Systematische, groß angelegte synthetische genetische (Gen-Gen-oder Epistase) Interaktion Bildschirme können verwendet werden, um genetische Redundanz und Weg cross-talk zu erkunden. Hier haben wir eine High-Throughput-quantitative synthetischen genetischen array Screening-Technologie beschreiben, bezeichnet ESGA dass wir für die Aufklärung epistatische Beziehungen und erforschen genetische Interaktion Netze in den entwickelten<em> Escherichia coli</em>.
Phänotypen durch eine komplexe Reihe von physikalischen (zB Protein-Protein) und funktionelle (zB Gen-Gen oder genetisches) Wechselwirkungen (GI) 1 bestimmt. Während körperliche Interaktionen können angeben, welche bakterielle Proteine als Komplexe verbunden sind, müssen sie nicht unbedingt enthüllen Weg-level funktionalen Beziehungen1. GI Bildschirmen, in denen das Wachstum der Doppelmutanten, die zwei gelöschte oder inaktivierte Gene gemessen und verglichen mit den entsprechenden einzelnen Mutanten, beleuchten kann epistatischen Abhängigkeiten zwischen Loci und somit ein Mittel zum Abfragen und entdecken neuartigen funktionalen Beziehungen 2. Large-scale GI Karten für eukaryotische Organismen wie Hefe 3-7 berichtet worden, aber GI Informationen bleiben spärlich für Prokaryoten 8, die die funktionellen Annotation von bakteriellen Genome behindert. Zu diesem Zweck haben wir und andere Hochdurchsatz-quantitative bakteriellen GI Screeningverfahren 9, 10 entwickelten </sup>.
Hier präsentieren wir die wichtigsten Schritte erforderlich, um quantitative E. durchführen coli Genetic Synthetische Array (ESGA) Screening-Verfahren auf einem genomweite 9, mit natürlichen bakteriellen Konjugation und homologe Rekombination, um systemisch zu erzeugen und zu messen, das die Eignung einer großen Anzahl von Doppel-Mutanten in einer Kolonie Anordnungsformat. Kurz gesagt, wird ein Roboter verwendet, um zu übertragen durch Konjugation, Chloramphenicol (Cm) – F-markierten Rezipientenstämme – Mutante Allele aus engineered Hfr (High Häufigkeit der Rekombination) 'Donorstämme' in eine geordnete Anordnung von Kanamycin (Kan) markiert. Normalerweise verwenden wir loss-of-function einzelnen Mutanten tragen nicht wesentlicher Deletionen (zB die "Keio" Sammlung 11) und essentielles Gen hypomorphen Mutationen (dh Allele verleihen reduzierte Protein Expression, die Stabilität oder Aktivität 9, 12, 13) fragen die funktionalen Zusammenhänge der nicht-essentielle und essentielle Gene, resziehungsweise. Nach Konjugation und anschließenden genetischen Austausch durch homologe Rekombination vermittelten werden die resultierenden Doppelmutanten auf festem Medium, das sowohl Antibiotika ausgewählt ist. Nach Auswachsen werden die Platten digital bebildert und Koloniegrößen quantitativ erzielt unter Verwendung einer in-house automatisierten Bildverarbeitungssystem 14. GIs enthüllt werden, wenn die Wachstumsrate einer Doppelmutante entweder signifikant besser oder schlechter als erwarteten 9 ist. Erschwerende (oder negative) GIs oft zwischen loss-of-function Mutationen in Paaren von Genen aus kompensatorischen Wege, die auf der gleichen grundlegenden Prozess 2 auftrifft führen. Hier wird der Verlust eines einzelnen Gens gepuffert, so dass entweder einzelne Mutante lebensfähig ist. Allerdings ist der Verlust der beiden Signalwege schädlichen und resultiert in synthetischen Letalität oder Krankheit (dh langsame Wachstum). Umgekehrt kann Linderung (oder positiven) Wechselwirkungen zwischen Genen in der gleichen Weg oder Proteinkomplexes 2 als der auftretenDeletion von entweder Gen allein oft ausreicht, um die normale Funktion des Weges oder komplexer, so dass zusätzliche Störungen nicht verringern Aktivität und damit Wachstum, weiter stören. Insgesamt lassen sich systematisch identifiziert und analysiert GI-Netzwerke bieten unvoreingenommene, globale Karten der funktionalen Zusammenhänge zwischen einer großen Anzahl von Genen, von denen Signalweg-Level-Informationen durch andere Ansätze verpasst 9 entnommen werden kann.
Wir haben eine stufenweise Protokoll für die Verwendung robotischen ESGA Screening, um bakterielles Gen Funktionen auf einen Stoffwechselweg Ebene durch Abfragen GI untersuchen skizziert. Dieser Ansatz kann verwendet werden, um einzelne Gene als auch ganzer biologischer Systeme in E. studieren coli. Sorgfältig Ausführung der experimentellen oben beschriebenen Schritte, einschließlich aller geeigneten Kontrollen und konsequent analysieren und unabhängig validiert die GI-Daten sind wesentliche Aspek…
The authors have nothing to disclose.
Diese Arbeit wurde durch Mittel aus Genome Kanada, Ontario Genomics Institute und der Canadian Institutes of Health Research gewährt JG und AE AG unterstützt wird, ist ein Empfänger von Vanier Canada Graduate Scholarship.
I. Antibiotics | 2 | 36471 Remove |
||||
Chloramphenicol | Bioshop | #CLR201 | 3 | 36472 Remove |
||
Kanamycin | #KAN201 | 4 | 36480 Remove |
|||
Ampicillin | # AMP201 | 5 | 36473 Remove |
|||
2. Luria-Bertani medium | 6 | 36474 Remove |
||||
LB powder | Bioshop | #LBL405 | 7 | 36478 Remove |
||
Agar | Bioshop | #AGR003 | 8 | 36481 Remove |
||
3. Bacterial Strains and Plasmids | 9 | 36475 Remove |
||||
Hfr Cavalli strain λred system (JL238) | Babu et al.14. | 10 | 36476 Remove |
|||
pKD3 | E. coli Genetic Stock Centre, Yale | 11 | 36477 Remove |
|||
Keio E. coli F- recipient collection | National BioResource Project (NBRP) of Japan11 | 12 | 36479 Remove |
|||
Hypomorphic E. coli F- SPA-tag strains | Open biosystems; Babu et al.14 | 13 | 36491 Remove |
|||
4. Primers | 14 | 36486 Remove |
||||
pKD3-based desalted constant primers | F1: 5′-GGCTGACATGGGAATTAGC-3′ R1: 5′-AGATTGCAGCATTACACGTCTT-3′ |
15 | 36482 Remove |
|||
Desalted custom primers | Cm-R: 5′-TTATACGCAAGGCGACAAGG-3′ Cm-F: 5′- GATCTTCCGTCACAGGTAGG-3′ |
16 | 36483 Remove |
|||
Desalted custom primers | F2 and R2: 20 nt constant regions based on pKD3 sequence and 45 nt custom homology regions F2 constant region: 5′-CATATGAATATCCTCCTTA-3′ R2 constant region: 5′-TGTGTAGGCTGGAGCTGCTTC-3’S1 and S2: 27 nt constant regions for priming the amplification of the SPA-Cm cassette and 45 nt custom homology regions S1 constant region: 5’AGCTGGAGGATCCATGGAAAAGAGAAG -3′ S2 constant region: 5′- GGCCCCATATGAATATCCTCCTTAGTT -3′ KOCO-F and KOCO-C: 20 nt primers 200 bp away from the non-essential gene deletion site or the essential gene SPA-tag insertion site |
17 | 36484 Remove |
|||
5. PCR and Electrophoresis Reagents | 18 | 36485 Remove |
||||
Taq DNA polymerase | Fermentas | # EP0281 | 19 | 36487 Remove |
||
10X PCR buffer | Fermentas | # EP0281 | 20 | 36488 Remove |
||
10 mM dNTPs | Fermentas | # EP0281 | 21 | 36489 Remove |
||
25 mM MgCl2 | Fermentas | # EP0281 | 22 | 36490 Remove |
||
Agarose | Bioshop | # AGA002 | 23 | 36492 Remove |
||
Loading dye | NEB | #B7021S | 24 | 36493 Remove |
||
Ethidium bromide | Bioshop | # ETB444 | 25 | 36497 Remove |
||
10X TBE buffer | Bioshop | # ETB444.10 | 26 | 36494 Remove |
||
Tris Base | Bioshop | # TRS001 | 27 | 36495 Remove |
||
Boric acid | Sigma | # T1503-1KG | 28 | 36496 Remove |
||
0.5 M EDTA (pH 8.0) | Sigma | # B6768-500G | 29 | 36498 Remove |
||
DNA ladder | NEB | #N3232L | 30 | 36499 Remove |
||
6. DNA isolation and Clean-up Kits | 31 | 36500 Remove |
||||
Genomic DNA isolation and purification kit | Promega | #A1120 | 32 | 36501 Remove |
||
Plasmid Midi kit | Qiagen | # 12143 | 33 | 36502 Remove |
||
QIAquick PCR purification kit | Qiagen | #28104 | 34 | 36512 Remove |
||
7. Equipment for PCR, Transformation and Replica-pinning | 35 | 36503 Remove |
||||
Thermal cycler | BioRad, iCycler | 36 | 36504 Remove |
|||
Agarose gel electrophoresis | BioRad | 37 | 36505 Remove |
|||
Electroporator | Bio-Rad GenePulser II | 38 | 36506 Remove |
|||
0.2 cm electroporation cuvette | Bio-Rad | 39 | 36507 Remove |
|||
42 °C water bath shaker | Innova 3100 | 40 | 36508 Remove |
|||
Beckman Coulter TJ-25 centrifuge | Beckman Coulter | 41 | 36519 Remove |
|||
32 °C shaker | New Brunswick Scientific, USA | 42 | 36509 Remove |
|||
32 °C plate incubator | Fisher Scientific | 43 | 36510 Remove |
|||
RoToR-HDA benchtop robot | Singer Instruments | 44 | 36511 Remove |
|||
96, 384 and 1,536 pin density pads | Singer Instruments | 45 | 36513 Remove |
|||
96 or 384 long pins | Singer Instruments | 46 | 36514 Remove |
|||
8. Imaging Equipments | 47 | 36515 Remove |
||||
Camera stand | Kaiser | 48 | 36516 Remove |
|||
Digital camera, 10 megapixel | Any Vendor | 49 | 36517 Remove |
|||
Light boxes, Testrite 16″ x 24″ units | Testrite | 50 | 36527 Remove |
|||
9. Pads or Plates Recycling | 51 | 36518 Remove |
||||
10% bleach | Any Vendor | 52 | 36520 Remove |
|||
70% ethanol | Any Vendor | 53 | 36521 Remove |
|||
Sterile distilled water | Any Vendor | 54 | 36522 Remove |
|||
Flow hood | Any Vendor | 55 | 36523 Remove |
|||
Ultraviolet lamp | Any Vendor | 56 | 36524 Remove |
|||
10. Labware | 57 | 36525 Remove |
||||
50 ml polypropylene tubes | Any Vendor | 58 | 36526 Remove |
|||
1.5 ml micro-centrifuge tubes | Any Vendor | 59 | 36528 Remove |
|||
250 ml conical flaks | VWR | # 29140-045 | 60 | 36529 Remove |
||
15 ml sterile culture tubes | Thermo Scientific | # 366052 | 61 | 36530 Remove |
||
Cryogenic vials | VWR | # 479-3221 | 62 | 36531 Remove |
||
Rectangular Plates | Singer Instruments | 63 | 36532 Remove |
|||
96-well and 384-well microtitre plates | Singer Instruments | Nunc | 64 | 36533 Remove |
||
Plate roller for sealing multi-well | Sigma | #R1275 | 65 | 36535 Remove |
||
plates | ABgene | # AB-0580 | 66 | 36534 Remove |
||
Adhesive plate seals | Fisher Scientific | # 13-990-14 | 67 | 36537 Remove |
||
-80 °C freezer | Any Vendor | 68 | 36536 Remove |