Sistematik, büyük ölçekli sentetik gen (bir gen ya da gen-epistasis) etkileşim ekranlar genetik ve fazlalık yolu çapraz konuşma keşfetmek için kullanılabilir. Burada, yüksek-throughput kantitatif sentetik genetik dizi tarama teknolojisi tarif eSGA biz epistatik ilişkileri durulaştırmada ve genetik etkileşim ağları keşfetmek için geliştirilen denir<em> Escherichia coli</em>.
Fenotipleri fiziksel (protein-protein gibi) ve fonksiyonel (örneğin, gen-geni ya da gen) etkileşimleri (GI) 1 karmaşık bir dizi ile belirlenmiştir. Fiziksel etkileşim bakteriyel protein kompleksleri olarak ilişkili oldukları işaret olsa da, onlar mutlaka yolunun düzey fonksiyonel relationships1 açıklamayız. İki silinmiş veya inaktif genleri taşıyan çift mutantların büyüme ölçülür ve karşılık gelen tek mutantlar ile karşılaştırıldığında hangi GI ekranlar, lokusları arasında epistatik bağımlılıkları aydınlatmak ve dolayısıyla yeni fonksiyonel ilişkiler 2 sorgulamak ve keşfetmek için bir araç sağlayabilir. Büyük ölçekli GI haritaları maya 3-7 gibi ökaryotik organizmalar için bildirilen, ancak GI bilgi bakteriyel genomlar işlevsel açıklama engellemektedir prokaryotlar 8 için seyrek kalır edilmiştir. Bu amaçla, ve diğerleri, yüksek verim kantitatif bakteri GI tarama yöntemleri, 9, 10 geliştirdik </> sup.
Burada, kantitatif E. gerçekleştirmek için gereken önemli adımları sunmak sistemik oluşturmak ve bir koloni dizisi biçiminde çift mutantlar çok sayıda spor ölçmek için doğal bakteriyel konjugasyon ve homolog rekombinasyon kullanarak coli bir genom-ölçekli 9 Sentetik Genetik Array (eSGA) tarama prosedürü,. Kısaca, bir robot aktarmak için kullanılır , konjugasyon yoluyla, kloramfenikol (Cm) – İşaretli F-alıcı suşlar – mühendislik Hfr gelen mutant alleli (rekombinasyon Yüksek frekans) kanamisin sıralı bir dizi (Kan) içine 'donör suşları' olarak işaretlenmiş. Genellikle, biz kayıp fonksiyon-gerekli olmayan gen delesyonlar taşıyan tek mutantlar ('Keio' koleksiyonu 11 gibi) ve temel gen mutasyonları hypomorphic (azaltılmış protein ekspresyonu, istikrar, ya da etkinlik 9, 12, 13 görüşmekte yani allelleri) kullanın non-esansiyel ve esansiyel genler, res fonksiyonel dernekleri sorgulamakpectively. Homolog yeniden birleşme ve bunu takip eden genetik değiş tokuş aracılı sonra, elde edilen çift mutant hem de antibiyotik içeren katı ortam üzerinde seçilir. Akıbet sonra, plakaları dijital görüntülü ve koloni boyutları nicel bir in-house otomatik görüntü işleme sistemi 14 kullanılarak puanlanır. Yaktığımız bir çift mutant büyüme oranı beklenen 9 daha da belirgin olarak daha iyi veya daha kötü olduğu zaman ortaya çıkar. Ağırlaştırıcı (veya negatif) yaktığımız çoğu aynı temel süreç 2 çarpacak telafi yollarının gelen genlerin çiftleri kaybı fonksiyon-mutasyonlar arasındaki sonuçlanabilir. Burada, tek bir gen kaybı ya da tek bir mutasyona uğramış uygun bir şekilde, arabelleğe. Ancak, her iki yollarının kaybı zararlı olduğunu ve sentetik öldürücülüğü veya hastalık (yani yavaş büyüme) ile sonuçlanır. Tersine, hafifletilmesi (veya pozitif) etkileşimleri aynı yolu ya da karmaşık protein 2 genleri arasında meydana gelebilecektek başına ya da gen silinmesi sık sık yoldan veya daha fazla ilave pertürbasyonlar, böylece büyüme aktivitesini azaltır, ve olmayan bu tür karmaşık ve normal fonksiyonunu karıştırmayı için yeterlidir. Genel olarak, sistematik olarak tanımlanması ve GI ağları analiz diğer yaklaşımlar tarafından cevapsız yolağı düzeyde bilgi 9 varılabilir hangi genlerin, çok sayıda arasındaki fonksiyonel ilişkilerin tarafsız, global haritalar sağlayabilir.
Biz GI sorgulayarak bir patika düzeyde bakteriyel gen fonksiyonlarını araştırmak için robotik eSGA tarama kullanmak için adım adım protokol ana hatlarıyla. Bu yaklaşım, E. tek tek genler hem de tüm biyolojik sistemlerde incelemek için kullanılabilir coli. Dikkatle tüm uygun kontroller dahil olmak üzere yukarıda anlatılan deneysel adımlar, yürütme ve titizlikle analiz ve bağımsız GI veri fonksiyonel yeni keşifler yapma eSGA başarısı için önemli yönleri vardır doğrulayar…
The authors have nothing to disclose.
Bu eser Genom Kanada, Ontario Genomik Enstitüsü ve JG ve AE AG Sağlık Araştırma hibe Kanada Enstitüsü'nün fonları tarafından desteklenmiştir Vanier Kanada Lisansüstü Bursu bir alıcı olduğunu.
I. Antibiotics | 2 | 36471 Remove |
||||
Chloramphenicol | Bioshop | #CLR201 | 3 | 36472 Remove |
||
Kanamycin | #KAN201 | 4 | 36480 Remove |
|||
Ampicillin | # AMP201 | 5 | 36473 Remove |
|||
2. Luria-Bertani medium | 6 | 36474 Remove |
||||
LB powder | Bioshop | #LBL405 | 7 | 36478 Remove |
||
Agar | Bioshop | #AGR003 | 8 | 36481 Remove |
||
3. Bacterial Strains and Plasmids | 9 | 36475 Remove |
||||
Hfr Cavalli strain λred system (JL238) | Babu et al.14. | 10 | 36476 Remove |
|||
pKD3 | E. coli Genetic Stock Centre, Yale | 11 | 36477 Remove |
|||
Keio E. coli F- recipient collection | National BioResource Project (NBRP) of Japan11 | 12 | 36479 Remove |
|||
Hypomorphic E. coli F- SPA-tag strains | Open biosystems; Babu et al.14 | 13 | 36491 Remove |
|||
4. Primers | 14 | 36486 Remove |
||||
pKD3-based desalted constant primers | F1: 5′-GGCTGACATGGGAATTAGC-3′ R1: 5′-AGATTGCAGCATTACACGTCTT-3′ |
15 | 36482 Remove |
|||
Desalted custom primers | Cm-R: 5′-TTATACGCAAGGCGACAAGG-3′ Cm-F: 5′- GATCTTCCGTCACAGGTAGG-3′ |
16 | 36483 Remove |
|||
Desalted custom primers | F2 and R2: 20 nt constant regions based on pKD3 sequence and 45 nt custom homology regions F2 constant region: 5′-CATATGAATATCCTCCTTA-3′ R2 constant region: 5′-TGTGTAGGCTGGAGCTGCTTC-3’S1 and S2: 27 nt constant regions for priming the amplification of the SPA-Cm cassette and 45 nt custom homology regions S1 constant region: 5’AGCTGGAGGATCCATGGAAAAGAGAAG -3′ S2 constant region: 5′- GGCCCCATATGAATATCCTCCTTAGTT -3′ KOCO-F and KOCO-C: 20 nt primers 200 bp away from the non-essential gene deletion site or the essential gene SPA-tag insertion site |
17 | 36484 Remove |
|||
5. PCR and Electrophoresis Reagents | 18 | 36485 Remove |
||||
Taq DNA polymerase | Fermentas | # EP0281 | 19 | 36487 Remove |
||
10X PCR buffer | Fermentas | # EP0281 | 20 | 36488 Remove |
||
10 mM dNTPs | Fermentas | # EP0281 | 21 | 36489 Remove |
||
25 mM MgCl2 | Fermentas | # EP0281 | 22 | 36490 Remove |
||
Agarose | Bioshop | # AGA002 | 23 | 36492 Remove |
||
Loading dye | NEB | #B7021S | 24 | 36493 Remove |
||
Ethidium bromide | Bioshop | # ETB444 | 25 | 36497 Remove |
||
10X TBE buffer | Bioshop | # ETB444.10 | 26 | 36494 Remove |
||
Tris Base | Bioshop | # TRS001 | 27 | 36495 Remove |
||
Boric acid | Sigma | # T1503-1KG | 28 | 36496 Remove |
||
0.5 M EDTA (pH 8.0) | Sigma | # B6768-500G | 29 | 36498 Remove |
||
DNA ladder | NEB | #N3232L | 30 | 36499 Remove |
||
6. DNA isolation and Clean-up Kits | 31 | 36500 Remove |
||||
Genomic DNA isolation and purification kit | Promega | #A1120 | 32 | 36501 Remove |
||
Plasmid Midi kit | Qiagen | # 12143 | 33 | 36502 Remove |
||
QIAquick PCR purification kit | Qiagen | #28104 | 34 | 36512 Remove |
||
7. Equipment for PCR, Transformation and Replica-pinning | 35 | 36503 Remove |
||||
Thermal cycler | BioRad, iCycler | 36 | 36504 Remove |
|||
Agarose gel electrophoresis | BioRad | 37 | 36505 Remove |
|||
Electroporator | Bio-Rad GenePulser II | 38 | 36506 Remove |
|||
0.2 cm electroporation cuvette | Bio-Rad | 39 | 36507 Remove |
|||
42 °C water bath shaker | Innova 3100 | 40 | 36508 Remove |
|||
Beckman Coulter TJ-25 centrifuge | Beckman Coulter | 41 | 36519 Remove |
|||
32 °C shaker | New Brunswick Scientific, USA | 42 | 36509 Remove |
|||
32 °C plate incubator | Fisher Scientific | 43 | 36510 Remove |
|||
RoToR-HDA benchtop robot | Singer Instruments | 44 | 36511 Remove |
|||
96, 384 and 1,536 pin density pads | Singer Instruments | 45 | 36513 Remove |
|||
96 or 384 long pins | Singer Instruments | 46 | 36514 Remove |
|||
8. Imaging Equipments | 47 | 36515 Remove |
||||
Camera stand | Kaiser | 48 | 36516 Remove |
|||
Digital camera, 10 megapixel | Any Vendor | 49 | 36517 Remove |
|||
Light boxes, Testrite 16″ x 24″ units | Testrite | 50 | 36527 Remove |
|||
9. Pads or Plates Recycling | 51 | 36518 Remove |
||||
10% bleach | Any Vendor | 52 | 36520 Remove |
|||
70% ethanol | Any Vendor | 53 | 36521 Remove |
|||
Sterile distilled water | Any Vendor | 54 | 36522 Remove |
|||
Flow hood | Any Vendor | 55 | 36523 Remove |
|||
Ultraviolet lamp | Any Vendor | 56 | 36524 Remove |
|||
10. Labware | 57 | 36525 Remove |
||||
50 ml polypropylene tubes | Any Vendor | 58 | 36526 Remove |
|||
1.5 ml micro-centrifuge tubes | Any Vendor | 59 | 36528 Remove |
|||
250 ml conical flaks | VWR | # 29140-045 | 60 | 36529 Remove |
||
15 ml sterile culture tubes | Thermo Scientific | # 366052 | 61 | 36530 Remove |
||
Cryogenic vials | VWR | # 479-3221 | 62 | 36531 Remove |
||
Rectangular Plates | Singer Instruments | 63 | 36532 Remove |
|||
96-well and 384-well microtitre plates | Singer Instruments | Nunc | 64 | 36533 Remove |
||
Plate roller for sealing multi-well | Sigma | #R1275 | 65 | 36535 Remove |
||
plates | ABgene | # AB-0580 | 66 | 36534 Remove |
||
Adhesive plate seals | Fisher Scientific | # 13-990-14 | 67 | 36537 Remove |
||
-80 °C freezer | Any Vendor | 68 | 36536 Remove |