Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

살아있는 Zebrafish 배아에서의 바이오 센스 모터 뉴런 멤브레인 잠재력

doi: 10.3791/55297 Published: June 26, 2017
* These authors contributed equally

Introduction

생체 내 전신 성분 분석을 통해 과학자들은 세포 행동을 가장 신뢰할 수있는 방법으로 조사 할 수 있습니다. 막 전압 변화가 흥분성 세포 간의 의사 소통을 유도하는 신경계에서와 같이 정밀 조사 활동이 세포 - 세포 상호 작용 (접촉 및 비접촉 의존 모두)에 크게 영향을받는 경우 특히 그렇습니다. 이러한 전기적 신호에 의해 암호화 된 정보의 이해는 신경계가 생리 및 질병 상태 모두에서 작동하는 방식을 이해하는 데 중요합니다.

대부분의 비 침습적 인 생리 조건에서 세포의 전기적 특성을 연구하기 위해 최근 유전자 조작 된 전압 지시기가 개발되었습니다 1 . 이전 세대의 광학 전압 센서 (주로 전압 감응 염료) 2 와 달리 GEVI는 손상되지 않은 신경계의 생체 내 분석을 허용하고,그들의 표현은 특정 세포 유형이나 개체군으로 제한 될 수 있습니다.

제브라 피쉬 태아 (zebrafish embryo)는 GEVI에 기인 한 큰 잠재력을 이용하는 생체 내 "기질"입니다. 사실, 광학적 인 명확성과 단순하지만 진화 적으로 보존 된 신경 시스템 덕분에 zebrafish 모델은 네트워크의 모든 세포 구성 요소를 간단히 식별하고 조작 할 수 있습니다. 실제로, FRET 기반 GEVI Mermaid 3 의 고용은 근 위축성 측삭 경화증 (ALS) 4 의 제브라 피쉬 모델에서 척추 운동 신경 행동의 사전 증상 변화를 확인하게했다.

다음 의 생체 내 프로토콜은 인과 관계를 표현하는 그대로의 제브라 피쉬 배아에서 척수 운동 뉴런의 전기적 특성을 모니터하는 방법을 설명합니다. 또한, 그것은 약리학 적으로 유도 된 chan이러한 전기적 특성의 변화는 초기 발달 단계에서 제브라 피쉬의 움직임을 특징 짓는 고정 관념 운동 활동 인 배아 자발적 감기의 빈도의 변화와 관련 될 수있다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. pHuC_Mermaid Plasmid Generation

참고 : 인어 (Mermaid)는 Ciona intestinalis 의 전압 감지 도메인 (VSD)을 페어링하여 개발 된 바이오 센서입니다 FRET 파트너 형광체 Umi-Kinoko Green (mUKG : donor)과 오렌지색 발광 형광 단백질 Kusabira Orange (mKOk : acceptor)의 단량체 버전으로 인산 가수 분해 효소 (Ci-VSP)를 함유 한 Ciona robusta 5 전압 센서. 이 바이오 센서의 경우 멤브레인 탈분극에 의해 유도 된 VSD 도메인의 구조 변화는 공여체와 수용체 형광 단백질의 근접성을 증가 시켜서 이들 사이의 에너지 전달을 증가시킵니다 (FRET 비율 증가) 3 . VSD는 세포막에서 바이오 센서의 효율적인 위치를 보장합니다. 바이오 센서의 뉴런 발현 (척수에서 신호는 신경 세포와 운동 신경 모두에서 검출 가능)은 인어 op를 복제하여 얻을 수 있습니다zebrafish 팬 - 신경 발기인 HuC 6 에서 프레임을 읽는 (ORF).

  1. 업스트림의 Sma I 제한 효소 부위를 삽입하기 위해 T3 Universal primer와 Mermaid Sma I primer (5'TATCCCGGGATTCGACGGTTCAGATTTTA)를 사용하여 Pfu (proofreading) DNA 중합 효소를 사용하여 pmer4 + Mermaid plasmid 3 의 Mermaid ORF를 중합 효소 연쇄 반응 (PCR) 인어 공주 ORF의
    1. 다음 PCR 혼합물을 사용하십시오 : Pfu DNA 중합 효소 0.5 μL, 특정 10 배 완충액 7.5 μL, 10 mM dNTP 1 μL, DMSO (dimethyl sulfoxide) 2.5 μL, 플라스미드 준비 0.5 μL (50 ng) 50 μL의 총 부피에서 각 프라이머의 20 μM 스톡 용액 μL.
    2. 95 ° C에서 15 초 동안 PCR 혼합물을 가열하고 50 ° C에서 15 초 동안 프라이밍 한 후 72 ° C에서 4 분 동안 길게 늘인 다음 35 사이클의 시간 동안 전체를 길게하십시오.
  2. 특정 뭉치를 젤 - 정화하십시오PCR 산물을 제조사의 프로토콜에 따라 시판되는 겔 정제 키트를 사용하여 정제 하였다.
  3. DNA 단편을 제조사의 프로토콜에 따라 pCMV-SC 무딘 벡터에 클로닝한다.
  4. HuC 프로모터의 다음 삽입을 위해 Sma I 제한 효소로 인어 양성 플라스미드 (pCMV-SC_Mermaid로 명명 됨)를 선형화한다.
    1. 다음과 같이 제한 반응을 설정하십시오 : Sma I 제한 효소 0.5 μL (10 U), 키트 10x 완충액 2 μL 및 20 μL 총 볼륨의 플라스미드 DNA 5 μg. 반응물을 25 ° C에서 1 시간 동안 인큐베이션한다.
  5. 제조 업체의 프로토콜에 따라 상업 겔 정화 키트를 사용하여 소화 플라스미드를 젤 - 정화.
  6. Pfu DNA 중합 효소와 zebrafish 게놈 DNA를 주형으로하여 HuC 특이 적 프라이머 쌍을 사용하여 HuC 프로모터 (pHuC)를 PCR 증폭한다 (HuCprom-forw1_SalI : 5'-GTAGTCGACCAGACTTGTCAAAAGGGTCCA 및 HuCprom-rev1 : 5'-TCCATTCTTGACGTACAAAGATG) 및 ATG의 상류 3,150-bp 영역에 걸쳐있다.
    1. 다음과 같은 구성표를 사용하여 PCR 혼합물을 설정 : Pfu DNA 중합 효소 0.5 μL, 특정 10x 버퍼 7.5 μL, 10 MM dNTP 1 μL, DMSO 2.5 μL, 게놈 DNA의 200 NG 및 20 μM의 1 μL 50μL의 총 부피에서 각각의 프라이머의 시약.
    2. 95 ° C에서 2 분간의 초기 단계 후 95 ° C에서 15 초 동안 PCR 혼합물을 가열하고 50 ° C에서 15 초 동안 프라이밍 한 다음 72 ° C에서 4 분간 길게 늘어서 35 사이클 .
  7. 제조 업체의 프로토콜에 따라 상용 겔 정화 키트를 사용하여 특정 무딘 PCR 제품을 젤 - 정화.
  8. T4 DNA ligase 1 μL와 특정 10X 버퍼 1 μL를 사용하여 등량의 정제 pCMV-SC_Mermaid (1.5 단계)와 pHuC DNA (1.7 단계)를 10 μL의 총 부피로 채 웁니다. 16 시간 동안 반응을 항온 처리한다.4 ° C.
  9. competative 세포의 나누어지는을 제조 업체의 지침에 따라 연결 반응 (1.8 단계) 5 μL로 변환합니다.
  10. I - Eco RV 이중 소화에 의해 적절한 방향으로 삽입 된 프로모터와 함께 pHuC 양성 클론 (pHuC_Mermaid)을 선택하십시오 ( SalI 제한 사이트는 단계 1.6에서 프로모터 단편의 상류에 삽입되었으며, Eco RV 제한 사이트 pCMV-SC 플라스미드의 폴리 아데 닐화 영역, 폴리 A의 하류에 위치한다).
    1. 다음과 같이 제한 반응을 설정하십시오 : Sal I 및 Eco RV 제한 효소 0.5 μL (10 U), kit10X 완충액 2 μL 및 20 μL의 총 부피의 pHuC_Mermaid DNA 1 μg. 반응을 37 ° C에서 1 시간 동안 항온 처리한다. Agarose 젤에 반응을 실행합니다.

2. 배아 마이크로 인젝션

  1. 수정 된 예야생형 (AB strain) 또는 Sod1-G93R 성인 zebrafish 4 에서 얻은 gs를 플라스틱 피펫을 사용하여 10mm 배양 접시에 옮긴다.
  2. 차가운 (4 ° C) 생선 물에서 배아를 헹구고 microinjector (microinjection 절차에 대한 전반적인 설명과 자세한 설명은 참고 문헌 7과 8 참조)를 사용하여 pHuC_Mermaid plasmid 200 pg으로 즉시 노른자에 마이크로 인젝션하십시오.
  3. 플라스틱 피펫을 사용하여 배아를 페트리 접시에 옮기고 다음 분석을 위해 원하는 발달 단계 (20-24 시간의 수정 후, hpf)에 도달 할 때까지 28 일 생선 물에서 배양하십시오.

3. 자연 테일 코일 링 분석

참고 : 20-24 hpf 배아에서 약물 릴 루졸 (riluzole)의 유무에 관계없이 자발적 꼬리 감기 거동을 평가하십시오.

  1. 0.2 % DMSO (riluzole 차량)가 들어있는 생선 물로 채워진 90mm 둥근 배양 접시에 배아를 옮기고 수동으로 tw를 사용하여 탈피하십시오날카로운 팁을 가진 보석상의 집게. 5 분 동안 배아를 품어.
  2. 실체 현미경에 장착 된 디지털 카메라를 사용하여 1 분간 비디오 녹화를하는 동안 RT에서 테일 코일 링을 감지합니다. 30 프레임 / s의 시간 해상도로 시간 시리즈를 획득하십시오.
  3. 시간 단위 당 구부리기 횟수 (대 측성 및 동측 모두)를 계산하여 자발 꼬리 감기 횟수를 계산합니다.
  4. 약물 riluzole의 효과를 평가하기 위해 부드럽게 플라스틱 파스퇴르 피펫을 사용하여 5 μm의 riluzole을 포함하는 생선 물로 채워진 새로운 90 mm 페트리 접시에 배아를 전송합니다.
    1. 1 분 비디오를 녹음하고 위와 같은 행동 분석을 수행하기 전에 5 분 동안 배아를 품어.

4. 살아있는 태아의 머메이드 바이오 센서 시각화를위한 이미징 설정 : 기증자와 억 셉터 신호의 동시 검출

  1. 생선 물에서 1 % 저 융점 아가로 오스에 20-24 hpf 태아를 장착하십시오.35mm 유리 바닥 이미징 접시 안에 37 ° C. 그들의 측면에 배아를 동양. 아가로 오스가 실온에서 응고 될 때까지 기다리십시오.
  2. 거꾸로 된 현미경에 거꾸로 공 촛점의 무대로 이미징 접시를 전송합니다. 488 nm 아르곤 레이저 라인으로 mUKG를 자극하고 495와 525 nm 사이에서 방출을 기록함으로써 20X 대물 렌즈 (0.7 개구 수, NA)로 바이오 센서를 표현하는 모터 뉴런을 확인하십시오.
  3. FRET 측정을 위해 FRET 쌍의 기증자 인 mUKG에 488 nm 레이저 라인을 자극하십시오. 양방향 모드에서 8,000 Hz에서 작동하는 공진 스캐너를 사용하여 도너 (495와 525 nm 사이)에서 방출 된 형광과 mKOk 수용기 (550과 650 nm 사이, FRET 채널)가 방출 한 형광을 동시에 감지합니다. 가능한 경우 473 nm 레이저를 사용하십시오.
    참고 : 도너의 여기 효율은 약간 감소 할 것이지만 (488 nm에서 93 % 대신 85 %), 억 셉터의 교차 여기는(473 nm 레이저 라인에서 488 nm에서 17 %에서 9 %로) 줄일 수 있습니다.
  4. 광 독성과 형광체 표백을 줄이려면 (수집 소프트웨어의 빔 경로 창 에서) 레이저 라인의 전력을 줄여 샘플 조명을 최소화하십시오.
  5. 실험 초기에 설정되고 세션 전체에서 일정하게 유지되는 게인 및 오프셋 매개 변수와 일치하도록 여기를 최적화합니다. 오프셋을 설정하려면 이미지의 색상을 (Q 검색 테이블을 사용하여) 강도 값으로 변경하고 레이저가 꺼진 상태에서 스캔하는 동안 배경 픽셀이 약간의 강도를 갖도록 오프셋 손잡이 (스마트 오프셋)를 돌립니다. 0보다 높습니다. 동일한 룩업 테이블에서 스캐닝 중에 레이저를 켜서 게인 노브 (스마트 게인)를 돌리면 신호 대 잡음비가 최대가되도록하고 포화 된 픽셀은 피하십시오.
  6. 개방 된 핀홀 (2 개의 통풍 장치)을 사용하여 16 비트 이미지를 수집하여 quantitativ에 충분한 동적 범위를 제공합니다.전자 분석. 획득 속도를 높이고 photobleaching을 최소화하기 위해 평균을 피하십시오.
  7. 소프트웨어 수집 창에서 드롭 다운 메뉴에서 512 x 64 픽셀 (픽셀 크기 : 605 nm)의 이미지 필드 크기를 선택하십시오.
  8. 획득 모드 창에서 드롭 다운 메뉴에서 xyt (단일 xy 평면의 시간 경과)를 선택하고 단일 xy 평면을 획득하고 매 30 초마다 하나의 이미지를 기록하도록 획득 매개 변수를 설정하여 배아 척수 신경 전압의 변화를 기록하십시오 1 분.
  9. 동일한 뉴런에서 막 탈분극에 riluzole 투여의 효과를 평가하기 위해, 5 μm의 riluzole을 포함하는 생선 물의 추가 5 분 후에 새로운 데이터 세트를 습득.
  10. FRET 분석을 위해서는 ImageJ 매크로 Biosensor_FRET (단일 사슬 FRET 바이오 센서를 표현)을 사용하십시오.
  11. ((FRET 평균 - FRET 배경) / (공여자 평균 - 공여자 배경)과 같은 t 1 에서 각 뉴런의 기초 막 FRET 비율을 평가하고, 여기서 FRET 및 Don또는 평균 강도는 획득 된 각 채널에 대해 세포 주위에 그려진 동일한 관심 영역 (ROI)에서 계산 된 평균 형광 강도이고, 도너 배경은 형광 샘플없이 시야의 ROI에서 계산 된 평균 형광 강도이다.
    참고 : 플러그인 사용에 대한 자세한 단계별 설명은 www.medc.unc.edu/microscopy/resources/imagej-plugins-and-macros/biosensor-fret 웹 사이트에서 찾을 수 있습니다.
  12. 그래프 화 소프트웨어를 사용하여 다른 실험 패러다임 간의 주파수, 진폭 및 탈분극 지속 시간을 비교하십시오. unpaired Student 's t -test를 사용하여 두 그룹을 비교하고 P <0.05 일 때 평균값을 통계적으로 다른 것으로 간주하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

배타적으로 단백질의 합성을 촉진하는 pHuC pan-neuronal promoter의 제어하에 FRET 기반의 Mermaid 바이오 센서 코딩 서열을 지닌 발현 벡터를 마이크로 인젝션에 의해 단일 세포 수정란에 전달 하였다. 일과성 트랜스 제닉 배아를 얻기 위해서 ( 그림 1 , 왼쪽 패널). microinjection 기법을 마스터 링 후, 인어 양성 배아의 백분율은 100 %에 가깝습니다. 이 중에서도 원형 막에 적절한 양의 인어 바이오 센서를 표현하는 배아 만 FRET 분석 / 이미지 획득을 고려했습니다.

자발적인 코일 감기, 꼬리의 끝을 머리 9 , 10에 가져 오는 전신 수축만으로 이루어진 운동 반응은 20 단계에서 기록되었습니다일반 물고기 배지 ( 그림 1 , 중앙 패널 및 비디오 1 )에서 -24 hpf, 5 μM riluzole ( 비디오 2 )에서 배양 후. 약물 릴 루졸에 의해 유발 된 자발 꼬리 꼬리 끌림의 빈도 변화에 대한 통계적 분석은 다른 곳에서보고 된 바있다.

척수 운동 신경 세포의 전기 활동의 변화가 자발적 코일 링 주파수에서의 릴 루졸 유도 변화의 기초인지 여부를 시험하기 위해, 배아 척추 운동 신경 세포의 막 전위를 비 침습적 방법으로 연구하여 형광 강도 (FRET 비율 : 그림 1 , 오른쪽 패널)의 공여체 / 수용체 FRET 쌍의 비율. 바이오 센서를 발현하는 1 차 척수 운동 뉴런 (primary spinal motor neurons)이 확인되었고 ( 그림 2A ), 그들의 기저 자발적인 탈분극 활동이 기록되었다 ( > 그림 2B 및 비디오 34 ). 꼬리 꼬임 코일 링 운동의 빈도 감소와 함께 riluzole 투여는 자발적인 탈분극 현상의 빈도를 감소 시켰습니다 ( 그림 2C ).

그림 1
그림 1 : 실험 절차의 흐름도. 단세포 단계 배아를 수집하고 pHuC_Mermaid 플라스미드로 즉시 마이크로 인젝션하여 인어 FRET 전압 바이오 센서를 범 - 연결 방식으로 표현한다. 28 ° C에서 배양 한 20-24 hpf에서 단일 배아를 실체 현미경으로 옮기고 생선 물에 존재하는 약물 릴 루졸이 있거나없는 자발적인 꼬리 감기 활동을 비디오로 기록하고 분석합니다. 동일한 배아는 모터 뉴런 막 잠재력의 변화를 측정하기 위해 생체 내 FRET 분석을 거친다.이 그림의 더 큰 버전을 보려면 href = "http://ecsource.jove.com/files/ftp_upload/55297/55297fig1large.jpg"target = "_ blank"> 여기를 클릭하십시오.

그림 2
그림 2 : 모터 뉴런 막 잠재력의 변화를 측정하기위한 생체 내 FRET 분석. ( A ) 척추 신경 세포에있는 FRET 기반 전압 바이오 센서 인어의 모자이크 발현과 함께 야생형 제브라 피쉬 배아. (a) 밝은 영역 이미지는 블랙 박스 (sc : 척수; ms : myoseptum; m : myotome)에 의해 식별되는 제브라 피쉬 트렁크의 영역을 나타낸다. 검출 된 형광 신호 (a)에 중첩함으로써, 1 차 척수 운동 뉴런 (PM)에서의 바이오 센서의 효율적인 발현이 명확하게 시각화 될 수있다. 검출 된 도너 (c) 및 FRET (d) 채널은 각각의 녹색 및 자홍색 룩업 테이블 (LUT)로 도시된다.오른쪽에. 모든 배아는 두개골 - 꼬리 방향으로 장착됩니다. 눈금 막대 = 10 μm. ( B ) FRET 비율 맵은 동일한 모터 뉴런에서 0.03 초마다 계산 된 FRET 비율을 표시합니다. 그것은 세포가 겪는 기초 자발적인 탈분극 활동을 보여줍니다. 인어 바이오 센서의 경우 막 전위가 증가하면 FRET 비율이 증가합니다. 눈금 막대 = 10 μm. ( C ) 1 분 녹음 동안 Sod1 - G93R zebrafish의 배아의 척수 운동 뉴런에서 발생하는 자발적인 평균 FRET 비율 변화의 대표 예. Riluzole 투여는 자발적인 탈분극 횟수를 줄입니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

영화 1
영화 1 :24 시간 hpf 야생형 제어 배아 에서 자발적 테일 코일 링 . 생선 물에서 배양 한 24 시간 hpf 야생형 대조 배아에서 자발적인 꼬리 꼬임을 나타내는 대표적인 기록. 이 비디오를 보려면 여기를 클릭하십시오. (마우스 오른쪽 버튼을 클릭하여 다운로드하십시오.)

영화 2
영화 2 : 24-hpf 야생형 riluzole 처리 된 태아 에서 자발적 테일 코일 링 . 5 μM riluzole (+ R)에서 배양 한 24 hpf 야생형 대조군 배아에서 자발적 꼬리 꼬임을 나타내는 대표적인 기록. 대조군과 비교하여, + R 배아는 24 hpf에서 자발적 꼬리 감기 거동의 빈도에서 유의 한 감소를 보였다. 이 비디오를 보려면 여기를 클릭하십시오. (도구ht를 클릭하여 다운로드하십시오.)

영화 3
영화 3 : 20 hpf에서 야생형 Zebrafish 태아의 척수에서 일차 운동 뉴런의 기본 자발적인 탈분극 활동. Mermaid 바이오 센서는 너무 민감하여 손상되지 않은 배아의 척수에서 모터 신경 막 전위의 급격한 변화를 감지 할 수 있습니다. 이 비디오를 보려면 여기를 클릭하십시오. (마우스 오른쪽 버튼을 클릭하여 다운로드하십시오.)

영화 4
영화 4 : 자발적인 탈분극 활동이 근육 수축에 결합됩니다. 20 hpf에서 야생형 제브라 피쉬 배아의 척수에서 이차 운동 신경 세포는 자발적인 탈분극을 경험한다. 이 경우 각 de양극화는이 발달 단계에서 기능적으로 동기화 된 syncytium으로 조직 된 제브라 피쉬 근육의 수축과 관련이있다. 이 비디오를 보려면 여기를 클릭하십시오. (마우스 오른쪽 버튼을 클릭하여 다운로드하십시오.)

Subscription Required. Please recommend JoVE to your librarian.

Discussion

이 프로토콜은 제브라 피쉬 배아 척수 운동 신경 세포의 전기적 특성과 자발적인 감기 행동, 초기 배아 발달의 17 hpf 주위에 나타나며 24 hpf까지 지속되는 초기 스테로이드 운동 활성 사이의 연관성을 탐색 할 수있었습니다.

우리의 접근 방식은 개발 기능 네트워크에서 세포 간의 상호 작용의 복잡성을 완전히 보존하면서 손상되지 않은 태아의 신경계를 연구하는 도구를 연구원들에게 제공합니다. 제브라 피쉬 배아의 생체 내 이미징은 저 융점 아가로 오스에 담그기 만하면 움직일 수 있습니다. 바이오 센서의 사용을 통한 세포막 전위의 변화에 ​​대한 연구는이 방법의 주요 이점 중 하나입니다. 신경 조직이 외피 조직을 제거함으로써 물리적으로 접근되어야하는 정규 전기 생리 학적 접근법은 절차 적이다검사중인 세포의 전기적 특성을 변화시킬 수 있습니다. 또한, FRET 기반 바이오 센서 접근법은 마취제 ( 즉, 나트륨 채널 차단제 Tricaine)를 사용하지 않고 세포의 전기 특성을 연구하여 화학 물질 투여와 관련된 잠재적 교란 ( 예 : 리 루졸)을 방지합니다. 실험 계획에서 중요 할 수도 있습니다. 이 방법을 통해 우리는 전기 활동과 자발적 꼬리 꼬임의 빈도에 초점을 맞출 수 있었는데, 대부분의 경우 마취제를 투여하지 않은 전기 생리 학적 녹음을 막는 행동 반응이었습니다. 마지막으로, GEVI의 고용은 특정한 배아 발달 단계에서 일할 수 있기 때문에 시간적 실험 제어가 가장 높다. 우리의 이미징 / 녹음 세션은 매우 제한된 시간대에 걸쳐서, 우리가 실시간으로 다른 배아의 발달 단계를 정확하게 비교할 수있게 해줍니다. 모든이와 반대로, 종래의 전기 생리 학적 기록은 대개 덜 정밀한 시간 범위에서 수행된다.

그러나 이미징 기술에 의한 전압 변화 측정은 속도, 주파수 및 막 전위 변화의 크기가 다를 수있는 신호 자체의 특성 때문에 본질적으로 어렵습니다. 이상적인 전압 센서는 빠른 반응성, 높은 감도 및 높은 광자 방출을 결합해야합니다. 대부분의 FRET 기반 GEVI의 경우, 비율 변화는 멤브레인 전압 변화의 함수에 따라 다르지만 형광 비율 변화의 진폭은 탈 극성 이벤트의 지속 기간과 밀접하게 관련됩니다. 최근에는 새로운 GEVI가 개발되고 특성화되었으므로 실험 문제, 모델 및 이미징 장치의 유형과 관련하여 최상의 프로브를 선택할 수 있습니다.

전압 바이오 센서는 통합 멤브레인 단백질입니다. 배양 된 세포로 트랜 스펙 션되거나 표현 될 때세포막에 국한 된 센서의 형광은 다른 세포 내 구획에있는 센서의 형광과 어느 정도 관련이있을 것입니다. 단백질이 잘못 국부화되거나 응집되어서 배경 신호가 생성 될 수 있습니다. 생체 내에서 바이오 센서를 사용하기 전에 단순한 실험 모델 ( 즉, 세포주 또는 1 차 배양 물을 형질 감염)에서 각 구조물의 발현 수준 및 적절한 멤브레인 위치를 모니터링해야한다.

현재의 실험 장치에서, 프로토콜의 또 다른 잠재적 결정 단계는 형질 전환 과정의 효율로 나타낼 수있다. 필요한 경우 Tol2 트랜스포존 시스템을 사용하여 플라스미드 양성 세포의 비율을 크게 높일 수 있습니다 12 . 고려해야 할 또 다른 중요한 측면은 기증자 형광 단의 형광 방출의 손실과 FRET 신호의 손실이다강렬한 조명 때문에 영상 촬영 중 발생합니다. 이는 시료의 조명을 최소화하여 사용되는 레이저 라인의 전력을 줄임으로써 피해야합니다. 마찬가지로 Photomultiplier의 게인과 오프셋은 포화 된 픽셀을 피할뿐만 아니라 수집 된 이미지에서 최상의 신호 대 잡음비를 얻기 위해 모든 레코딩 세션이 시작될 때 신중하게 조정해야합니다. 이 모든 매개 변수는 조사한 세포의 유형, 바이오 센서의 특성 및 이미지 획득에 사용되는기구 (최근에 기술 된 바와 같이 와이드 필드 형광 현미경을 사용할 수도 있음)에 따라 달라질 수 있습니다. 그러나 연구원은 생체 내 이미징 동안 잡음 수준이 시험 관내 기록보다 센서의 특정 신호를 간섭 할 수 있다고 항상 고려해야한다. 마지막으로, 가능하다면, 전압에 반응하지 않는 돌연변이 프로브를 이용한 대조 측정이 편리한 방법이 될 것입니다시스템 고유의 잡음 및 / 또는 인공물의 수준을 평가합니다.

제브라 피쉬 배아의 사용은 유전자 조작 및 현미경 조사에 대한 반응으로이 접근 방식의 핵심적인 특징을 나타냅니다. 사실, 이러한 특성은 transient transgenesis를 만들고 FRET 기반의 신경 전기 특성 분석을 가능하게합니다. 최적의 프로모터와 바이오 센서 조합을 사용하면 모든 세포 유형의 전기적 활성을 선택적으로 분석하고 배아 표현형과 유사한 활동을 수행 할 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Low Melting Point Agarose  Sigma-Aldrich A9414
DMSO  Sigma-Aldrich W387520
Riluzole Sigma-Aldrich R116
Pfu Ultra HQ DNA polymerase  Agilent Technologies - Stratagene Products Division 600389
T3 Universal primer  Sigma-Aldrich
Wizard SV Gel and PCR Clean-Up system Promega A9280
Universal SmaI primer  Eurofins
StrataClone Mammalian Expression Vector System / pCMV-SC blunt vector  Agilent Technologies - Stratagene Products Division  240228
SmaI  New England Biolabs R0141S
T4 DNA ligase Promega M1801
SalI New England Biolabs R0138S
EcoRV New England Biolabs R0195S
35 mm, glass-bottomed imaging dish  Ibidi 81151
forceps Sigma-Aldrich F6521
Stereomicroscope Leica Microsystems M10 F
Digital camera Leica Microsystems DFC 310 FX
Leica Application Suite 4.7.1 software  Leica Microsystems
QuickTime Player, v10.4 Apple
Confocal microscope (inverted) Leica Microsystems TCS SP5
Microinjector  Eppendorf  Femtojet
ImageJ macro Biosensor_FRET 
GraphPad Prism 6.0c  GraphPad Software, Inc

DOWNLOAD MATERIALS LIST

References

  1. Knöpfel, T., Gallero-Salas, Y., Song, C. Genetically encoded voltage indicators for large scale cortical imaging come of age. Curr Opin Chem Biol. 27, 75-83 (2015).
  2. Chemla, S., Chavane, F. Voltage-sensitive dye imaging: Technique review and models. J Physiol Paris. 104, (1-2), 40-50 (2010).
  3. Tsutsui, H., Karasawa, S., Okamura, Y., Miyawaki, A. Improving membrane voltage measurements using FRET with new fluorescent proteins. Nat Methods. 5, (8), 683-685 (2008).
  4. Benedetti, L., et al. INaP selective inhibition reverts precocious inter- and motorneurons hyperexcitability in the Sod1-G93R zebrafish ALS model. Sci Rep. 6, 24515 (2016).
  5. Pennati, R., et al. Morphological differences between larvae of the Ciona intestinalis species complex: hints for a valid taxonomic definition of distinct species. PLoS ONE. 10, (5), 0122879 (2015).
  6. Park, H. C., et al. Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic zebrafish with fluorescent neurons. Dev Biol. 227, (2), 279-293 (2000).
  7. Yuan, S., Sun, Z. Microinjection of mRNA and morpholino antisense oligonucleotides in zebrafish embryos. J Vis Exp. (27), (2009).
  8. Rosen, J. N., Sweeney, M. F., Mably, J. D. Microinjection of zebrafish embryos to analyze gene function. J Vis Exp. (25), (2009).
  9. Drapeau, P., et al. Development of the locomotor network in zebrafish. Prog Neurobiol. 68, (2), 85-111 (2002).
  10. Brustein, E., et al. Steps during the development of the zebrafish locomotor network. J Physiol Paris. 97, (1), 77-86 (2003).
  11. Drapeau, P., Ali, D. W., Buss, R. R., Saint-Amant, L. In vivo recording from identifiable neurons of the locomotor network in the developing zebrafish. J Neurosci Methods. 88, 1-13 (1999).
  12. Kawakami, K. Tol2: a versatile gene transfer vector in vertebrates. Genome Biol. 8, Suppl 1S7 (2007).
  13. Sungmoo, L., et al. Imaging Membrane Potential with Two Types of Genetically Encoded Fluorescent Voltage Sensors. J Vis Exp. (108), e53566 (2016).
살아있는 Zebrafish 배아에서의 바이오 센스 모터 뉴런 멤브레인 잠재력
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Benedetti, L., Ghilardi, A., Prosperi, L., Francolini, M., Del Giacco, L. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (124), e55297, doi:10.3791/55297 (2017).More

Benedetti, L., Ghilardi, A., Prosperi, L., Francolini, M., Del Giacco, L. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (124), e55297, doi:10.3791/55297 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter