræft, og i nogle tilfælde, kræft udvikler sig til en dødelig subtype kaldet neuroendokrine prostatacancer. Vurdering af de små ikke-kodning RNA-medierede molekylære ændringer, der letter denne overgang vil give bedre sygdoms stratificering og identifikation af kausale mekanismer, der fører til udvikling af neuroendokrine prostatakræft.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Bhagirath, D., Dahiya, R., Majid, S., Tabatabai, Z. L., Saini, S. Sequencing Small Non-coding RNA from Formalin-fixed Tissues and Serum-derived Exosomes from Castration-resistant Prostate Cancer Patients. J. Vis. Exp. (153), e60549, doi:10.3791/60549 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Ablation af Androgen receptor (AR) signalering af androgen berøvelse er målet for den første linje af terapi for prostatakræft, der i første omgang resulterer i kræft regression. Men i et betydeligt antal tilfælde, sygdommen udvikler sig til avanceret, kastrationsresistent prostatacancer (CRPC), som har begrænsede terapeutiske muligheder og er ofte aggressiv. Fjern metastaser observeres for det meste på dette stadium af den aggressive sygdom. CRPC behandles af en anden generation af AR-pathway hæmmere, der i første omgang forbedrer overlevelsen, efterfulgt af fremkomsten af terapi resistens. Neuroendokrine prostatacancer (NEPC) er en sjælden variant af prostatacancer (PCa), der ofte udvikler sig som et resultat af terapi resistens via en transdifferentierings proces kendt som neuroendokrine differentiering (NED), hvori PCa-celler gennemgår en Lineage switch fra adenocarcinomer og vise øget ekspression af neuroendokrine (NE) Lineage markører. Ud over de genomiske ændringer, der driver progression og Trans differentiering til NEPC, epigenetiske faktorer og mikromiljømæssige signaler betragtes som væsentlige aktører i at køre sygdomsprogression. Dette manuskript indeholder en detaljeret protokol til at identificere de epigenetiske drivere (dvs. små ikke-kodning RNAs), der er forbundet med Advanced PCa. Ved hjælp af renset microRNAs fra formalin-fast paraffin-indlejret (FFPE) metastatisk væv og tilsvarende serum-afledte ekstracellulære vesikler (EVs), protokollen beskriver, hvordan man forbereder biblioteker med passende kvalitetskontrol til sekvensering Miornas fra disse eksempel kilder. Isolerende RNA fra både FFPE og EVs er ofte udfordrende, fordi det meste af det er enten forringet eller er begrænset i mængde. Denne protokol vil uddybe forskellige metoder til optimering af RNA-indgange og cDNA-biblioteker for at give de mest specifikke læsninger og data af høj kvalitet ved sekvensering.

Introduction

Prostatakræft er drevet af androgener, der handler via AR signalering. Derfor, målretning af AR pathway er den grundpille behandling for sygdommen1. Resistens opstår dog ofte som følge af målrettede terapier, og sygdommen udvikler sig til en avanceret metastatisk CRPC2. CRPc behandles af anden generation af ar-terapi, der omfatter enzalutamid og abirateronacetat2,3, somi første omgang forbedrer overlevelsen. Men, dødelige varianter såsom NEPC opstår ofte i 25 − 30% af behandlede CRPC tilfælde, der har begrænsede behandlingsmuligheder, hvilket fører til øget dødelighed3. NEPC opstår via en reversibel transdifferentierings proces kendt som NED, hvori PCa-celler gennemgår en Lineage switch fra adenocarcinomer og viser nedsat ekspression af AR og øget ekspression af NE Lineage markører, herunder enolase 2 (ENO2), kromogranin A (CHGA) og synaptophysin (SYP)4. I betragtning af at disse resistens varianter opstår som følge af terapeutiske indgreb, er det vigtigt at dechifrere veje, der fører til generering af denne dødbringende, svære at behandle form af PCa.

Genomforskning af NEPC blev for nylig dechiferet i en udtømmende undersøgelse udført af Beltran et al. hvorved kopier af nummerets ændringer, mutationer, enkelt nukleotidpolymorfier (SNPs) og DNA-methylering fra patient afledte metastatiske væv blev analyseret5. Trods betydelige fremskridt i forståelsen af genomforskning af denne aggressive form for PCa, er lidt kendt om de epigenetiske faktorer, herunder de små ikke-kodning RNAs (micrornas), der er involveret i overgangen af CRPc-adenocarcinoma til NEPC. MicroRNAs (miRNAs) er 22 BP lang, dobbeltstrenget RNAs, der handler primært ved at undertrykke genekspression post-transkriptivt af sekvens-specifikke interaktioner med de 3 '-ikke-oversatte regioner (UTRs) af cognate mRNA mål6. Flere oncomirs og tumor suppressorer er nu blevet identificeret, og deres rolle i reguleringen af sygdomsudbrud og metastase er blevet godt undersøgt i forskellige kræftformer6,7. Disse små ikke-kodning RNAs ofte tjener som meget vigtige mål i at kontrollere sygdom dødelighed6,8,9. Nyere forskning har været fokuseret på at forstå paracrine virkninger af miRNAs i Cancer metastaser via deres transport i EVs, såsom exosomer, at strømmen i blodbanen og tillade tumorceller til at sende disse sekundære budbringere til metastatiske steder i en nuclease-fri miljø10,11,12. EVs transporterer miRNAs fra tumorcellerne for at overføre de transformerende effekter fra værtscellerne12. Identifikation af evt som sekundære budbringere af tumorceller kan derfor være nyttige i ikke-invasiv påvisning af sygdommens sværhedsgrad.

MiR-1246 er meget upregulated i EVs fra aggressive PCa, og det indikerer sygdommens sværhedsgrad13. Disse EV-associerede miRNAs ikke kun fungere som ikke-invasive biomarkører af sygdommen, men også spille funktionelt vigtige roller i kørsel tumorigenesis. Derfor er det vigtigt at forstå betydningen af miRNA repertoire, der er forbundet med resistente former for PCa for at muliggøre bedre identifikation af ikke-invasive biomarkører samt deres funktionelle betydning.

Fremkomsten af næste generation sekvensering har tilbudt den mest omfattende platform til at studere detaljerne i tumor landskab involverer ændringer i genomet såsom mutationer, kromosomale flytninger, chromothripsis, og methylering, som alle bidrager væsentligt til form og karakter af kræft14,15,16. Ligeledes, det er også et vigtigt redskab til at forstå de store engang ændringer, der opstår i en tumor celle, og som ofte er vigtige aktører i sygdoms sværhedsgrad17. Med det formål at forstå miRNA-repertoiret i forbindelse med genereringen af NEPC blev der udført små RNA-sekvensering på FFPE metastatisk CRPC-væv og deres tilsvarende serum afledte EVs. RNA afledt af en af disse to prøve kilder er (1) lavt udbytte og (2) af dårlig kvalitet på grund af den nedbrydning, der ofte sker på grund af formalin fiksering og EV isolation. Desuden er generering af cDNA-biblioteker et kritisk, men besværligt trin i en sekvensering. Således metoder til isolering af disse RNAs og bruge dem til at generere biblioteker til små RNA sekvensering kræver optimering for at generere nøjagtige og pålidelige data.

Der er flere metoder til at profilere miRNA-udtryk i forskellige prøver, herunder RT-PCR, microarrays og in-situ-hybridisering (ISH). En protokol, der bruger FFPE vævs afledt RNA til at evaluere miRNA-udtryk ved RT-PCR og ISH, blev for nylig udgivet18. Nyere teknologier tilbyder mere udtømmende og omfattende platforme til profilering af miRNA-udtryk i en stikprøve. NanoString nCounter tilbyder en følsom miRNA Detection platform19, men registreringen er ofte begrænset af det antal Mirnas, der er tilgængelige i matrixen (~ 2.000). I et sådant scenario, en mere følsom og udtømmende platform såsom næste generation sekvensering tilbyder meget bredere dybde af miRNA identifikation og samtidige profilering i forskellige prøver20. Metoden er blevet anvendt til at bestemme Mirna-signaturer i urin eller plasma fra PCa-patienter21,22,23. I den nuværende artikel, en protokol er præsenteret for at bruge en næste generation sekventering platform til at studere Mirna profiler forbundet med aggressive CRPc ved hjælp af FFPE væv og serum-afledte EV RNAs.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Denne undersøgelse blev gennemført i overensstemmelse med de etiske retningslinjer i USA'S fælles regel og blev godkendt af det institutionelle udvalg for menneskelig forskning.

1. microdissection

Bemærk: FFPE metastatisk CRPc-væv med adenocarcinom-funktioner (CRPc-adeno) eller ne-differentiering (CRPc-ne) blev opnået fra prostata cancer biorepositorienet (pcbn). TEN-micron PCa sektioner på glas slides blev forberedt til manuel microdissection som diskuteret tidligere18. For kort at opsummere:

  1. Deparaffinize vævs sektionerne ved at suge slidene i xylen (2x, 10 min hver). Derefter rehydreres sektionerne ved at inkuhere diasene i 5 min hver i graderet ethanol (100%, 95%, 90%, 80% og 70%), efterfulgt af en destilleret vand vask og farvning med hematoxylinlegemer (30 s Soak).
  2. Efter hematoxylinlegemer farvning, vask vævs sektioner med vand. Dehydrat derefter vævs sektionerne ved at placere dem i klassificeret ethanol (70%, 80% 90%, 95%, 100%) (5 min. hver) efterfulgt af xylen (5 min).
  3. Analysér den tilsvarende hematoxylinlegemer og eosin (H & E) slides til at identificere tumor områder (dvs., adenokarcinomer eller NED) og markere disse tumor områder og normale tilstødende områder med bistand fra en bestyrelse-certificeret patolog. Ved hjælp af disse H & E slides som køreplaner, markere hematoxylin-farvede væv opnået i ovenstående trin for at skelne mellem tumoren og normale områder.
  4. Dissekere den markerede vævs slide omhyggeligt under mikroskopet ved hjælp af en skalpel klinge.
  5. Saml det dissekerede væv fra normale og cancerøse områder i separate rør ved hjælp af elektrostatisk ladede gel-pipettespidser. Den ladede spids tiltrækker det dissekerede væv og giver mulighed for maksimal vævs restitution efter dissektion. Når vævet klæber til den ladede spids, skæres spidsen ind i et tomt 2 mL opsamlings glas.

2. isolering af Serumafledte EVs-

Bemærk: Frosne patient serumprøver indsamlet fra patienter med metastatisk CRPC med adenokarcinom-egenskaber (CRPC-adeno) eller NE-differentiering (CRPC-NE) blev udtaget fra PCBN ved hjælp af en godkendt IRB-protokol og opbevaret ved-80 °C forud for deres anvendelse. Der blev indsamlet serum prøver fra det samme sæt patienter, som anvendes til mikrodissekeret væv, for at muliggøre sammenligning mellem det tilsvarende væv og den serum afledte EVs. Et kommercielt tilgængeligt serum-EV-isolations reagens blev brugt til at indsamle evt.

  1. Tø frosne patient serumprøver ved 4 °C.
  2. Brug 110 μL optøet serum prøve og spin ved 2.000 x g i 30 min.
  3. Saml supernatanten for efterfølgende EV/exosome isolation og kassere snavs pellet. Tilsæt 30 μL serum exosomvesikler isolations reagens til supernatanten og Inkuber ved 4 °C i 30 min.
  4. Spin ved 10.000 x g i 10 min. Saml det EV-depleterede serum forsigtigt uden at forstyrre pellet i et separat 1,5 ml rør og opbevar ved-80 °c for fremtidig analyse, hvis det er nødvendigt.
  5. Resuspension af EV-pellet i 70 μL fosfat bufferet saltvand (PBS), som er fremstillet i nuklease frit Hold en alikvot for partikel sporings analysessystemet for at vurdere kvaliteten og antallet af partikler. Resten af prøven opbevares ved-80 °C indtil yderligere analyse.

3. RNA-isolation fra Mikrodissekeret prostata væv og evt

Bemærk: Total RNA blev isoleret fra mikrodissekeret væv og renset EVs ved hjælp af et kommercielt tilgængeligt sæt (tabel over materialer) i fabrikantens anvisninger med nogle få modifikationer. De følgende afsnit beskriver kort disse procedurer med særlig vægt på de vigtige skridt:

  1. Isoler RNA fra det mikrodissekted væv.
    1. Resuspension af det microdissekeret FFPE-væv i 150 μL proteinase K-buffer. Bland med vortexning og pipette ud det resterende væv fra spidsen. Spin ved 11.000 x g i 1 min.
    2. Tilsæt 10 μL proteinase K til pellet. Vent i 2 minutter, indtil pellet bliver hvidt. Pipetten op og ned et par gange.
    3. Inkuber ved 56 °C i 16 min. vortex hver 3 min.
    4. Fjern prøverne, og lad varme blokken nå op på 80 °C. Prøverne inkubates på blokken i 16 min. vortex hver 3 min.
    5. Inkuber på is i 3 minutter.
    6. Spin ved 20.000 x g i 15 min. Overfør supernatanten til et nyt 2 ml rør.
    7. Tilsæt 16 μL DNase-booster buffer efterfulgt af 10 μL DNase I. mix ved at invertere røret forsigtigt og inkubere ved stuetemperatur (RT) i 15 min.
    8. Tilsæt 320 μL røde blodlegemer (RBC) lyse buffer. Bland ved at invertere røret og tilsæt derefter 1.120 μL 100% ethanol. Straks overføres på spin kolonner, der opbevares ved 4 °C. Spin ved 8.000 x g for 30 s.
    9. Vask kolonnerne 2x med vaskebuffer og drej kolonnerne ved 20.000 x g i 5 minutter for at fjerne rest vaskebuffer.
    10. Lad spin søjlen lufttørre i 2 − 3 minutter, og elueres derefter med 19 μl RNase-frit vand. Kvantificere det rensede RNA på et spektrofotometer og normalisere prøven til 40 ng/μL.
  2. RNA-isolation fra den serum afledte EVs.
    1. Isoler det exosomale RNA ved hjælp af et sæt. Der tilsættes 75 μL lyse buffer A og 9,3 μL lysisbuffer B til 50 μL af den rensede EV-suspension.
      Bemærk: Prøven blandes ved at invertere røret i ca. 10 min. for at muliggøre fuldstændig lyse af evt.
    2. Tilsæt 130 μL 100% ethanol, og bland det straks ved at invertere prøven. Overfør på en spin kolonne og drej derefter på 3.300 x g i 1 min.
    3. Vask søjlen 2x med vaskebufferen. Drej kolonnen ved 1.300 x g i 3 min. for at fjerne vaskebufferen helt.
    4. Lad kolonnen lufttørre i 2 min. Tilsæt 18 μL elueringsbuffer til søjlen, og lad den sidde i 2 min. spin ved 400 x g i 1 min efterfulgt af et andet spin ved 5.800 x g i 3 min.
    5. Gentag trin 3.2.4 med den elueret buffer, der er inkluderet i kittet, for at øge udbyttet af RNA fra prøven.
    6. Kvantificere prøven på et spektrofotometer og normalisere den til 40 ng/μL.

4. forberedelse af bibliotek til små RNA-sekvensering

Bemærk: Et lille RNA-Biblioteks prep-Kit (tabel over materialer) blev brugt til at generere cDNA-biblioteker fra de isolerede RNA-prøver. Trinene til at generere biblioteker, rense og kvalitet kontrollere dem før du kører på en sequencer er afgørende for enhver sekvensering protokol, som de i sidste ende bestemme kvaliteten af output data fra en løbetur. Fortsæt derfor forsigtigt med hvert trin. Retningslinjerne fra producenten foreslår at bruge et minimum af 50 ng af RNA. I betragtning af den dårlige kvalitet og lave mængder af total RNA normalt opnået fra disse to prøve kilder, denne protokol er optimeret til RNA koncentrationer så lavt som 100 ng. Nedenstående protokol er til et udsnit af et bibliotek.

  1. Generer adapter-ligated cDNA.
    1. Brug 5 μL af en normaliseret (40 ng/μL) RNA-prøve. Tilsæt 1 μL 3 ' adapter. Den termiske variator foropvarmes til 70 °c, inden prøverne inkuberet. Inkuber i 2 min. straks at overføre prøverne på is, før du går videre til næste trin.
    2. I et separat rør blandes 2 μL ligations buffer, 1 μL Rnasehæmmer og 1 μL T4 RNA-Ligase 2, en sletnings mutant. Bland ved pipettering op og ned, og tilsæt 4 μL af denne blanding til røret med RNA/3-adapteren.
    3. Overfør til den termiske variator, der er forvarmet til 28 °c, og Inkuber i 1 time.
    4. Tilsæt 1 μL stopopløsning, mens prøverne holdes på den termiske blok. Inkuber ved 28 °C i yderligere 15 minutter.
    5. Fjern rørene og hold på isen umiddelbart efter dette trin.
    6. I et separat rør tilsættes 1 μL 5 ' adapter.
    7. Overfør til en termisk variator, der er forvarmet til 70 °c, og Inkuber i 2 min.
    8. Anbring straks røret på isen for at forhindre genudglødning af adaptorerne.
    9. Tilsæt 1 μL 10 mM ATP til røret af denatureret 5 ' adapter. Bland ved pipettering og tilsæt 1 μL T4-RNA-ubiquitinligase til blandingen. Bland ved pipettering og tilsæt 3 μL af denne blanding til røret, der indeholder det 3 ' adapter-ligerede RNA. Overførsel på den termiske variator, der er forvarmet til 28 °c og Inkuber i 1 time.
    10. Straks overføres til is og enten fortsættes med prøverne eller opbevares ved-20 °C til fremtidig brug.
    11. For at udføre RT-PCR skal du bruge 6 μL af hvert adapter-ligeret RNA og tilføje 1 μL RNA RT primer til den. Overføres til den termiske variator, der er forvarmet til 70 °c. Inkuber i 2 min.
    12. I et separat rør blandes 2 μL 5x strand buffer, 0,5 μL 12,5 mM dNTPs, 1 μL 100 mM DTT, 1 μL Rnasehæmmer og 1 μL revers transkriptase. Tilsæt 5,5 μl af denne blanding til det adapter ligerede RNA og Overfør til den termiske variator, der er forvarmet til 50 °c. Inkuber i 1 time.
    13. Straks overføre det adapter ligerede cDNA til is.
    14. I et separat rør blandes 25 μL PCR-mix, 2 μL RNA-PCR-primer, 2 μL RNA-PCR-primer-indeks og 8,5 μL RNase-frit vand. Tilsæt 37,5 μL af denne blanding til 12,5 μL adapter-ligeret cDNA. Overføres til den termiske variator, der er forvarmet til 98 °c. Program termisk variator som foreslået i producentens protokol med cyklus nummer modificeret til 15 i stedet for 11.
      Bemærk: Sekvenser af alle de anvendte primere er opført under tabel over materialer.
    15. Prøverne opbevares ved 4 °C efter afslutning. Fortsæt med dem eller Opbevar ved-80 °C til fremtidig brug.
  2. Renser og udfører kvalitetskontrol for det ligerede cDNA.
    Bemærk: Forstærket cDNA blev gel-renset ved at følge producentens protokol med undtagelse af nogle få modifikationer for at forbedre kvaliteten og udbyttet af rensede cDNA-prøver som forklaret nedenfor.
    1. Brug 6% TBE polyacrylamid geler til at rense det forstærkede cDNA. Fortynd højopløsnings stigen (HRL) og brugerdefinerede RNA-stigen (CRL) med lige store mængder DNA-belastnings farve.
    2. Tilsæt 10 μL DNA-belastnings farve til hver cDNA-prøve. 30 μL af hver prøve udtages i to separate kørebaner ved siden af hinanden med CRL og HRL i mellemrummet mellem de to forskellige prøver.
    3. Kør gelen i 1x TBE-buffer ved 145 V i ca. 30 − 40 minutter.
      Bemærk: Hold styr på den nedre blå front af belastningen farvestof. Stop elektroforesen, når den nærmer sig bunden af gel.
    4. Gel overføres i 1x TBE-buffer med Ethidium bromid (EtBr) ved 0,5 μg EtBr/1 mL 1x TBE.
      Forsigtig: Etbr er et kendt kræftfremkaldende og hvert skridt herfra, indtil excision fra gelen skal udføres med ekstrem forsigtighed.
    5. Visualiser gelen i en transilluminator, og skær gelen præcist mellem 145 BP og 160 BP-mærket.
      Bemærk: Adapter dimere kører meget tæt på 145 BP-mærket. Skær derfor gelen lidt over 145 BP-mærket for at undgå kontaminering med adapter dimer.
    6. Gelen overføres til DNA-brydende rør, som opbevares i 2 mL opsamlings glas. Spin ved 20.000 x g i 2 min. Tilsæt 300 ΜL RNase frit vand, og lad det rotere forsigtigt på en rocker natten over ved rt.
    7. For at udføre DNA-udfældningen, den følgende dag overføre indholdet af røret til 5 μm filter rør. Spin ved 600 x g for 10 s.
      Bemærk: Lad ikke rørene spinne længere end 10 s, når gelen passerer gennem filteret.
    8. Tilsæt 2 μl glykogen, 30 μl 3 M naoac, 2 μl 0,1 x pellet maling og 975 μl 100% ethanol til det elueret DNA. Spin ved 17.000 x g ved 4 °c i 20 min.
    9. Kassér supernatanten og tilsæt 75% ethanol til at vaske pellet. Spin ved 17.000 x g ved 4 °c i 5 min. kassér supernatanten og Inkuber rørene ved 37 °c for at fordampe ethanol fuldstændigt.
    10. Resuspension af pellet med 12 μL 10 mM Tris-HCl pH 8,5.
    11. Udfør en kvalitetskontrol af bibliotekets kvalitet ved at fortynde det rensede cDNA med 10x (1:10) og bruge 1 μL fortyndet cDNA til at køre på en bio-analysator.
    12. Sørg for, at cDNA-produktets størrelse svarer til rækken af små RNA (136 − 160 BP) i elektro pherogrammet. Beregn den totale Molaritet for hver prøve. Normaliserer hver prøve til 2 nM ved hjælp af Tris-HCl pH 8,5.
  3. Og sekvens af det rensede cDNA.
    1. Du bør samle bibliotekerne ved at blande lige store mængder af hver 2 nM-prøve i et enkelt 200 μL PCR-rør. Tilsæt 10 μL frisklavet 0,2 N NaOH til 10 μL poolet bibliotek.
    2. Bland straks ved vortexing, og spin ved 280 x g i 1 min. INKUBER ved rt i 5 min.
    3. Tilsæt 10 μL 200 mM Tris-HCl pH 7 til 20 μL af det denaturerede bibliotek. Bland ved vortexning og spin ved 280 x g i 1 min.
    4. Tilsæt 970 μL forkølet hybridiserings buffer til biblioteket og bland godt ved vortexing. Biblioteket er i en koncentration på 20 pM. Opbevares på is, indtil det endelig er fortyndet.
      Bemærk: Den endelige fortynding sker lige før du kører på sequencer.
    5. Tilsæt 117 μL af det denaturerede bibliotek til 1.183 μL forkølet hybridiserings buffer. Bland ved at invertere røret og puls centrifugen. Den endelige koncentration af biblioteket er nu 1,8 pM.
    6. Tilsæt 1,3 μL PhiX til 1,3 mL af det endelige bibliotek. Hvis du vil starte en kørsel på en sequencer, skal du følge vejledningen på skærmen på softwaregrænsefladen, gennemse kørsels parametrene, herunder læse type (enkelt læst), læse længde (antal cyklusser for hver læsning), biblioteks-ID og vælge Start.

5. data analyse

  1. I slutningen af sequencer Run, få de resulterende sekvensering data som fastQ filer. Brug den relevante software til at analysere de resulterende sekvensering data.
  2. Åbn fastQ Toolkit-applikationen, og tryk på Start -knappen.
  3. Vælg filerne på listen over prøver i softwaren, og vælg, hvor dataene skal gemmes.
  4. Tilføj et strengnavn, der gælder for hver trimmet sekvens. Hold strenghed til 0,9. Indtast adapter sekvensen for at trimme som "TGGAATTCTCGGGTGCCAAGG" fra den 3 ' ende af hver sekvens prøve. Udvid fanen læse filtrering , og vælg en minimum læse længde på "5". Vælg feltet Bekræft , og tryk på knappen Fortsæt for at starte trimning. De trimmede filer vil blive gemt i projektmappen, når analysen er afsluttet.
  5. Åbn det lille RNA v. 1.0 -program på softwaren, og tryk på Start -knappen.
  6. Vælg det projekt, hvor filerne skal gemmes og sendes efter analysen.
  7. Vælg funktionen Novel Mirs og differential Mirs i applikationen. Adskille grupperne som "kontrol" og "test" for differentiel analyse og tilføje de trimmede filer, der skal analyseres i deres respektive grupper.
  8. Vælg knappen Start for at starte analysen. Efter analyserne, downloade de resulterende filer.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Biblioteket blev udarbejdet efter RNA-isolation, og der blev udført en kvalitetskontrol. Gel rensning for det forstærkede cDNA-bibliotek fremstillet af RNA isoleret fra mikrodissekerede væv og serumafledte EVs er vist i figur 1 og figur 2. Produktstørrelsen for adapter ligerede miRNAs svarede til ca. 136 − 160 BP for hver prøve. Figur 1A-B er markeret til at vise det område af gelen, der nøjagtigt skal exciseres til forberedelse af små RNA-biblioteker. Figur 2A-B viser gelelektroforese og elektro pherogrammer for det mikrodissekeret væv og den serum afledte EVS. Supplerende figur 1 viser et repræsentativt resultat fra elektroforese maskinen og metoden til beregning af Molaritet.

Der blev udført trin til at hente bibliotekets Metrics, før der blev kørt på en sequencer. Figur 3 viser de repræsentative Metrics fra en lille RNA-sekvensering, der viser den forventede klynge tæthed, QC-score, klynge, der passerer filter procenten, og anslået udbytte og fejlprocenter. Figur 3A og figur 3C viser tabellerne med alle Run parametre og graf for QC score over forskellige cyklusser. Figur 3B, D er grafiske repræsentationer af fejlprocenten for phix-justering over forskellige cyklusser. De leverede data er fra analysesoftwaren på stedet.

En kommercielt tilgængelig software applikation (tabel over materialer) blev brugt til at analysere de sekvenserede prøver fra mikrodissekeret væv og serum afledte EVS. De sekvenserede prøver blev trimmet fra adapter sekvenserne ved hjælp af FASTq Toolkit efterfulgt af analyse på applikationen "Small RNA v. 1.0". Figur 3 viser de resulterende data ved analyse. Tabel 1 og tabel 2 viser de samlede læsninger fra mikrodissekeret væv og serum afledt EVS-sekvens kørsel. Figur 3A og figur 3B viser den lille RNA-længde fordeling for de to prøve kilder.

Figure 1
Figur 1: bibliotek forberedelse til sekvensering lille ikke-kodning RNA. Polyacrylamid cDNA-gel til de forstærkede biblioteker fra (A) mikrodissekeret FFPE-vævs-RNA og (B) RNA fra renset serum afledt EVS. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: kvalitetskontrol for sekventering lille ikke-kodning RNA. Repræsentativt billede for gel elektroforese og elektro pherogram for renset cDNA-bibliotek for (A) mikrodissekeret FFPE-væv og (B) serum afledt EVS. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3: Kør Metrics for Small RNA-sekvensering. Tabel-og grafisk gengivelse af køre parametre% Q ≥ 30, klynge tæthed, klynge, der passerer filter%, anslået afkast og Q-score for sekvensering,derløber fra (A) mikrodissekeret FFPE-væv ogC) serum afledt EVS. Grafisk gengivelse af fejlprocenter for PhiX-justering over forskellige cyklusser for sekvensering løber fra (B) mikrodissekeret FFPE-væv og (D) serum afledt EVS. Fejllinjer repræsenterer standardafvigelsen for fejlprocenterne for hver cyklus. Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4: forventede udfald fra en lille ikke-kodning RNA sekvensering køre. Små RNA-læse længder til bibliotek fra (A) mikrodissekeret FFPE-væv og (B) serum afledt EVS. Venligst klik her for at se en større version af dette tal.

Prøve Total sekvensering læser
1 92, 68658
2 70, 00551
3 1, 56, 41204
4 1, 50, 46681
5 1, 42, 82756
6 1, 27, 38970
7 1, 57, 21318
8 88, 51578
9 1, 32, 16879
10 1, 14, 66162
11 1, 91, 14932

Tabel 1: Total sekvensering læser for en lille RNA-sekvensering, der løber fra microdissekeret FFPE-væv. Procentdel af læsninger svarende til små RNAs for sekvenserede FFPE-prøver, der blev opnået efter analyse.

Prøve Total sekvensering læser
1 2, 30, 88960
2 1, 77, 69806
3 90, 37884
4 87, 26243
5 73, 23571
6 2, 89, 37388
7 76, 52149
8 1, 30, 07122
9 54, 34386
10 93, 05941
11 94, 53760
12 82, 79773

Tabel 2: samlet sekvens aflæsninger for en lille RNA-sekvensering, der løber fra oprenset, serum afledt EVS. Procentdel af læsninger svarende til små RNAs for sekvenserede EV-prøver opnået efter analyse.

Supplementary Figure 1
Supplerende figur 1: kvalitetskontrol for sekvensering af mindre ikke-kodnings-RNA. Repræsentative resultater fra en elektroforese maskine, der viser den samlede Molaritet af den angivne prøve. Venligst klik her for at se en større version af dette tal.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

I denne artikel beskriver vi en protokol for at isolere RNA fra FFPE-væv og serum afledte EVs ved hjælp af kits, der blev optimeret til at øge udbyttet og kvaliteten af isolerede RNAs. Desuden blev de rensede RNAs brugt til at generere cDNA-biblioteker til små RNA-sekvensering. Begge de anførte trin er afgørende for fastsættelsen af kvaliteten og dybden af sekvensering læser, der er det endelige resultat fra Run24. Derfor er optimering af disse afgørende trin afgørende for en vellykket sekvens kørsel.

Et vigtigt skridt i isolationen af FFPE-afledte RNA er fordøjelsen med proteinase K, der giver mulighed for fjernelse af tværbundet formalin fra vævet. Dette trin er blevet optimeret ved inkuberet af prøven ved 55 °C og 80 °C i ca. 16 − 18 minutter hver. Dette resulterede i en effektiv stigning i kvaliteten af isolerede RNA ved en stigning i forholdet 260/280. Sekvensering læser er ofte variabel for en løbetur, der omfatter flere prøver. Derfor, at kontrollere mængden af RNA-indgange i starten af biblioteket forberedelse giver mulighed for ensartethed i biblioteket. Brug af normaliseret RNA hjælper med at udjævne en sekvensering, der kører ensartet på tværs af forskellige prøver. Det mest kritiske trin i biblioteket forberedelse er rensning af forstærket adapter ligeret cdnas. Det er meget vigtigt at omhyggeligt punktafgifts ende geler over 140 BP markør, fordi en lille afvigelse mod bunden af markøren fører til kontaminering af adapteren dimers. Endelig er normaliseringen af cDNA-biblioteket det vigtigste trin i sekvente Rings protokollen og bør gøres præcist baseret på den beregnede normalitet fra elektroforese maskinen.

I tilfælde af en adapter dimer forurening, kan man køre det rensede bibliotek på en TBE gel og fraholde det ønskede produkt. Udbyttet af cDNA-biblioteket i en sådan ekstraktion er imidlertid faldet markant, hvilket kan påvirke læse længden fra prøven. For et skøn over koncentrationen af det rensede cDNA-bibliotek, kan man fortynde prøverne, før de kører på elektroforese maskine baseret på produktets intensitet i TBE-geler og forberede forskellige fortyndinger (dvs. 5x, 10x, eller 25x). For yderligere at forbedre skønnet over de rensede cDNA-biblioteker hjælper det at køre en qPCR ud over elektroforese med at evaluere skabelon niveauerne og giver mulighed for mere nøjagtig normalisering.

Selv om ultracentrifugering er guldstandarden for isolering af EVs fra forskellige kilder, begrænser et lavere udbytte af partiklerne fra en sådan ekstraktion ofte anvendelsen af denne metode til rensning af EVs, hvor udgangsmaterialet er begrænset, og en betydelig mængde der er behov for input-RNA til downstream-applikationer. Således, brug af total exosomvesikler isolation reagens giver en langt hurtigere og højere udbytte metode for EV isolation fra begrænsede kilder som serum og plasma fra kliniske prøver.

I alt beskriver denne protokol metoderne til generering af cDNA-biblioteker på en mere effektiv måde, samtidig med at der tages hensyn til udbyttet og kvaliteten af cDNA-bibliotekerne for at få nøjagtige og omfattende sekvensering. I betragtning af potentialet i exosomer som en kilde til kræft biomarkører, denne metode til næste generation sekventering (NGS) analyser af exosomal Mirna indhold vil være nyttige for forskning i marken.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingen interessekonflikt at erklære.

Acknowledgments

Dette arbejde understøttes af den amerikanske hær for medicinsk forskning erhvervelse aktivitet (USAMRAA) gennem ideen udvikling Award under Award No. W81XWH-18-1-303 og W81XWH-18-2-0013 og desuden ved tildeling nr. W81XWH-18-2-0015, W81XWH-18-2-0016, W81XWH-18-2-0017, W81XWH-18-2-0018, og W81XWH-18-2-0019 prostata cancer Biorepository Network (PCBN). Det erkendes også, at der ydes støtte til forfatterne af National Cancer Institute på National Institutes of Health (Tilskudsnummer RO1CA177984). Rajvir Dahiya er en senior forskerkarriere forsker ved Department of Veterans Affairs, BX004473 og finansieret af NIH-UO1CA199694 (RD). Meninger, fortolkninger, konklusioner, og anbefalinger er dem af forfatteren og er ikke nødvendigvis godkendt af Department of Defense eller U.S. Army. Vi er taknemmelige for Judy Shigenaga, direktør for Core Facility i San Francisco VAMC, for hendes assistance med NextSeq 500 sequencer.

Materials

Name Company Catalog Number Comments
3 M NaOAc pH 5.5 USB Corp. 75897 100 mL
5 µm filter tubes IST Engineering Inc. 5388-50
6% TBE polyacrylamide gels Novex EC6265BOX
BaseSpace Illumina Analysis software
Bio-analyzer Agilent
DNA loading dye Novex LC6678
Eppendorf Thermostat plus Eppendorf 1.5 mL
EtBr Pierce 17898
Ethyl alcohol 200 proof Pharmco 111000200
Exosomal RNA isolation kit Norgen 58000
Gel breaking tubes IST Engineering Inc. 3388-100
Glycogen molecular biology grade Thermo Scientifc R0561
Hematoxylin Select Stat lab SL401
Microcentrifuge Fisher Scientific 13-100-676 accuSpin Micro 17R
miRNeasy FFPE kit Qiagen 217504
Nanodrop Thermo Scientifc Nano Drop 1000
Nanosight NTA Malvern LM14
NextSeq 500 Sequencer Illumina
NextSeq 500/550 Mid Output Kit v2 (150 cycles) Illumina FC-404-2001
Pellet paint Millipore 70748-3
Superscript II Reverse Transcriptase Invitogen 18064014
T4 RNA Ligase 2 Deletion Mutant Lucigen LR2D11310K
TBE Running buffer (5x) Novex LC6675
Thermal cycler MJ Research PTC100
Total exosome isolation reagent (from serum) Invitrogen 4478360
TrueSeq small RNA library Prep kit-Set A (Indexes 1-12) Illumina RS-200-0012
Xylene Fisher Scientific X3P- 1GAL
RNA 3' Primer GUUCAGAGUUCUACAGUCCGACGAUC
RNA 5' Primer TGGAATTCTCGGGTGCCAAGG
Stop Oligo GAAUUCCACCACGUUCCCGUGG
RNA RT Primer GCCTTGGCACCCGAGAATTCCA
RNA PCR Primer AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA
RNA PCR Index Primer CAAGCAGAAGACGGCATACGAGAT[6 bases]GTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
- - - 6 bases in adapter
RNA PCR Index Primer 1 CGTGAT
RNA PCR Index Primer 2 ACATCG
RNA PCR Index Primer 3 GCCTAA
RNA PCR Index Primer 4 TGGTCA
RNA PCR Index Primer 5 CACTGT
RNA PCR Index Primer 6 ATTGGC
RNA PCR Index Primer 7 GATCTG
RNA PCR Index Primer 8 TCAAGT
RNA PCR Index Primer 9 CTGATC
RNA PCR Index Primer 10 AAGCTA
RNA PCR Index Primer 11 GTAGCC
RNA PCR Index Primer 12 TACAAG

DOWNLOAD MATERIALS LIST

References

  1. Heinlein, C. A., Chang, C. Androgen receptor in prostate cancer. Endocrine Reviews. 25, (2), 276-308 (2004).
  2. Tilki, D., Schaeffer, E. M., Evans, C. P. Understanding Mechanisms of Resistance in Metastatic Castration-resistant Prostate Cancer: The Role of the Androgen Receptor. European Urology Focus. 2, (5), 499-505 (2016).
  3. Vlachostergios, P. J., Puca, L., Beltran, H. Emerging Variants of Castration-Resistant Prostate Cancer. Current Oncology Reports. 19, (5), 32 (2017).
  4. Aggarwal, R., Zhang, T., Small, E. J., Armstrong, A. J. Neuroendocrine prostate cancer: subtypes, biology, and clinical outcomes. Journal of the National Comprehensive Cancer Network. 12, (5), 719-726 (2014).
  5. Beltran, H., et al. Divergent clonal evolution of castration-resistant neuroendocrine prostate cancer. Nature Medicine. 22, (3), 298-305 (2016).
  6. Calin, G. A., Croce, C. M. MicroRNA signatures in human cancers. Nature Reviews Cancer. 6, (11), 857-866 (2006).
  7. Coppola, V., De Maria, R., Bonci, D. MicroRNAs and prostate cancer. Endocrine-Related Cancer. 17, (1), 1-17 (2010).
  8. Ambs, S., et al. Genomic profiling of microRNA and messenger RNA reveals deregulated microRNA expression in prostate cancer. Cancer Research. 68, (15), 6162-6170 (2008).
  9. Lu, J., et al. MicroRNA expression profiles classify human cancers. Nature. 435, (7043), 834-838 (2005).
  10. Bhagirath, D., Yang, T. L., Dahiya, R., Saini, S. MicroRNAs as Regulators of Prostate Cancer Metastasis. Advances in Experimental Medicine and Biology. 1095, 83-100 (2018).
  11. Hoshino, A., et al. Tumour exosome integrins determine organotropic metastasis. Nature. 527, (7578), 329-335 (2015).
  12. Colombo, M., Raposo, G., Thery, C. Biogenesis, secretion, and intercellular interactions of exosomes and other extracellular vesicles. Annual Review of Cell and Developmental Biology. 30, 255-289 (2014).
  13. Bhagirath, D., et al. microRNA-1246 Is an Exosomal Biomarker for Aggressive Prostate Cancer. Cancer Research. 78, (7), 1833-1844 (2018).
  14. Witte, J. S. Prostate cancer genomics: towards a new understanding. Nature Reviews Genetics. 10, (2), 77-82 (2009).
  15. Kim, J. H., et al. Deep sequencing reveals distinct patterns of DNA methylation in prostate cancer. Genome Research. 21, (7), 1028-1041 (2011).
  16. Robinson, D., et al. Integrative clinical genomics of advanced prostate cancer. Cell. 161, (5), 1215-1228 (2015).
  17. Kim, J., Yu, J. Interrogating genomic and epigenomic data to understand prostate cancer. Biochimica Et Biophysica Acta. 1825, (2), 186-196 (2012).
  18. Bucay, N., et al. miRNA Expression Analyses in Prostate Cancer Clinical Tissues. Journal of Visualized Experiments. (103), e53123 (2015).
  19. Geiss, G. K., et al. Direct multiplexed measurement of gene expression with color-coded probe pairs. Nature Biotechnology. 26, (3), 317-325 (2008).
  20. Tam, S., de Borja, R., Tsao, M. S., McPherson, J. D. Robust global microRNA expression profiling using next-generation sequencing technologies. Laboratory Investigation. 94, (3), 350-358 (2014).
  21. Rodriguez, M., et al. Identification of noninvasive miRNAs biomarkers for prostate cancer by deep sequencing analysis of urinary exosomes. Molecular Cancer. 16, (1), 156 (2017).
  22. Guelfi, G., et al. Next Generation Sequencing of urine exfoliated cells: an approach of prostate cancer microRNAs research. Scientific Reports. 8, (1), 7111 (2018).
  23. Daniel, R., et al. A Panel of MicroRNAs as Diagnostic Biomarkers for the Identification of Prostate Cancer. International Journal of Molecular Sciences. 18, (6), 1281 (2017).
  24. Xuan, J., Yu, Y., Qing, T., Guo, L., Shi, L. Next-generation sequencing in the clinic: promises and challenges. Cancer Letters. 340, (2), 284-295 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics