체계적인 대규모 합성 유전자 (유전자 유전자 또는 epistasis) 상호 작용 화면은 유전 이중화 및 경로 간 대화를 탐험하는 데 사용할 수 있습니다. 여기, 우리는 높은 처리량 정량 합성 유전자 배열 검사 기술을 설명, eSGA 우리는 epistatic 관계를 elucidating과의 유전 적 상호 작용 네트워크를 탐험하기 위해 개발이 칭했다<em> 대장균</em>.
Phenotypes는 물리적 (단백질 단백질 등) 및 기능 (예 : 유전자 – 유전자 또는 유전자)의 상호 작용 (GI) 1의 복잡한 일련의에 의해 결정됩니다. 물리적 상호 작용은 세균의 단백질은 단지로 등록 된 표시 할 수 있지만, 반드시 경로 수준의 기능 relationships1를 공개하지 않습니다. 이 삭제되거나 inactivated 유전자를 베어링 더블 돌연변이의 성장을 측정하고 해당 단일 돌연변이에 비해되어있는 GI 화면, loci 사이 epistatic 종속성을 조명하고 따라서 새로운 기능의 관계 2 검색하고 발견 할 수있는 수단을 제공 할 수 있습니다. 대형 GI지도는 효모 3-7과 같은 진핵 생물에 대해보고 있지만, GI 정보는 박테리아 genomes의 기능 주석을 방해 prokaryotes 8에 대한 희박한 유지되었습니다. 이를 위해, 우리와 다른 사람들은 높은 처리량 정량 세균 GI 검사 방법 9, 10을 개발했습니다 </>를 논의하게 될 것입니다.
여기, 우리는 양적 E.를 수행하는 데 필요한 주요 단계를 제시 체계적으로 생성하고 식민지 배열 형식의 이중 돌연변이 다수의 피트니스을 측정하기 위해 자연 박테리아 활용과 상동 재조합을 사용하여 대장균 게놈 규모의 9 합성 유전자 배열 (eSGA) 심사 절차. 간단히, 로봇이 전송하는 데 사용됩니다 , 활용을 통해 chloramphenicol (CM)는 – 마크 F-받는 종자 – 엔지니어링 Hfr에서 돌연변이 대립 유전자 (재조합 높은 주파수) kanamycin의 정렬 배열 (관)에 '기증자 변종'을 표시했습니다. 일반적으로, 우리는에 손실 기능을 중요하지 않은 유전자 삭제를 베어링 단일 돌연변이 ( '케이'컬렉션 11 예)와 필수 유전자 hypomorphic 변이를 (감소 단백질 표현, 안정성, 또는 활동 9, 12, 13를 부여 즉 대립 유전자)를 사용 중요하지 않은, 필수 유전자, 고해상도의 기능 연관을 쿼리pectively. 상동 재조합에 의해 활용하고 다음의 유전자 교환 인한 후, 결과를 두 번 돌연변이는 모두 항생제를 포함하는 고체 매체에 선택됩니다. 가지 후, 플레이트는 디지털 이미징하고 식민지 크기는 양적 내부 자동 이미지 처리 시스템 14를 사용하여 채점하고 있습니다. GIS는 이중 돌연변이의 성장 속도가 예상보다 9 중 훨씬 더 나은 또는 더 나쁜 경우 공개됩니다. 악화 (또는 부정적) GIS는 종종 같은 필수 과정 2 가해진 보상 경로에서 유전자 쌍의 손실 기능 돌연변이 사이에 발생. 여기 하나의 유전자의 손실은 단일 돌연변이가 가능한이 같은 것을 버퍼입니다. 그러나 두 경로의 손실이 해로운이며, 합성 lethality 또는 질병 (즉, 느린 성장)에 발생합니다. 반대로, 경감 (또는 긍정적) 상호 작용과 같은 경로 나 복잡한 단백질 2 유전자 사이에 발생할 수 있습니다혼자 두 유전자의 삭제는 종종 경로 또는 추가 섭동 더, 따라서 성장을 활동을 줄이고하지 않는 등 단지의 정상적인 기능을 교란하기에 충분합니다. 전반적으로, 체계적으로 파악하고 GI 네트워크를 분석하는 것은 다른 방법으로 놓친 경로 수준의 정보가 9 유추 할 수있는 유전자, 많은 수의 사이의 기능적 관계의 편견, 글로벌지도를 제공 할 수 있습니다.
우리는 GI을 조사하여 경로 수준에서 박테리아 유전자 기능을 조사하기 위해 로봇 eSGA 검사를 사용하기위한 단계 – 현명한 프로토콜을 설명하고 있습니다. 이 접근 방식은 E.에서 개별 유전자뿐만 아니라 전체 생물 시스템을 연구하는 데 사용할 수 있습니다 대장균. 조심스럽게 모든 적절한 컨트롤을 포함 위에서 설명한 실험 단계를 실행하고, 엄격하게 분석하고 독립적으로 GI 데이?…
The authors have nothing to disclose.
이 작품은 게놈 캐나다, 온타리오 유전체학 연구소, 그리고 JG 및 AE AG에 대한 건강 연구 보조금의 캐나다 연구소의 자금에 의해 지원되었다 Vanier 캐나다 대학원 장학금의 수상자이다.
I. Antibiotics | 2 | 36471 Remove |
||||
Chloramphenicol | Bioshop | #CLR201 | 3 | 36472 Remove |
||
Kanamycin | #KAN201 | 4 | 36480 Remove |
|||
Ampicillin | # AMP201 | 5 | 36473 Remove |
|||
2. Luria-Bertani medium | 6 | 36474 Remove |
||||
LB powder | Bioshop | #LBL405 | 7 | 36478 Remove |
||
Agar | Bioshop | #AGR003 | 8 | 36481 Remove |
||
3. Bacterial Strains and Plasmids | 9 | 36475 Remove |
||||
Hfr Cavalli strain λred system (JL238) | Babu et al.14. | 10 | 36476 Remove |
|||
pKD3 | E. coli Genetic Stock Centre, Yale | 11 | 36477 Remove |
|||
Keio E. coli F- recipient collection | National BioResource Project (NBRP) of Japan11 | 12 | 36479 Remove |
|||
Hypomorphic E. coli F- SPA-tag strains | Open biosystems; Babu et al.14 | 13 | 36491 Remove |
|||
4. Primers | 14 | 36486 Remove |
||||
pKD3-based desalted constant primers | F1: 5′-GGCTGACATGGGAATTAGC-3′ R1: 5′-AGATTGCAGCATTACACGTCTT-3′ |
15 | 36482 Remove |
|||
Desalted custom primers | Cm-R: 5′-TTATACGCAAGGCGACAAGG-3′ Cm-F: 5′- GATCTTCCGTCACAGGTAGG-3′ |
16 | 36483 Remove |
|||
Desalted custom primers | F2 and R2: 20 nt constant regions based on pKD3 sequence and 45 nt custom homology regions F2 constant region: 5′-CATATGAATATCCTCCTTA-3′ R2 constant region: 5′-TGTGTAGGCTGGAGCTGCTTC-3’S1 and S2: 27 nt constant regions for priming the amplification of the SPA-Cm cassette and 45 nt custom homology regions S1 constant region: 5’AGCTGGAGGATCCATGGAAAAGAGAAG -3′ S2 constant region: 5′- GGCCCCATATGAATATCCTCCTTAGTT -3′ KOCO-F and KOCO-C: 20 nt primers 200 bp away from the non-essential gene deletion site or the essential gene SPA-tag insertion site |
17 | 36484 Remove |
|||
5. PCR and Electrophoresis Reagents | 18 | 36485 Remove |
||||
Taq DNA polymerase | Fermentas | # EP0281 | 19 | 36487 Remove |
||
10X PCR buffer | Fermentas | # EP0281 | 20 | 36488 Remove |
||
10 mM dNTPs | Fermentas | # EP0281 | 21 | 36489 Remove |
||
25 mM MgCl2 | Fermentas | # EP0281 | 22 | 36490 Remove |
||
Agarose | Bioshop | # AGA002 | 23 | 36492 Remove |
||
Loading dye | NEB | #B7021S | 24 | 36493 Remove |
||
Ethidium bromide | Bioshop | # ETB444 | 25 | 36497 Remove |
||
10X TBE buffer | Bioshop | # ETB444.10 | 26 | 36494 Remove |
||
Tris Base | Bioshop | # TRS001 | 27 | 36495 Remove |
||
Boric acid | Sigma | # T1503-1KG | 28 | 36496 Remove |
||
0.5 M EDTA (pH 8.0) | Sigma | # B6768-500G | 29 | 36498 Remove |
||
DNA ladder | NEB | #N3232L | 30 | 36499 Remove |
||
6. DNA isolation and Clean-up Kits | 31 | 36500 Remove |
||||
Genomic DNA isolation and purification kit | Promega | #A1120 | 32 | 36501 Remove |
||
Plasmid Midi kit | Qiagen | # 12143 | 33 | 36502 Remove |
||
QIAquick PCR purification kit | Qiagen | #28104 | 34 | 36512 Remove |
||
7. Equipment for PCR, Transformation and Replica-pinning | 35 | 36503 Remove |
||||
Thermal cycler | BioRad, iCycler | 36 | 36504 Remove |
|||
Agarose gel electrophoresis | BioRad | 37 | 36505 Remove |
|||
Electroporator | Bio-Rad GenePulser II | 38 | 36506 Remove |
|||
0.2 cm electroporation cuvette | Bio-Rad | 39 | 36507 Remove |
|||
42 °C water bath shaker | Innova 3100 | 40 | 36508 Remove |
|||
Beckman Coulter TJ-25 centrifuge | Beckman Coulter | 41 | 36519 Remove |
|||
32 °C shaker | New Brunswick Scientific, USA | 42 | 36509 Remove |
|||
32 °C plate incubator | Fisher Scientific | 43 | 36510 Remove |
|||
RoToR-HDA benchtop robot | Singer Instruments | 44 | 36511 Remove |
|||
96, 384 and 1,536 pin density pads | Singer Instruments | 45 | 36513 Remove |
|||
96 or 384 long pins | Singer Instruments | 46 | 36514 Remove |
|||
8. Imaging Equipments | 47 | 36515 Remove |
||||
Camera stand | Kaiser | 48 | 36516 Remove |
|||
Digital camera, 10 megapixel | Any Vendor | 49 | 36517 Remove |
|||
Light boxes, Testrite 16″ x 24″ units | Testrite | 50 | 36527 Remove |
|||
9. Pads or Plates Recycling | 51 | 36518 Remove |
||||
10% bleach | Any Vendor | 52 | 36520 Remove |
|||
70% ethanol | Any Vendor | 53 | 36521 Remove |
|||
Sterile distilled water | Any Vendor | 54 | 36522 Remove |
|||
Flow hood | Any Vendor | 55 | 36523 Remove |
|||
Ultraviolet lamp | Any Vendor | 56 | 36524 Remove |
|||
10. Labware | 57 | 36525 Remove |
||||
50 ml polypropylene tubes | Any Vendor | 58 | 36526 Remove |
|||
1.5 ml micro-centrifuge tubes | Any Vendor | 59 | 36528 Remove |
|||
250 ml conical flaks | VWR | # 29140-045 | 60 | 36529 Remove |
||
15 ml sterile culture tubes | Thermo Scientific | # 366052 | 61 | 36530 Remove |
||
Cryogenic vials | VWR | # 479-3221 | 62 | 36531 Remove |
||
Rectangular Plates | Singer Instruments | 63 | 36532 Remove |
|||
96-well and 384-well microtitre plates | Singer Instruments | Nunc | 64 | 36533 Remove |
||
Plate roller for sealing multi-well | Sigma | #R1275 | 65 | 36535 Remove |
||
plates | ABgene | # AB-0580 | 66 | 36534 Remove |
||
Adhesive plate seals | Fisher Scientific | # 13-990-14 | 67 | 36537 Remove |
||
-80 °C freezer | Any Vendor | 68 | 36536 Remove |