A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Xenopus laevis as a Model to Identify Translation Impairment

10.5K views

⸱

DOI:

10.3791/52724

⸱

September 27th, 2015

In This Article

Summary

Protein synthesis control occurs mainly at the translation initiation step, deficiencies in which are linked to diverse disorders. To better understand their etiology, we described here a protocol using Xenopus laevis oocytes assessing the translation of mos transcript in the presence of a mutant of translation initiation factor eIF4G1.

Abstract

Protein synthesis is a fundamental process to gene expression impacting diverse biological processes notably adaptation to environmental conditions. The initiation step, which involves the assembly of the ribosomal subunits at the mRNA initiation codon, involved initiation factor including eIF4G1. Defects in this rate limiting step of translation are linked to diverse disorders. To study the potential consequences of such deregulations, Xenopus laevis oocytes constitute an attractive model with high degrees of conservation of essential cellular and molecular mechanisms with human. In addition, during meiotic maturation, oocytes are transcriptionally repressed and all necessary proteins are translated from preexisting, maternally derived mRNAs. This inexpensive model enables exogenous mRNA to become perfectly integrated with an effective translation. Here is described a protocol for assessing translation with a factor of interest (here eIF4G1) using stored maternal mRNA that are the first to be polyadenylated and translated during oocyte maturation as a physiological readout. At first, mRNA synthetized by in vitro transcription of plasmids of interest (here eIF4G1) are injected in oocytes and kinetics of oocyte maturation by Germinal Vesicle Breakdown detection is determined. The studied maternal mRNA target is the serine/threonine-protein-kinase mos. Its polyadenylation and its subsequent translation are investigated together with the expression and phosphorylation of proteins of the mos signaling cascade involved in oocyte maturation. Variations of the current protocol to put forward translational defects are also proposed to emphasize its general applicability. In light of emerging evidence that aberrant protein synthesis may be involved in the pathogenesis of neurological disorders, such a model provides the opportunity to easily assess this impairment and identify new targets.

Introduction

Proteins are essential elements of cellular life and thus at larger-scale of the organism. They ensure the majority of cellular functions including structure, transport, reaction catalysis, regulation, gene expression etc. Their expression is the result of a complex mechanism of translation allowing the conversion of an mRNA into protein. The translation is subjected to various controls to adapt and to regulate gene expression according to the cell needs, during development and differentiation, aging, physiological stresses or pathological manifestations.

Translation is divided into 3 phases (initiation, elongation and termination) and presents 3 initiation translation systems in order to respond to these needs: cap-dependent, cap-independent via Internal Ribosome Entry Segment (IRES) structures and cap-Independent Translation Enhancers (CITE).

Most eukaryotic mRNA are translated in a cap-dependent manner via the 7-methylguanosine 5'-triphosphate cap that serves as a recognition feature during protein synthesis. This cap binds to eIF4E, a component of eIF4F complex with eIF4G1 and eIF4A. Associated with other partners like poly(A) Binding Protein (PABP), eIF2-GTP-Met-tRNAMet, these translation initiation factors allow to circularize mRNA and improve its accessibility to forms 43S complex until the AUG initiation codon recognition1. This event corresponds to the end of the translation initiation i.e., the first step of translation.

Cap-independent translation is used by mRNA encoding for essential proteins under stressed conditions that induce for instance cell proliferation and apoptosis. This mechanism involves secondary structures in mRNA 5'- untranslated region (UTR) called IRES, the carboxy-terminal end of eIF4G1 associated with eIF4A and the 43S complex. The binding of this 43S pre-initiation complex to IRES initiates the cap independent translation without the need for eIF4E factor2,3.

Finally, another translation mechanism still not well understood supports this cap-independent translation activity under stressed conditions via CITE structures located within mRNA UTR 4.

Through these various modes of translation differing by their initiation steps, translation plays a critical role in cellular homeostasis and any change in one of these processes would thus impact the organism with small to large scale effects. Indeed, the initiation is a rate limiting step governing the correct translation processes of mRNA into proteins and is thus the target of numerous controls and regulation points5. Whether it is for the latter or for components of these processes, if one turns out to be defective, it will perturb the established balance in the cell and thus could lead to pathologic conditions. In this context, mutations in translation factors have been involved in several disorders including neurodegenerative disorders such as `leukoencephalopathy with vanishing white matter´ (eIF2B1-5 subunit)6, in Walcott-Rallison syndrome (EIF2AK3 gene encoding for PERK)7, potentially in Parkinson's disease (eIF4G1 p.R1205H)8. It is therefore important to conduct cellular and molecular studies of these mutant proteins to increase our knowledge on disease development and on the general process of translation initiation.

To carry out these studies, it is essential to choose the most adequate models to observe the consequences of these mutations. Xenopus laevis oocytes are particularly well adapted due to their physiological and biochemical properties: physiological synchronicity (blocked in phase G2 of the cell cycle), high capacity of protein synthesis (200-400 ng/day/oocyte), high number of extracted oocytes from a same animal (800-1,000 oocytes/female) and cell size (1.2-1.4 mm in diameter) which facilitates their manipulation. Microinjection of Xenopus oocytes with synthesized mRNA can easily be performed to dissect translation steps. In this view it presents other advantages. Given the speed of meiosis progression and of translation after mRNA microinjection (~24 hr), Xenopus oocyte represents a fast system compared to reconstituted cellular systems (extracted from E.coli, wheat germs or rabbit reticulocyte...) in which an mRNA is translated with a reduced translation rate and at a lower speed. So, the effects of a mutation introduced in an mRNA will be quickly observable and easily studied in several oocytes. Another advantage of Xenopus oocytes is that maternal mRNAs are latent and protein translation is blocked before progesterone stimulation. Addition of progesterone is thus a good means of controlling the translation induction. Cytoplasmic polyadenylation does not occur during oogenesis. It begins during oocyte maturation in progesterone-stimulated oocytes in a temporal order and continues throughout early development and could be used to study the different steps of translation.

The polyadenylation of mos mRNA is among the first to occur and it belongs with Aurora A/Eg2, Histone-Like B4 mRNA to the class of “early maturation” genes as defined in Charlesworth et al. (2004)9. The translational induction of “late” mRNA such as Cyclin A1 and Cyclin B1 occurs around the time of germinal vesicle breakdown (GVBD). Mos mRNA encodes a serine/threonine-protein kinase. Its translation is crucial since it induces the MAP kinase cascade that indirectly activates the oocyte maturation. Indeed, in response to progesterone, polyadenylation of mos mRNA is enhanced via a process involving Aurora A/Eg2 regulatory proteins and other RNA binding proteins with the 3’UTR of mos mRNA. This increased polyadenylation of mos mRNA leads to an increase of mos protein level, which in turn activates MEK1. This process mediates the activation of the extracellular signaling-regulated kinase 2 (ERK2) (Figure 1). This signaling cascade can then trigger the maturation M-phase promoting factors, a complex formed by Cyclin B and Cdc2 kinase, and eventually results in meiotic resumption.

Therefore in Xenopus laevis oocytes, the study of maternal mRNA such as mos could easily be used to test their translatability with several endpoints from their efficient polyadenylation to translation of several mos signaling components, including also the determination of the GVBD rate. This system is therefore interesting to evaluate the first consequences of mutations in translation initiation factors without interference of newly transcribed mRNA or of transfection efficiency, problems often occurring with eukaryotic cell studies.

Here, a protocol is established where mutant eIF4G1 mRNAs are microinjected in Xenopus laevis oocytes and the translation of maternal mRNA is tested. In the presence of a defect in GVBD progression, mos mRNA polyadenylation which is essential for progression through the oocyte meiotic cell cycle and for the subsequent translation of early and late class mRNAs is ascertained. The phosphorylation Aurora A/Eg2 and ERK is also studied to confirm the consequence of mos deregulation.Thus, Xenopus oocytes represent a simple way to analyse different steps of mRNA translation.

Access restricted. Please log in or start a trial to view this content.

Protocol

All Xenopus experiments were performed at the animal facility of the Lille 1 University according to the rules of the European Community Council guidelines (86/609/EEC) for laboratory animal experimentation. The animal protocol was approved by the local institutional review board (Comité d’Ethique en Experimentation Animale Nord-Pas-De-Calais, CEEA 07/2010).

1. Oocyte Handling

  1. Prepare the anesthetic solution: dissolve 1 g of tricaine methane sulphonate powder in a 1 L of sterile water.
  2. Plunge female Xenopus laevis into this solution, cover the beaker to avoid escape and wait approximately 45 min for the animal to be completely sedated (without any reaction to a leg pinch).
  3. Wash the frog with soap and rinse with tap water then place the animal on its back on clean aluminum foil.
  4. Clamp the skin of the lateral part of the abdomen and at the ovaries level with forceps. Make an incision of approximately 1 cm with scissors cleaned before use with ethanol 70%. Make sure that the section is deep enough and to reach the underlying abdominal wall to allow excision of ovarian tissue in which several oocytes in various stages of development are found.
  5. Dissect the ovary lobes, wash them 4 times in a Petri dish (50 mm) with ND96 medium (96 mM NaCl, 2 mM KCl, 1 mM MgCl2, 1.8 mM CaCl2, 5 mM HEPES adjusted to pH 7.4 with NaOH, supplemented with 50 µg/ml streptomycin/penicillin, 225 µg/ml sodium pyruvate, 30 µg/ml soybean trypsin inhibitor, 1 µl/ml tetracycline) to remove all traces of blood and debris.
    Note: Tetracycline allows an optimal conservation and a good recovery after microinjection treatment.
  6. Store them in a covered Petri dish submerged in the medium at 14 °C, allowing their preservation for one week.
  7. Stitch the abdominal wall and the skin with veterinarian absorbable thread and a suturing needle (3 or 4 stitches will be necessary).
  8. Place the animal in a beaker without water and moister the skin with tap water until the frog is moving again. Cover the beaker to prevent escape.
  9. Separate carefully the ovary lobes in the medium in groups of 5 to 10 oocytes by using 2 pairs of forceps under a stereomicroscope with a 10-fold magnification. Select oocytes at stage VI. They can be recognized by i) their shape and color with a brown pigmented animal pole and yellow vegetative pole separated by a clear belt ii) their size superior to 1.2 mm in diameter10.
  10. Incubate the selected oocytes in a collagenase solution (1 mg/ml collagenase A from Clostridium histolyticum, dissolved in ND96 without tetracycline) in a Petri dish under gentle agitation during 45 min to facilitate the oocyte defolliculation (collagenase digests oocyte/follicular cell connections). Rinse the oocytes 3 or 4 times with ND96 medium kept at 14 °C.
    Note: Do not incubate the oocytes less or more than 45 min due to the risk of destroying oocyte surface proteins and of causing poor viability. Collagenase treatment can induce spontaneous GVBD.
  11. Incubate oocytes in the medium for 3-4 hr. Remove follicular cells with fine tweezers under binocular magnifying glass and keep them at 19 °C in ND96 medium.

2. Preparation of mRNA Synthesis

  1. Linearize 5 µg of the following plasmids by enzymatic digestion using PmeI enzyme.
    NOTE: pcDNA6.2/V5-DEST containing a 1599 amino-acids eIF4G1 cDNA wild type (eIF4G1-WT; NM_198241), pcDNA6.2/V5-DEST containing an eIF4G1 dominant negative cDNA (eIF4G1-DN) with mutations c.2105T>G c.2106A>C, c.2120->G, c.2122T>A, 2125T>- and c.2126T>G in the region of interaction between eIF4G1 and eIF4E at position 612 to 618 of the corresponding protein disturbing the interaction between eIF4G1 and eIF4E8, pcDNA6.2/C-EmGFP containing Chloramphenicol Acetyl Transferase (GFP). Prepare 2 mixtures for each of the 3 plasmids: the first including PmeI enzyme and the second without enzyme as control.
  2. Precipitate plasmid DNA using a classical ethanol procedure and resuspend it in 20 µl of Nuclease-free H2O.
  3. Determine its concentration using a spectrophotometer. The concentration should be superior to 150 ng/µl to transcribe cRNA.
  4. Run 1 µl of samples and their controls with 5 µl of loading buffer on a 0.8% agarose gel to verify the plasmid linearization.
  5. Use a kit for in vitro transcription and cRNA purification according to manufacturer’s instructions. The transcribed cRNA are resuspended in 20 µl of Nuclease-free H2O. Samples can be stored at -80 °C if needed.
  6. Prepare the MOPS 10X migration buffer containing 0.2 M MOPS (pH 7.0), 20 mM sodium acetate and 10 mM EDTA (pH 8.0). Sterilize solution with a 0.45 µm filter. Stock the solution protected from the light at RT to avoid solution oxidation.
  7. Clean the electrophoresis tank successively with NaOH, HCl and thoroughly rinsed with double-filtered water for an O/N to avoid RNase and prevent RNA degradation.
  8. Cast a 1.5% agarose gel containing MOPS and formaldehyde. Warm until complete agarose dissolution and let it cool down to 55 °C. Under fume hood, add 0.1 volume of MOPS 10X, 6.6% of formaldehyde and 4 µg of ethidium bromide (10 mg/ml). Pour the gel under the fume hood and wait approximately 1 hr for the gel to harden.
    Note: Formaldehyde and Ethidium Bromide are toxic.
  9. Prepare samples for migration in a 0.2 ml tube with 1 µl of cRNA, 8.8% of formaldehyde, 60% of formamide and 0.1 volume of MOPS 10X. Incubate for 3 min at 70 °C and put the tubes on ice for 10 min. Centrifuge samples few seconds at 5,000 x g. Add 2 µl of gel loading buffer.
    Note: Formamide is toxic.
  10. Run samples for 20 min at 90V. Soak the gel in Nuclease-free H2O O/N to destain the gel before analyzing it to check the cRNA quality.
  11. Determine cRNA concentration using a spectrophotometer and store them at -80 °C.

3. Microinjection of Synthesized RNA and Oocytes Maturation Stimulation

  1. Prepare the necessary equipment for oocytes microinjection. Use a micropipette puller to pull small glass capillary. Under stereomicroscope, break off the extremity of the capillary with the tweezers to create a blunt end. Fill the capillary micropipette with mineral oil using a 1 ml syringe with a millipore 0.45 µm filter at the opposite extremity. Mount the micropipette onto the microinjection pipette. Choose an accurate micropipette calibrated by the manufacturer to give good accuracy when used with appropriate glass capillary.
  2. Perform microinjection 1-2 hr after defolliculation, necessary delay for oocyte recovery on oocytes kept at 14 °C. Use Petri dishes with the bottom scraped with forceps to create an adhesive surface for oocytes and fill them with ND96 medium.
  3. Arrange oocytes along a scraped lane in a Petri dish allowing a successive injection of oocytes with the capillary micropipette at an angle of 45 °C.
  4. Inject in the oocyte equatorial zone, below the pigmented animal area for an optimal diffusion of samples in the cytoplasm. Insert only the thinnest part of capillary tip on approximately 150-200 µm of depth.
  5. Inject 30 ng of cRNA obtained respectively from the different plasmids in a volume of 60 nl in a first oocyte. After injection, wait for 5-10 sec before removing the capillary tip to avoid sample escape (Figure 2A).
    Note: Do not exceed 120 nl. Inject as slowly as you can. A control with distilled water is recommended.
  6. Move manually the Petri dish to inject the next oocyte.
    Note: Make sure that the tip is not clogged by generating a small pulse out of the bath solution after 2 to 3 microinjections.
  7. Transfer injected oocytes in 24 wells culture plates (10 oocytes /well) filled with 3 ml of fresh ND96 medium and leave them at 19 °C.
  8. Incubate the oocytes in ND96 with progesterone (PG) (2 µg/ml) to trigger meiotic maturation (GVBD) at 19°C, 15 hr or 4 hr after microinjection of polyadenylated cRNAs obtained respectively from pcDNA6.2/V5-DESTeIF4G1 and pcDNA6.2/C-EmGFP used as a control (Figure 2A).
    Note: Co-injection of fluorescent marker with the cRNA is a nice tool to ensure that the cRNA was injected and remained in the oocyte. Perform such preliminary experiments using a cRNA of interest with a GFP tag.
  9. Microinject as in #3.5 different ratios (1:3; 2:2; 3:1) of polyadenylated eIF4G1-WT and eIF4G1-DN cRNAs in order to test the translation effect of eIF4G1-WT cRNAs on the mutant phenotype (Figure 2D).

4. Germinal Vesicle Breakdown Determination

  1. Count the number of mature oocytes after PG stimulation by observing the presence of a white spot at the black animal pole with a stereomicroscope. Repeat the counting every hour until the twenty-fourth hour (Figure 2B, 2C).

5. Western Blot (WB) Analysis

  1. Homogenize the group of 10 oocytes by back and forth movements with a micropipette tip, at 4 °C in 200 µl in the following buffer: 50 mM Hepes, pH 7.4, 500 mM NaCl, 0.05% SDS, 5 mM MgCl2, 1 mg/ml bovine serum albumin, 10 mg/ml leupeptin, 10 mg/ml aprotinin, 10 mg/ml soybean trypsin inhibitor, 10 mg/ml benzamidine, 1 mM PMSF, 1 mM sodium vanadate.
  2. Centrifuge samples for 15 min at 10,000 x g to remove the lipid (upper phase) and the membrane (bottom phase) fractions. Collect the cytoplasmic fraction, store an aliquot to determine protein concentration and complete the remaining with Laemmli or a Bis-Tris sample buffer (1:1).
    Note : Bis-Tris gels and loading buffer have a more neutral pH that protects proteins from hydrolysis
  3. Heat 20 µg of sample at 95 °C for 10 min. Load each sample into the wells of the acrylamide gel. Place the gel in a tank with appropriate buffer.
  4. Perform an electrophoresis for 1 h at 200 V.
  5. Realize a WB in TBS pH 8.0 (Tris HCl 15 mM, NaCl 150 mM, Tween 0.1%, containing 10% bovine serum albumin) with a goat anti-Aurora A/Eg2 (1:3,000, 2 hr) or with a rabbit anti-Aurora A/Eg2-P (1:1,000, O/N at 4 °C), mouse anti-ERK2 (1:3,000, 2 hr), goat anti-ERK2-P (Tyr204) (1:3,000, 2 hr), rabbit anti-mos (1:5,000, 4 hr), rabbit anti-GFP (1:3,000, 2 hr) antibodies.Use antibodies mouse anti-V5 (1:10,000, 2 hr) and rabbit anti-Rsk (1:1,000, 2 hr) (as loading controls).
  6. Wash the membrane 3 times for 10 min in TBS-Tween and incubate 1 hr with either an anti-mouse or anti-rabbit or anti-goat (IgM) horseradish peroxidase-labeled secondary antibody at dilutions of 1:5,000, 1:7,500 and 1:5,000 respectively.
  7. Perform 3 washes of 10 min in TBS-Tween and detect the antigen-antibodies complexes with the Advanced ECL Detection system.

6. Polyadenylation Assay

  1. Sample 5 oocytes per condition in a 1.5 ml. Wash them with 1 ml of Nuclease-free PBS 1X (pH 7.4). The following steps will be made under fume hood.
  2. Extract RNA using a classical organic procedure (see manufacturer instructions).
  3. Recover RNA by centrifugation (10,000 x g) for 5 min at 4 °C. Remove supernatant and air dry RNA for 10 min.
  4. Resuspend RNA pellet in 30 µl of Nuclease-free H2O.
  5. Take 15 µl of samples in a new tube and add 85 µl of Nuclease-free H2O. Clean up these samples to improve their quality on silica’s column according to the manufacturer’s instructions. Elute the RNA using 30 µl of Nuclease-free H2O
  6. Run 1 µl of samples with 5 µl of loading buffer on a 0.8% agarose gel to check the RNA integrity.
  7. Determine the RNA concentration using a spectrophotometer.
  8. Prepare 2 ligation mixtures per condition (i.e., eIF4G1-WT, eIF4G1-DN and the H2O control) with the following reagents: 10 U of RNA ligase, 0.1 volume of 10X buffer, 1 mM ATP, 10% of PEG8000 50%, 0.1 µg of primer P1 (5’-P-GGTCACCTTGATCTGAAGC-NH2-3’)11 and bring the final volume to 10 µl with Nuclease-free H2O. Add in the first mixture RNA obtained from oocytes without PG stimulation and in the second mixture RNA obtained from PG stimulated oocytes.
  9. Incubate for 1 hr at 37 °C then for 20 min at 65 °C to inactivate the enzyme.
  10. Use a cDNA Reverse Transcription (RT) kit. Prepare the RT mixture, per tube: 0.1 volume of 10X RT buffer, 0.1 µg of primer P2 (5’-GCTTCAGATCAAGGTGACCTTTTT)10, 4 mM dNTP mixture, 50 U of reverse transcriptase and complete with Nuclease-free H2O to final volume of 10 µl. Add 10 µl of ligation reaction obtained previously. Perform the RT under conditions described by the manufacturer.
  11. Prepare Polymerase Chain Reaction (PCR) mixture, per tube: 0.1 volume of buffer 10X, 1.5 mM MgCl2, 133 µM dNTP mixture, 0.2 µM specific primer, 0.2 µM primer P2, 0.025 U Taq polymerase, 1 µl of cDNA and complete with Nuclease-free H2O to final volume of 50 µl. Perform the PCR under following conditions: 50 °C for 2 min, 95 °C for 10 min, [95 °C for 1 min, 56 °C for 30 sec, 72 °C for 30 sec]*40 cycles, 72 °C for 10 min9. The specific primers are as follows: mos, GTTGCATTGCTGTTTAAGTGGTAA Histone-like B4, AGTGACAAACTAGGCTGATATACT; Cyclin A1, CATTGAACTGCTTCATTTTCCCAG; Cyclin B1: GTGGCATTCCAATTGTGTATTGTT9.
  12. Prepare a 3% agarose gel. Add in each PCR products 10 µl of loading buffer. Run the gel with 10 µl of samples at 110 V for an optimal migration. Analyse the gel after 10 and 20 min to observe a change of size reflecting the length of the tail poly(A) and thus the RNA maturation which is a prerequisite to their translation.

Access restricted. Please log in or start a trial to view this content.

Results

Kinetic maturation of Xenopus oocytes and determination of the percentage oocyte GVBD after 24 hr of PG stimulation (Figures 2B, 2C):

In order to study the translational consequences of the eIF4G1-DN mutation, the response to PG in Xenopus laevis oocytes microinjected with cRNA eIF4G1-DN is compared to eIF4G1-WT and to other control conditions (H2O, GFP). The controls enable to assess the incidence of oocyte microinjection regardless of the nature ...

Access restricted. Please log in or start a trial to view this content.

Discussion

Translation is a mechanism involved in the physiopathology of numerous human disorders including several neurodegenerative diseases. For instance in Parkinson’s disease several reports suggested the impairment in translation associated with hereditary mutations8,12,13.

Several cellular models are available to study translation. Here, in order to study the translational consequences of a mutation in eIF4G1 that acts as dominant negative mutation reducing the interaction between...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

This research was supported by grant from INSERM, University of Lille 1, University of Lille 2, Regional Hospital Center of Lille (CHR de Lille). MCCH acknowledges supports from the Fondation de France and wishes to thank IRCL, Pr. Sonenberg for the gift of the V5-plasmids, Dr. Dissous (Pasteur Institute, Lille) for the gift of anti-GFP antibodies, UMS 3387 (University of Rennes) where Xenopus oocytes are purchased and Dr Taymans (JPArc, Lille) for critical reading of the manuscript text.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Tricaine methane sulphonateSandozMS-222oocytes handling
ForcepsMoriaDumont MC40
Streptomycin/penicillinSigma781
Sodium pyruvateSigmaP2256
Soybean trypsin inhibitorSigmaT9128
TetracyclinSigmaT7660
Veterinarian absorbable Vicryl threadJohnson&Johson IntlJV1205
Collagenase ARoche diagnostics10103586001
PmeINew England BiolabsR0560SPreparation of synthetic mRNA
DNAse/RNAse free H2OLife Technologies10977
Sodium AcetateMerck6268
Absolute ethanolSigma02854
Nano DropThermo Scientific
TBE 10XEppendorf0032006.507
Ethidium bromide 10 mg/mlLife Technologies15585-011
mMESSAGE mMACHINE KitAmbion by Life TechnologiesAM1344
MOPSSigmaM1254
EDTAFluka03609
AgaroseLife Technologies16500-500
Formaldehyde 37%Merck1.04003.1000
FormamideFluka47671
Gel Doc ImagerBiorad
Oocyte Pipet with 100 8" Glass CapillariesDrummond Scientific Company3-000-510-Xmicroinjection
Replacement Glass 8"Drummond Scientific Company3-000-210-G8
0.45 µm filterMilliporeSLHA025NB
ProgesteroneSigmaP0130
HepesSigmaH3375Western Blot
NaClSigmaS5886
SDSBiorad161-0301
MgCl2SigmaA3294
Bovine serum albuminSigmaA4612
leupeptinSigmaL8511
aprotininSigmaA1153
benzamidineSigmaB6506
PMSFSigmaP7626
sodium vanadateSigmaS6508
Laemmli bufferBiorad161-0737
NuPAGE Novex 4-12% Bis-Tris Protein Gels, 1.0 mm, 15 wellLife TechnologiesNP0323BOX
SDS-PAGE electrophoresis, mini-Protean TGXBiorad456-1036 and -1096
horizontal semi-dry blotting systemW.E.P. Compagny
GlycineBiorad161-0718
Tris-HClBiorad161-0719
Hybond ECL MembraneAmersham Life Science10401180
MethanolVWR20846-292
Ponceau Red (0.5%)SigmaP3504
Tween 20SigmaP2287
anti-GFPLife TechnologiesA11122
anti-V5Santa Cruz Biotechnologysc-58052
anti-Eg2Santa Cruz Biotechnologysc-27884
anti-Eg2-PCell SignalingC39D8
anti-ERK2Santa Cruz Biotechnologysc-1647
anti-ERK2-P (Tyr204)Santa Cruz Biotechnologysc-7976
anti-RskSanta Cruz Biotechnologysc-231
anti-mosSanta Cruz Biotechnologysc-86
anti-mouse horseradish peroxidase labeled secondary antibodySanta Cruz Biotechnologysc-2005
anti-rabbit horseradish peroxidase labeled secondary antibodySanta Cruz Biotechnologysc-2812
anti-goat horseradish peroxidase labeled secondary antibodySanta Cruz Biotechnologysc-2378
Advanced ECL Detection SystemAmershan Life ScienceRPN2135
PBS 1xSigmaP4417polyadenylation assay
TRIZOL (Qiazol Lysis Reagent)Qiagen79306
ChloroformSigma31998-8
IsopropanolSigma278475-1L
RNeasy mini kitQiagen74106
RTL buffer Qiagen79216
RNAse free DNAse setQiagen79254
PrimersEurogentec
T4 RNA ligase 1 New England BiolabsM0204S
High capacity c-DNA Reverse Transcription kitApplied Biosystems, Life Technologies4368813
Taq polymeraseLife Technologies10342020

References

  1. Jackson, R. J., Hellen, C. U., Pestova, T. V. The mechanism of eukaryotic translation initiation and principles of its regulation. Nat Rev Mol Cell Biol. 11 (2), 113-127 (2010).
  2. Holcik, M., Sonenberg, N. Translational control in stress and apoptosis. Nat Rev Mol Cell Bio. 6 (4), 318-327 (2005).
  3. Lopez-Lastra, M., Rivas, A., Barria, M. I. Protein synthesis in eukaryotes: the growing biological relevance of cap-independent translation initiation. Biol Res. 38 (2-3), 121-146 (2005).
  4. Terenin, I. M., Andreev, D. E., Dmitriev, S. E., Shatsky, I. N. A novel mechanism of eukaryotic translation initiation that is neither m7G-cap-, nor IRES-dependent. Nucleic Acids Res. 41 (3), 1807-1816 (2013).
  5. Sonenberg, N., Hinnebusch, A. G. Regulation of translation initiation in eukaryotes: mechanisms and biological targets. Cell. 136 (4), 731-745 (2009).
  6. Van der Knaap, M. S., Leegwater, P. A., Könst, A. A., Visser, A., Naidu, S., Oudejans, C. B., Schutgens, R. B., Pronk, J. C. Mutations in each of the five subunits of translation initiation factor eIF2B can cause leukoencephalopathy with vanishing white matter. Ann Neurol. 51 (2), 264-270 (2002).
  7. Senée, V., Vattem, K. M., Delépine, M., Rainbow, L. A., Haton, C., Lecoq, A., et al. Wolcott-Rallison Syndrome: clinical, genetic, and functional study of EIF2AK3 mutations and suggestion of genetic heterogeneity. Diabetes. 53 (7), 1876-1883 (2004).
  8. Chartier-Harlin, M. C., Dachsel, J. C., Vilariño-Güell, C., Lincoln, S. J., Leprêtre, F., Hulihan, M. M., et al. Translation initiator EIF4G1 mutations in familial Parkinson disease. Am J Hum Genet. 89 (3), 398-406 (2011).
  9. Charlesworth, A., Cox, L. L., MacNicol, A. M. Cytoplasmic polyadenylation Element (CPE)- and CPE-binding Protein (CPEB)-independent mechanisms regulate early class maternal mRNA translational activation in Xenopus oocytes. J Biol Chem. 279 (17), 17650-17659 (2004).
  10. Dumont, J. N. Oogenesis in Xenopus laevis. J Morphol. 136, 153-180 (1972).
  11. Rassa, J. C., Wilson, G. M., Brewer, G. A., Parks, G. D. Spacing constraints on reinitiation of paramyxovirus transcription: the gene end U tract acts as a spacer to separate gene end from gene start sites. Virology. 274, 438-449 (2000).
  12. Lin, W., Wadlington, N. L., Chen, L., Zhuang, X., Brorson, J. R., Kang, U. J. Loss of PINK1 attenuates HIF-1α induction by preventing 4E-BP1-dependent switch in protein translation under hypoxia. J Neurosci. 34 (8), 3079-3089 (2014).
  13. Martin, I., Kim, J. W., Lee, B. D., Kang, H. C., Xu, J. C., Jia, H. 2, Stankowski, J., et al. Ribosomal protein s15 phosphorylation mediates LRRK2 neurodegeneration in Parkinson's disease. Cell. 57 (2), 472-485 (2014).
  14. Cohen, S., Au, S., Panté, N. Microinjection of Xenopus laevis oocytes. J Vis Exp. (24), (2009).
  15. Willis, J., DeStephanis, D., Patel, Y., Gowda, V., Yan, S. Study of the DNA damage checkpoint using Xenopus egg extracts. J Vis Exp. (69), e4449(2012).
  16. Keiper, B. D., Rhoads, R. E. Translational recruitment of Xenopus maternal mRNAs in response to poly(A) elongation requires initiation factor eIF4G-1. Dev Biol. 206 (1), 1-14 (1999).
  17. Wakiyama, M., Imataka, H., Sonenberg, N. Interaction of eIF4G with poly(A)-binding protein stimulates translation and is critical for Xenopus.oocyte maturation. Curr Biol. 10 (18), 1147-1150 (2000).
  18. Sheets, M. D., Wu, M., Wickens, M. Polyadenylation of c-mos mRNA as a control point in Xenopus meiotic maturation. Nature. 374 (6522), 511-516 (1995).
  19. Gebauer, F., Richter, J. D. Synthesis and function of Mos: the control switch of vertebrate oocyte meiosis. Bioessays. 19 (1), 23-28 (1997).
  20. Le Sommer, C., Lerivray, H., Lesimple, M., Hardy, S. Xenopus as a model to study alternative splicing in vivo. Biol Cell. 99 (1), 55-65 (2007).
  21. Au, S., Cohen, S., Panté, N. Microinjection of Xenopus laevis.oocytes as a system for studying nuclear transport of viruses. Methods. 51 (1), 114-120 (2010).
  22. Gotoh, T., Villa, L. M., Capelluto, D. G., Finkielstein, C. V. Regulatory pathways coordinating cell cycle progression in early Xenopus development. Results Probl Cell Differ. 53, 171-199 (2011).
  23. Schmidt, E. K., Clavarino, G., Ceppi, M., Pierre, P. SUnSET, a nonradioactive method to monitor protein synthesis. Nat Methods. 6 (4), 275-277 (2009).
  24. Moreno, J. A., Halliday, M., Molloy, C., Radford, H., Verity, N., Axten, J. M., et al. Oral treatment targeting the unfolded protein response prevents neurodegeneration and clinical disease in prion-infected mice. Sci Transl Med. 5 (206), 206ra138(2013).
  25. Doyle, K. M., Kennedy, D., Gorman, A. M., Gupta, S., et al. Unfolded proteins and endoplasmic reticulum stress in neurodegenerative disorders. J Cell Mol Med. 15 (10), 2025-2039 (2011).
  26. Gandin, V., Sikström, K., Alain, T., Morita, M., McLaughlan, S., Larsson, O., Topisirovic, I. Polysome fractionation and analysis of mammalian translatomes on a genome-wide scale. J Vis Exp. (87), e51455(2014).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Translation InitiationOocyte MaturationGerminal Vesicle BreakdownWestern BlotmRNA PolyadenylationMos Signaling CascadeProgesterone StimulationeIF4G1 MutationCapillary Microinjection