Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Biosensing Motor Neuron Membran Potential i Live Zebrafish Embryos

doi: 10.3791/55297 Published: June 26, 2017
* These authors contributed equally

Introduction

In vivo systemisk komponentanalys gör det möjligt för forskare att undersöka cellulärt beteende på det mest tillförlitliga sättet. Detta gäller särskilt när aktiviteten under granskning påverkas starkt av cellcellsinteraktioner (både kontakt- och kontaktfria), som i nervsystemet, där membranspänningsförändringar driver kommunikationen bland excitativa celler. Förståelsen av informationen som kodas av dessa elektriska signaler är nyckeln till att förstå hur nervsystemet arbetar i både fysiologiska och sjukdomstillstånd.

För att studera cellelektriska egenskaper i de mest icke-invasiva fysiologiska förhållandena har flera genetiskt kodade spänningsindikatorer nyligen utvecklats 1 . I motsats till tidigare generationer av optiska spänningssensorer (huvudsakligen spänningskänsliga färgämnen) 2 möjliggör GEVIs in vivo analyser av det intakta neurala systemet ochDeras uttryck kan begränsas till specifika celltyper eller populationer.

Zebrafish embryot är valet av in vivo "substrat" ​​för att dra nytta av den stora potentialen som tillskrivs GEVIs. Tack vare sin optiska klarhet och det förenklade, men evolutionärt konserverade nervsystemet, möjliggör sebrafiskmodellen enkel identifiering och manipulation av varje cellulär komponent i ett nätverk. Anställningen av den FRET-baserade GEVI-sjöjungfrunen 3 ledde faktiskt till identifiering av pre-symptomatiska förändringar i spinalmotor-neuronbeteende i en zebrafiskmodell av amyotrofisk lateralskleros (ALS) 4 .

Följande in vivo- protokoll beskriver hur man övervakar de elektriska egenskaperna hos ryggmotoriska neuroner i intakta zebrafiskembryon som uttrycker sjöjungfru på ett neuronspecifik sätt. Dessutom demonstrerar det hur farmakologiskt inducerad chanGes i sådana elektriska egenskaper kan förknippas med förändringar i frekvensen av embryonala spontana spolar, den stereotypa motoraktiviteten som karakteriserar zebrafiskens rörelsebeteende vid mycket tidiga utvecklingsstadier.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. pHuC_Mermaid Plasmid Generation

ANMÄRKNING: Sjöjungfrun är en biosensor som utvecklats genom att koppla in spänningsavkännande domänen (VSD) av Ciona intestinalis (nu Ciona robusta ) 5 spänningssensor innehållande fosfatas (Ci-VSP) med FRET-partner fluorophores Umi-Kinoko Green (mUKG: donator) och en monomer version av det orangefärgade fluorescerande proteinet Kusabira Orange (mKOk: acceptor). För denna biosensor ökar konformationsförändringar av VSD-domänen, som induceras genom membranav depolarisation, närheten av donor- och acceptor-fluorescerande proteiner, vilket ökar energiöverföringen mellan dem (ökning av FRET-förhållandet) 3 . VSD försäkrar effektiv lokalisering av biosensorn vid plasmamembranet. Biosensorns neuronala uttryck (i ryggmärgen, signalen är detekterbar i både interneuroner och motorneuroner) uppnås genom att klonera sjöjungfruen påEn läsram (ORF) under den zebrafisk-pan-neurala promotorn HuC 6 .

  1. Förstärka med polymeras kedjereaktion (PCR) Mermaid ORF från pCS4 + Mermaid-plasmiden 3 med Pfu (korrekturläsning) DNA-polymeras med användning av T3 Universal Primer och Mermaid Sma I Primer (5'TATCCCGGGATTCGACGGTTCAGATTTTA) för att införa ett Sma I restriktionsställe uppströms Av sjöjungfruens ORF.
    1. Använd följande PCR-blandning: 0,5 | il Pfu-DNA-polymeras, 7,5 | il av den specifika 10x bufferten, 1 | il 10 mM dNTPs, 2,5 | il dimetylsulfoxid (DMSO), 0,5 | il (50 ng) av plasmidpreparatet och 1 Μl av 20 μM stamlösningar av varje primer i en total volym av 50 | il.
    2. Värm PCR-blandningen under 15 s vid 95 ° C, primär den under 15 s vid 50 ° C och förläng den i 4 minuter vid 72 ° C i totalt 35 cykler.
  2. Gel-rena den specifika trubbigaPCR-produkt med ett kommersiellt gelreningspaket, enligt tillverkarens protokoll.
  3. Klon DNA-fragmentet i den pCMV-SC-trubbiga vektorn enligt tillverkarens protokoll.
  4. Lineariserar den sjöjungfru-positiva plasmiden (benämnd pCMV-SC_Mermaid) med Sma I-restriktionsenzymet för följande införande av HuC-promotorn.
    1. Ställ in restriktionsreaktionen enligt följande: 0,5 | il (10 U) av Sma I-restriktionsenzym, 2 | il av sats 10x bufferten och 5 | ig plasmid-DNA i en total volym av 20 | il. Inkubera reaktionen vid 25 ° C i 1 h.
  5. Gel-rena den digererade plasmiden med användning av ett kommersiellt gelrenings kit enligt tillverkarens protokoll.
  6. PCR-amplifiera HuC-promotorn (pHuC), med Pfu-DNA-polymeras och genomfödt DNA från zebrafisk som mall, med användning av ett par HuC-specifika primrar (HuCprom-forw1_SalI: 5'-GTAGTCGACCAGACTTGTCAAAAGGGTCCA och HuCproM-rev1: 5'-TCCATTCTTGACGTACAAAGATG) och spänner över en 3,150-bp region uppströms ATG.
    1. Ställ in PCR-blandningen med hjälp av följande schema: 0,5 xl Pfu-DNA-polymeras, 7,5 xl av den specifika 10x bufferten, 1 xl 10 mM dNTPs, 2,5 xl DMSO, 200 ng genomiskt DNA och 1 xl 20 im Stamlösningar av varje primer i en total volym av 50 | il.
    2. Efter ett initialt steg på 2 min vid 95 ° C värms PCR-blandningen i 15 s vid 95 ° C, primer den i 15 s vid 50 ° C och förlängs den i 4 minuter vid 72 ° C i totalt 35 cykler .
  7. Gel-rena den specifika stumma PCR-produkten med ett kommersiellt gelreningssett enligt tillverkarens protokoll.
  8. Ligera en ekvimolär mängd av den renade pCMV-SC_Mermaid (steg 1.5) och pHuC-DNA (steg 1.7) med användning av 1 pl T4 DNA-ligas och 1 jil av den specifika 10X bufferten i en total volym av 10 jil. Inkubera reaktionen under 16 h vid4 ° C.
  9. Transformera en alikvot av kompetenta celler med 5 | il av ligeringsreaktionen (steg 1.8) enligt tillverkarens instruktioner.
  10. Välj de pHuC-positiva klonerna (pHuC_Mermaid) med promotorn insatt i korrekt orientering med hjälp av en Sal I- Eco RV dubbel-digestion ( Sal I-restriktionsstället har införts uppströms promotorfragmentet i steg 1.6, medan Eco RV-restriktionsstället Placeras nedströms polyadenyleringsområdet, PolyA, av pCMV-SC-plasmiden).
    1. Ställ in restriktionsreaktionen enligt följande: 0,5 μL (10 U) av både Sal I- och Eco RV-restriktionsenzymerna, 2 | il av kit10X-bufferten och 1 μg pHuC_Mermaid-DNA i en total volym av 20 | il. Inkubera reaktionen vid 37 ° C i 1 h. Kör reaktionerna på en agarosgel.

2. Embryo-mikroinjektion

  1. Överför befruktad t.ex.Gs erhållen från vildtyp (AB-stam) eller Sod1-G93R vuxen zebrafisk 4 till en 10 mm petriskål med en plastpipett.
  2. Skölj embryon i kallt (4 ° C) fiskvatten och omedelbart mikroinjektionera dem i äggulaen med 200 pg pHuC_Mermaid-plasmid med hjälp av en mikroinjektor (för en övergripande och detaljerad beskrivning av mikroinjektionsproceduren, se Referenser 7 och 8).
  3. Använd en plastpipett, överför embryonerna till en petriskål och inkubera dem i fiskvatten vid 28 ° C tills de når det önskade utvecklingsstadiet (20-24 timmar efter befruktning, hpf) för följande analyser.

3. Spontan svansanalys

OBS: Utvärdera det spontana svansspolningsbeteendet i 20-24 hkf-embryon med eller utan läkemedelsriluzol.

  1. Överför ett embryo till en 90 mm rund petriskål fylld med fiskvatten innehållande 0,2% DMSO (riluzol vehikel) och manuellt dechorionera det med tvåO juvelerare pincett med vassa tips. Inkubera embryot i 5 min.
  2. Upptäck svansspolen vid RT under en 1 minuters videoinspelning med hjälp av en digitalkamera monterad på ett stereomikroskop. Få tidsserier vid en tidsupplösning på 30 bilder / s.
  3. Beräkna frekvensen av spontana svansspolar genom att räkna antalet böjningar (både kontralaterala och ipsilaterala) per tidsenhet.
  4. För att utvärdera effekten av läkemedlet riluzole, använd försiktigt en plastpasteurpipett för att överföra embryot till en ny 90 mm petriskål fylld med fiskvatten innehållande 5 μM riluzole.
    1. Inkuber embryot i 5 minuter innan du spelar in en 1-min-video och utför beteendeanalysen som ovan.

4. Imaging Setup för Mermaid Biosensor Visualisering i levande embryon: Samtidig upptäckt av givare och Acceptorsignaler

  1. Montera 20-24 hpf-embryon i 1% smältpunktsagaros i fiskvatten vid37 ° C inuti en 35 mm glasbaserad bildskål. Orientera embryon på deras sidor. Vänta tills agarosen stelnar vid rumstemperatur.
  2. Överför bildskålen till scenen av en inverterad konfokal monterad på ett inverterat mikroskop. Identifiera motor neuroner som uttrycker biosensorn med ett 20X-objekt (0,7 numerisk bländning, NA) genom att spänna mUKG med 488 nm argonlaserlinjen och registrera dess emission mellan 495 och 525 nm.
  3. För en FRET-mätning, excitera mUKG, givaren till FRET-paret, med 488 nm laserlinjen. Samtidigt upptäcker, med en resonansscanner som arbetar vid 8000 Hz i dubbelriktat läge, fluorescensen som emitteras av givaren (mellan 495 och 525 nm) och fluorescensen som emitteras av mKOk-acceptorn (mellan 550 och 650 nm, FRET-kanalen). Använd 473 nm-lasern om den är tillgänglig.
    OBS: Givarens exciteringseffektivitet kommer att minskas något (85% i stället för 93% med 488 nm), men kors excitationen av acceptorn kommer attMinskas också (från 17% med 488 nm till 9% med 473 nm laserlinje).
  4. För att minska fototoxicitet och fluoroforblekning minimerar du belysningen av provet genom att minska laserlinjens effekt (på fönstret för strålbanan i förvärvsprogrammet).
  5. Optimera excitering för att matcha förstärknings- och offsetparametrar som är inställda i början av experimentet och hålls konstanta under hela sessionen. För att ställa in förskjutningen, ändra bildens färg till intensitetsvärden (med hjälp av Q-uppslagstabellen) och vrid offsetknappen (smart offset) medan scanning med lasern är avstängd så att bakgrundspixlarna har en intensitet något Högre än noll. Med samma uppslagstabell, genom att byta laser på medan du skannar, vrid förstärkningsknappen (smart gain) för att maximera signal-brusförhållandet, var försiktig så att du inte undviker mättade pixlar.
  6. Med hjälp av ett öppet pinhål (2 luftiga enheter), förvärva 16-bitars bilder för att ge ett tillräckligt dynamiskt intervall för kvantitativE analyser. Undvik medelvärde för att öka uppköpshastigheten och för att minimera fotobildning.
  7. I fönstret för uppköp av programvara väljer du en bildfältstorlek på 512 x 64 pixlar (pixelstorlek: 605 nm) i rullgardinsmenyn.
  8. Från fönstret för förvärvsläge väljer du xyt (tidsförlopp på ett enda xy-plan) f rommenyn och registrerar ändringarna i spänningsnervanspänning genom att förvärva ett enda xy-plan, vilket ställer in förvärvsparametrarna för att spela in en bild var 30: a Ms i 1 min.
  9. För att utvärdera effekten av riluzol administrering på membran depolarisation i samma neuron, förvärva en ny dataset 5 min efter tillsats av fiskvatten innehållande 5 μM riluzole.
  10. För FRET-analys, använd ImageJ-makro Biosensor_FRET (uttryckande FRET-biosensorer med en enda kedja.
  11. Utvärdera basalmembranets FRET-förhållande för varje neuron vid t 1 som ((FRET-medelvärdet - FRET-bakgrunden) / (Donormedel - Donorbakgrund)), där FRET och DonEller medelintensitet är den genomsnittliga fluorescensintensiteten beräknad i samma region av intresse (ROI) ritad runt cellen för varje förvärvad kanal och FRET och Donor-bakgrunden är den genomsnittliga fluorescensintensiteten beräknad i ett ROI i synfältet utan det fluorescerande provet.
    OBS! En detaljerad steg-för-steg beskrivning av användningen av plugin finns på www.med.unc.edu/microscopy/resources/imagej-plugins-and-macros/biosensor-fret webbplatsen.
  12. Använd en grafisk programvara för att jämföra frekvensen, amplituden och varaktigheten av depolarisering mellan olika experimentparamigmer. Jämför två grupper med en unpaired Students t- test och överväg medelvärdena som statistiskt olika när P <0,05.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

En expressionsvektor som bär den FRET-baserade sjöjungfrubiosensorkodningssekvensen under kontrollen av den pHuC-pan-neuronala promotorn, som driver proteinsyntes uteslutande i nervsystemet, levererades till encellsbefruktad ägg genom en mikroinjektion i För att erhålla transienta transgena embryon ( Figur 1 , Vänster panel). Efter mastering av mikroinjektionstekniken var andelen mermaid-positiva embryon nära 100%. Bland dessa undersöktes endast embryon som uttryckte den rätta mängden Mermaid biosensor vid plasmamembranen för FRET-analys / bildförvärv.

Spontana spolar, motorresponser som uteslutande består av en fullständig kroppskontraktion som leder spetsen av svansen till huvudet 9 , 10 , registrerades vid scenen 20-24 hpf i vanligt fiskmedium ( Figur 1 , mittpanel och Video 1 ) och efter inkubering i 5 μM riluzole ( Video 2 ). De statistiska analyserna av förändringarna i frekvensen av spontana svansspolar som utlöses av läkemedelsriluzolen rapporteras på annat håll 4 .

För att testa huruvida förändringar i den spinalmotoriska neurons elektriska aktivitet var på grundval av de riluzol-inducerade förändringarna i den spontana sammanfogningsfrekvensen, undersöktes membranpotentialen i embryo-spinalmotorneuroner på ett icke invasivt sätt, som mätt fluorescensintensiteten Förhållande mellan donator / acceptor FRET-paret av Mermaid biosensorn (FRET-förhållande: Figur 1 , höger panel). Primära ryggmotoriska neuroner som uttrycker biosensorn identifierades ( Figur 2A ) och deras basala spontana depolarisationsaktiviteter registrerades ( Ng> Figur 2B och Video 3 och 4 ). Tillsammans med minskningen av frekvensen av svansspolningsrörelser minskar riluzoladministrationen frekvensen av spontana depolariseringshändelser ( Figur 2C ).

Figur 1
Figur 1: Flödesschema för försöksproceduren. Enkla cellstegsembryon uppsamlas och omedelbart mikroinjektioneras med pHuC_Mermaid-plasmiden för att uttrycka FRAM-spänningsbiosensorn på sjöjungfrun på pan-neuronalt sätt. Vid 20-24 hkf med inkubering vid 28 ° C överförs enskilda embryon under ett stereomikroskop och deras spontana svansspolningsaktivitet, med och utan läkemedelsriluzolen närvarande i fiskvattnet, registreras och analyseras video. Samma embryon genomgår in vivo FRET-analys för att mäta förändringar i motorisk neuronmembranpotential.Href = "http://ecsource.jove.com/files/ftp_upload/55297/55297fig1large.jpg" target = "_ blank"> Vänligen klicka här för att se en större version av den här siffran.

Figur 2
Figur 2: In vivo FRET-analys för att mäta förändringar i motor neuron membranpotential. ( A ) Zebrafish embryon med vildtyp med mosaikuttrycket av FRET-baserad spänningsbiosensor Mermaid i ryggmärgen. (A) Den ljusa fältbilden visar området för zebrafiskstammen identifierad av den svarta lådan (sc: ryggmärg, ms: myoseptum, m: myotom). Genom att superimposera på (a) fluorescenssignalen detekterad (b) kan det effektiva uttrycket av biosensorn i en primär spinalmotorisk neuron (PM) tydligt visualiseras. Givaren (c) och detekterade FRET (d) -kanalen visas med respektive gröna och magenta uppslagstabeller (LUT)på höger sida. Alla embryon är monterade i en kranial-till-caudal orientering. Skala bar = 10 μm. ( B ) FRET-förhållandekartan visar FRET-förhållandet beräknat varje 0,03 s i samma motorneuron. Det visar den basala spontana depolariseringsaktiviteten som cellen genomgår. För Mermaid biosensorn uppstår ökningen av FRET-förhållandet när membranpotentialen ökar. Skala bar = 10 μm. ( C ) Representativt exempel på spontana genomsnittliga FRET-förhållande förändringar som uppträder i en ryggmotorisk neuron hos ett Sod1-G93R-zebrafiskembryo under en 1 minuters inspelning. Riluzole administrering minskar frekvensen av spontana depolarisationer. Vänligen klicka här för att se en större version av denna figur.

Film 1
Film 1:Spontan Tail Coiling i 24-hpf Wild-typ kontroll embryon. Representativ inspelning som visar spontan svansspolning i ett 24 hpf vildtypskontrollembryo inkuberat i fiskvatten. Vänligen klicka här för att se den här videon. (Högerklicka för att ladda ner.)

Film 2
Film 2: Spontan svanscoiling i 24-hpf vildtyps riluzolbehandlade embryon. Representativ inspelning som visar spontan svansspolning i ett 24 hpf vildtypskontrollembryo inkuberat i 5 uM riluzol (+ R). Jämfört med kontroller visade + R-embryon en signifikant minskning av frekvensen av spontan svansspolning vid 24 hpf. Vänligen klicka här för att se den här videon. (RiggHt-klicka för att ladda ner.)

Film 3
Film 3: Basal Spontan Depolariseringsaktivitet hos en Primär Motor Neuron i ryggmärgen hos en Wild-typ Zebrafish Embryo vid 20 hpf. Mermaid biosensorn är så känslig att den kan upptäcka de snabba förändringarna i motor neuronmembranpotential i ryggmärgskroppen av intakta embryon. Vänligen klicka här för att se den här videon. (Högerklicka för att ladda ner.)

Film 4
Film 4: Spontan depolarisationsaktivitet kopplas till muskelkontraktion. En sekundär motorneuron i ryggmärgen hos ett vildtypssebraf embryo vid 20 hpf genomgår spontan depolarisering. I det här fallet, varje dePolarisering är förknippad med en sammandragning av zebrafiskmusklerna, organiserad i ett funktionellt synkroniserat syncytium vid detta utvecklingsstadium. Vänligen klicka här för att se den här videon. (Högerklicka för att ladda ner.)

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Protokollet som presenteras här möjliggjorde att vi undersökte sambandet mellan de elektriska egenskaperna hos zebrafiskens embryo-ryggmotoriska neuroner och det spontana samlingsbeteendet, den tidigaste stereotypa motoraktiviteten, som uppträder kring 17 hkf av embryonisk utveckling och varar fram till 24 hkf 10 .

Vårt tillvägagångssätt ger forskare ett verktyg för att studera neurala systemet av intakta embryon, vilket helt bevarar komplexiteten hos interaktionerna mellan celler i ett utvecklingsfunktionellt nätverk. In vivo avbildning av zebrafiskembryon har utförts genom att helt enkelt immobilisera dem genom nedsänkning i lågsmältande agaros. Studien av förändringar i cellmembranpotential genom användning av en biosensor representerar en av huvudfördelarna med denna metod. Kanoniska elektrofysiologiska tillvägagångssätt, där neuroner måste vara fysiskt åtkomliga genom att avlägsna de omslutande vävnaderna 11 , är procedurEs som kan förändra de elektriska egenskaperna hos de celler som undersöks. Vidare möjliggör den FRET-baserade biosensormetoden att studera cellelektrogena egenskaper utan användning av anestetika ( dvs Tricaine, en natriumkanalblåsare), vilket undviker eventuell störning i samband med administrering av kemikalier ( dvs riluzol här), vilket Kan vara avgörande i försöksplanen. Denna metod gjorde det möjligt för oss att fokusera på moduleringen av både den elektriska aktiviteten och frekvensen av spontana svansspolar, ett beteendesvar som i de flesta fall förhindrar elektrofysiologiska inspelningar utan administrering av anestetika. Slutligen erbjuder anställning av GEVIs den högsta temporära experimentella kontrollen, eftersom det tillåter arbete vid ett specifikt embryonalt utvecklingsstadium. Våra avbildnings- / inspelningssessioner spände över ett mycket begränsat tidsfönster, vilket gör det möjligt för oss att exakt jämföra utvecklingsstadierna hos de olika embryonerna i realtid. AlltDe konventionella elektrofysiologiska inspelningarna, tvärtom, utförs vanligen i större och mindre exakta tidsutrymmen.

Mätning av spänningsändringar med bildtekniker är emellertid i grunden svårt på grund av själva signalen, vilken kan variera i hastighet, i frekvens och i storleken på förändringarna i membranpotentialen. En ideell spänningssensor bör kombinera snabb respons, hög känslighet och hög fotonutsläpp. För de flesta FRET-baserade GEVIs varierar förhållandevariationerna som en funktion av membranspänningsvariationer, men amplituden för fluorescensförhållandets förändringar är strikt associerad med varaktigheten av depolariseringshändelserna. Nyligen utvecklades och karaktäriserades nya GEVIs, vilket gör det möjligt att välja den bästa proben i förhållande till typen av experimentell problem, modell och bildanordning.

Spänningsbiosensorer är integrerade membranproteiner. När transfekteras i odlade celler eller uttrycksD i levande organismer, kommer fluorescensen hos den plasmamembran-lokaliserade sensorn i viss utsträckning att vara associerad med sensorens fluorescens i andra intracellulära fack - där proteinet kan misslokaliseras eller aggregeras, vilket alstra en bakgrundssignal. Utföringsnivån och den korrekta membranlokaliseringen av varje konstruktion bör övervakas i förenklade experimentella modeller ( dvs. transfektera cellinjer eller primära kulturer) innan biosensorerna används i levande organismer.

I föreliggande experimentinställning kan ett annat potentiellt kritiskt steg i protokollet representeras av effektiviteten hos transgenesförfarandet. Om nödvändigt kan andelen plasmid-positiva celler ökas drastiskt genom användning av Tol2-transposonsystemet 12 . En ytterligare viktig aspekt som måste beaktas är förlusten av fluorescensutsläpp i donorfluoroforen och förlusten hos FRET sigNal som uppstår under bildsessionen på grund av intensiv belysning. Detta bör undvikas genom att minimera belysningen av provet, vilket minskar kraften hos den använda laserlinjen. På liknande sätt måste förstärkaren och förskjutningen av fotomultiplikatorerna noggrant stämas i början av varje inspelningssession för att uppnå det bästa signal-brusförhållandet i de förvärvade bilderna samt för att undvika mättade pixlar. Alla dessa parametrar kan variera beroende på vilken typ av cell som undersöks, biosensorns egenskaper, och instrumenten som används för bildupptagning (brett fältfluorescensmikroskop kan också användas, såsom nyligen beskrivits 13 ). Forskaren bör dock alltid överväga att under in vivo- bildbehandling kan bullernivån störa sensorens specifika signal mer än i in vitro- inspelningar. Slutligen, om det är tillgängligt, skulle kontrollmätningar som använder mutantprober, som inte svarar på spänning, vara ett bekvämt sättAtt utvärdera nivån på systemspecifikt brus och / eller artefakter.

Sysselsättningen av zebrafiskembryon är ett viktigt inslag i detta tillvägagångssätt tack vare deras respons på genetisk manipulation och mikroskopisk undersökning. Faktum är att dessa egenskaper gör transient transgenes och den FRET-baserade analysen av neuronella elektriska egenskaper är möjliga. Enligt vår mening skulle det med potentiellt möjligt vara möjligt att selektivt analysera den elektriska aktiviteten av vilken celltyp av intresse som helst och parallell sådan aktivitet med den embryoniska fenotypen med de mest lämpade promotorerna och biosensorkombinationerna.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Low Melting Point Agarose  Sigma-Aldrich A9414
DMSO  Sigma-Aldrich W387520
Riluzole Sigma-Aldrich R116
Pfu Ultra HQ DNA polymerase  Agilent Technologies - Stratagene Products Division 600389
T3 Universal primer  Sigma-Aldrich
Wizard SV Gel and PCR Clean-Up system Promega A9280
Universal SmaI primer  Eurofins
StrataClone Mammalian Expression Vector System / pCMV-SC blunt vector  Agilent Technologies - Stratagene Products Division  240228
SmaI  New England Biolabs R0141S
T4 DNA ligase Promega M1801
SalI New England Biolabs R0138S
EcoRV New England Biolabs R0195S
35 mm, glass-bottomed imaging dish  Ibidi 81151
forceps Sigma-Aldrich F6521
Stereomicroscope Leica Microsystems M10 F
Digital camera Leica Microsystems DFC 310 FX
Leica Application Suite 4.7.1 software  Leica Microsystems
QuickTime Player, v10.4 Apple
Confocal microscope (inverted) Leica Microsystems TCS SP5
Microinjector  Eppendorf  Femtojet
ImageJ macro Biosensor_FRET 
GraphPad Prism 6.0c  GraphPad Software, Inc

DOWNLOAD MATERIALS LIST

References

  1. Knöpfel, T., Gallero-Salas, Y., Song, C. Genetically encoded voltage indicators for large scale cortical imaging come of age. Curr Opin Chem Biol. 27, 75-83 (2015).
  2. Chemla, S., Chavane, F. Voltage-sensitive dye imaging: Technique review and models. J Physiol Paris. 104, (1-2), 40-50 (2010).
  3. Tsutsui, H., Karasawa, S., Okamura, Y., Miyawaki, A. Improving membrane voltage measurements using FRET with new fluorescent proteins. Nat Methods. 5, (8), 683-685 (2008).
  4. Benedetti, L., et al. INaP selective inhibition reverts precocious inter- and motorneurons hyperexcitability in the Sod1-G93R zebrafish ALS model. Sci Rep. 6, 24515 (2016).
  5. Pennati, R., et al. Morphological differences between larvae of the Ciona intestinalis species complex: hints for a valid taxonomic definition of distinct species. PLoS ONE. 10, (5), 0122879 (2015).
  6. Park, H. C., et al. Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic zebrafish with fluorescent neurons. Dev Biol. 227, (2), 279-293 (2000).
  7. Yuan, S., Sun, Z. Microinjection of mRNA and morpholino antisense oligonucleotides in zebrafish embryos. J Vis Exp. (27), (2009).
  8. Rosen, J. N., Sweeney, M. F., Mably, J. D. Microinjection of zebrafish embryos to analyze gene function. J Vis Exp. (25), (2009).
  9. Drapeau, P., et al. Development of the locomotor network in zebrafish. Prog Neurobiol. 68, (2), 85-111 (2002).
  10. Brustein, E., et al. Steps during the development of the zebrafish locomotor network. J Physiol Paris. 97, (1), 77-86 (2003).
  11. Drapeau, P., Ali, D. W., Buss, R. R., Saint-Amant, L. In vivo recording from identifiable neurons of the locomotor network in the developing zebrafish. J Neurosci Methods. 88, 1-13 (1999).
  12. Kawakami, K. Tol2: a versatile gene transfer vector in vertebrates. Genome Biol. 8, Suppl 1S7 (2007).
  13. Sungmoo, L., et al. Imaging Membrane Potential with Two Types of Genetically Encoded Fluorescent Voltage Sensors. J Vis Exp. (108), e53566 (2016).
Biosensing Motor Neuron Membran Potential i Live Zebrafish Embryos
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Benedetti, L., Ghilardi, A., Prosperi, L., Francolini, M., Del Giacco, L. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (124), e55297, doi:10.3791/55297 (2017).More

Benedetti, L., Ghilardi, A., Prosperi, L., Francolini, M., Del Giacco, L. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (124), e55297, doi:10.3791/55297 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter