Sistemáticos ya gran escala sintéticos genéticos (gen-gen o epistasis) pantallas de interacción puede ser utilizado para explorar la redundancia genética y la vía de la diafonía. A continuación, se describe un alto rendimiento cuantitativo sintético tecnología de detección genética amplia, denominada eSGA que hemos desarrollado para la aclaración de las relaciones y explorar epistatic interacción en redes genéticas<em> Escherichia coli</em>.
Fenotipos están determinados por una serie compleja de física (por ejemplo, proteína-proteína) y funcionales (por ejemplo, gen-gen o genética) interacciones (GI) 1. Aunque las interacciones físicas pueden indicar que las proteínas bacterianas se asocian en forma de complejos, que no necesariamente revelan nivel vía-relationships1 funcionales. Pantallas GI, en las que se mide el crecimiento de los mutantes dobles que llevan dos genes eliminados o inactivados y en comparación con los mutantes individuales correspondientes, puede iluminar dependencias epistática entre loci y por lo tanto, proporcionar un medio para consultar y descubrir nuevas relaciones funcionales 2. Mapas a gran escala GI se ha informado de los organismos eucariotas como las levaduras 3-7, pero la información sigue siendo escasa GI para procariotas 8, que impide la anotación funcional de genomas bacterianos. Con este fin, nosotros y otros han desarrollado de alto rendimiento métodos cuantitativos de detección de bacterias gastrointestinales 9, 10 </sup>.
A continuación, se presentan los principales pasos necesarios para realizar cuantitativo E. coli sintético de matriz genética (eSGA) procedimiento de detección en una escala del genoma 9, utilizando conjugación bacteriana natural y la recombinación homóloga para generar sistémicamente y medir la aptitud de un gran número de mutantes dobles en un formato de matriz de colonia. Brevemente, un robot se utiliza para transferir , a través de la conjugación, cloranfenicol (Cm) – marcado alelos mutantes de Hfr ingeniería (alta frecuencia de recombinación) 'cepas donantes en una serie ordenada de kanamicina (Kan) – F-receptores marcados cepas. Típicamente, se utiliza la pérdida de función de los mutantes individuales no esenciales que llevan deleciones del gen (por ejemplo, la colección "Keio '11) y mutaciones de genes esenciales hipomórficos alelos (es decir, que confieren expresión de proteínas reducida, estabilidad, actividad o 9, 12, 13) a consultar a las asociaciones funcionales de genes no esenciales y esenciales, respectivamente. Después de la conjugación mediada y subsiguiente intercambio genético por recombinación homóloga, los dobles mutantes resultantes se seleccionaron en medio sólido que contiene ambos antibióticos. Después consecuencia, las placas son digitalmente fotografiado y tamaños de colonia son cuantitativamente calificado usando un sistema interno de procesamiento automático de imagen 14. Indicaciones geográficas se revela cuando la tasa de crecimiento de un mutante doble o es significativamente mejor o peor que el esperado 9. No deseados (o negativa) entre las indicaciones geográficas a menudo como resultado mutaciones de pérdida de función en los pares de genes de las vías compensatorias que inciden en el mismo proceso esencial 2. Aquí, la pérdida de un solo gen está tamponada, de tal manera que sea único mutante es viable. Sin embargo, la pérdida de las dos vías es perjudicial y resulta en la letalidad sintética o enfermedad (es decir, crecimiento lento). A la inversa, aliviar (o positivo) pueden ocurrir interacciones entre los genes en la misma vía o complejo de proteínas como la 2supresión de genes, ya sea solo a menudo es suficiente para perturbar la función normal de la vía o un complejo tal que las perturbaciones adicionales no reducen la actividad, y por lo tanto el crecimiento, aún más. En general, la identificación sistemática y el análisis de redes de GI puede proporcionar mapas globales, recomendaciones, de las relaciones funcionales entre un gran número de genes, de los cuales pueden ser vía la información a nivel perdido por otros enfoques inferidos 9.
Hemos esbozado un protocolo de paso a paso para el uso de robótica de detección eSGA para investigar las funciones de genes de bacterias a un nivel interrogando vía gastrointestinal. Este enfoque puede ser utilizado para estudiar los genes individuales, así como los sistemas biológicos completos en E. coli. Con cuidado, la ejecución de las medidas experimentales descritas anteriormente, incluyendo todos los controles adecuados, y con rigor el análisis y la validación de los datos de forma independiente …
The authors have nothing to disclose.
Este trabajo fue apoyado por fondos del Genoma Canadá, el Instituto de Genómica de Ontario, y los Institutos Canadienses de Investigación en Salud de las subvenciones a JG AG y AE es un recipiente de Vanier Canadá Becas de Posgrado.
I. Antibiotics | 2 | 36471 Remove |
||||
Chloramphenicol | Bioshop | #CLR201 | 3 | 36472 Remove |
||
Kanamycin | #KAN201 | 4 | 36480 Remove |
|||
Ampicillin | # AMP201 | 5 | 36473 Remove |
|||
2. Luria-Bertani medium | 6 | 36474 Remove |
||||
LB powder | Bioshop | #LBL405 | 7 | 36478 Remove |
||
Agar | Bioshop | #AGR003 | 8 | 36481 Remove |
||
3. Bacterial Strains and Plasmids | 9 | 36475 Remove |
||||
Hfr Cavalli strain λred system (JL238) | Babu et al.14. | 10 | 36476 Remove |
|||
pKD3 | E. coli Genetic Stock Centre, Yale | 11 | 36477 Remove |
|||
Keio E. coli F- recipient collection | National BioResource Project (NBRP) of Japan11 | 12 | 36479 Remove |
|||
Hypomorphic E. coli F- SPA-tag strains | Open biosystems; Babu et al.14 | 13 | 36491 Remove |
|||
4. Primers | 14 | 36486 Remove |
||||
pKD3-based desalted constant primers | F1: 5′-GGCTGACATGGGAATTAGC-3′ R1: 5′-AGATTGCAGCATTACACGTCTT-3′ |
15 | 36482 Remove |
|||
Desalted custom primers | Cm-R: 5′-TTATACGCAAGGCGACAAGG-3′ Cm-F: 5′- GATCTTCCGTCACAGGTAGG-3′ |
16 | 36483 Remove |
|||
Desalted custom primers | F2 and R2: 20 nt constant regions based on pKD3 sequence and 45 nt custom homology regions F2 constant region: 5′-CATATGAATATCCTCCTTA-3′ R2 constant region: 5′-TGTGTAGGCTGGAGCTGCTTC-3’S1 and S2: 27 nt constant regions for priming the amplification of the SPA-Cm cassette and 45 nt custom homology regions S1 constant region: 5’AGCTGGAGGATCCATGGAAAAGAGAAG -3′ S2 constant region: 5′- GGCCCCATATGAATATCCTCCTTAGTT -3′ KOCO-F and KOCO-C: 20 nt primers 200 bp away from the non-essential gene deletion site or the essential gene SPA-tag insertion site |
17 | 36484 Remove |
|||
5. PCR and Electrophoresis Reagents | 18 | 36485 Remove |
||||
Taq DNA polymerase | Fermentas | # EP0281 | 19 | 36487 Remove |
||
10X PCR buffer | Fermentas | # EP0281 | 20 | 36488 Remove |
||
10 mM dNTPs | Fermentas | # EP0281 | 21 | 36489 Remove |
||
25 mM MgCl2 | Fermentas | # EP0281 | 22 | 36490 Remove |
||
Agarose | Bioshop | # AGA002 | 23 | 36492 Remove |
||
Loading dye | NEB | #B7021S | 24 | 36493 Remove |
||
Ethidium bromide | Bioshop | # ETB444 | 25 | 36497 Remove |
||
10X TBE buffer | Bioshop | # ETB444.10 | 26 | 36494 Remove |
||
Tris Base | Bioshop | # TRS001 | 27 | 36495 Remove |
||
Boric acid | Sigma | # T1503-1KG | 28 | 36496 Remove |
||
0.5 M EDTA (pH 8.0) | Sigma | # B6768-500G | 29 | 36498 Remove |
||
DNA ladder | NEB | #N3232L | 30 | 36499 Remove |
||
6. DNA isolation and Clean-up Kits | 31 | 36500 Remove |
||||
Genomic DNA isolation and purification kit | Promega | #A1120 | 32 | 36501 Remove |
||
Plasmid Midi kit | Qiagen | # 12143 | 33 | 36502 Remove |
||
QIAquick PCR purification kit | Qiagen | #28104 | 34 | 36512 Remove |
||
7. Equipment for PCR, Transformation and Replica-pinning | 35 | 36503 Remove |
||||
Thermal cycler | BioRad, iCycler | 36 | 36504 Remove |
|||
Agarose gel electrophoresis | BioRad | 37 | 36505 Remove |
|||
Electroporator | Bio-Rad GenePulser II | 38 | 36506 Remove |
|||
0.2 cm electroporation cuvette | Bio-Rad | 39 | 36507 Remove |
|||
42 °C water bath shaker | Innova 3100 | 40 | 36508 Remove |
|||
Beckman Coulter TJ-25 centrifuge | Beckman Coulter | 41 | 36519 Remove |
|||
32 °C shaker | New Brunswick Scientific, USA | 42 | 36509 Remove |
|||
32 °C plate incubator | Fisher Scientific | 43 | 36510 Remove |
|||
RoToR-HDA benchtop robot | Singer Instruments | 44 | 36511 Remove |
|||
96, 384 and 1,536 pin density pads | Singer Instruments | 45 | 36513 Remove |
|||
96 or 384 long pins | Singer Instruments | 46 | 36514 Remove |
|||
8. Imaging Equipments | 47 | 36515 Remove |
||||
Camera stand | Kaiser | 48 | 36516 Remove |
|||
Digital camera, 10 megapixel | Any Vendor | 49 | 36517 Remove |
|||
Light boxes, Testrite 16″ x 24″ units | Testrite | 50 | 36527 Remove |
|||
9. Pads or Plates Recycling | 51 | 36518 Remove |
||||
10% bleach | Any Vendor | 52 | 36520 Remove |
|||
70% ethanol | Any Vendor | 53 | 36521 Remove |
|||
Sterile distilled water | Any Vendor | 54 | 36522 Remove |
|||
Flow hood | Any Vendor | 55 | 36523 Remove |
|||
Ultraviolet lamp | Any Vendor | 56 | 36524 Remove |
|||
10. Labware | 57 | 36525 Remove |
||||
50 ml polypropylene tubes | Any Vendor | 58 | 36526 Remove |
|||
1.5 ml micro-centrifuge tubes | Any Vendor | 59 | 36528 Remove |
|||
250 ml conical flaks | VWR | # 29140-045 | 60 | 36529 Remove |
||
15 ml sterile culture tubes | Thermo Scientific | # 366052 | 61 | 36530 Remove |
||
Cryogenic vials | VWR | # 479-3221 | 62 | 36531 Remove |
||
Rectangular Plates | Singer Instruments | 63 | 36532 Remove |
|||
96-well and 384-well microtitre plates | Singer Instruments | Nunc | 64 | 36533 Remove |
||
Plate roller for sealing multi-well | Sigma | #R1275 | 65 | 36535 Remove |
||
plates | ABgene | # AB-0580 | 66 | 36534 Remove |
||
Adhesive plate seals | Fisher Scientific | # 13-990-14 | 67 | 36537 Remove |
||
-80 °C freezer | Any Vendor | 68 | 36536 Remove |