Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Canlı Zebra balığı Embriyolarında Biosense Motor Nöron Membranı Potansiyeli

doi: 10.3791/55297 Published: June 26, 2017
* These authors contributed equally

Introduction

İn vivo sistemik bileşen analizi, bilim insanlarının hücresel davranışlarını en güvenilir biçimde araştırmalarını sağlar. İncelenen aktivite, membran voltajı değişikliklerinin uyarılabilir hücreler arasındaki iletişimi yönlendirdiği sinir sisteminde olduğu gibi, hücre-hücre etkileşimlerinden (temaslı ve temassız olmak üzere) büyük ölçüde etkilendiğinde, bu durum özellikle geçerlidir. Bu elektrik sinyalleri tarafından kodlanan bilginin anlaşılması, sinir sisteminin hem fizyolojik hem de hastalık hallerinde nasıl çalıştığı anlamanın anahtarıdır.

En invaziv olmayan fizyolojik koşullarda hücre elektriksel özelliklerini incelemek için yakın zamanda birkaç genetik olarak kodlanmış gerilim göstergesi geliştirilmiştir 1 . Önceki nesiller optik voltaj sensörlerinin (özellikle voltaja duyarlı boyalar) 2 aksine, GEVI'ler bozulmamış sinir sisteminin in vivo analizlerine izin verir veIfadeleri, spesifik hücre tipleri veya popülasyonları ile sınırlanabilir.

Zebra balığı embriyo, GEVI'ye atfedilen büyük potansiyelin avantajlarından yararlanmak için seçilen in vivo "substrat" ​​tır. Aslında, optik netliği ve basitleştirilmiş ve evrimsel olarak korunmuş sinir sistemi sayesinde zebra balığı modeli, bir ağdaki her hücresel bileşenin anlaşılır bir şekilde tanımlanmasına ve manipüle edilmesine olanak tanır. Aslında, FRET tabanlı GEVI Mermaid 3'ün istihdamı, amyotrofik lateral skleroz (ALS) 4'ün zebrafish modelinde spinal motor nöron davranışındaki semptomatik önlemlerin tanımlanmasına yol açtı.

Aşağıdaki canlı organizma protokolü, Mermaid'i nörona spesifik bir şekilde ifade eden bozulmamış zebra balığı embriyolarındaki omurilik motor nöronlarının elektriksel özelliklerini nasıl izleyeceğini açıklamaktadır. Dahası, farmakolojik olarak indüklenen chan'ınBu tür elektriksel özelliklerdeki ges, gelişimin çok erken evrelerinde zebra balığı hareket davranışını karakterize eden stereotipik motor aktivite olan embriyonik spontan sargıların frekansındaki değişikliklerle ilişkilendirilebilir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. pHuC_Mermaid Plasmid Üretimi

NOT: Denizkızı, Ciona intestinalis'in voltaj algılama alanını (VSD) eşleştirerek geliştirilen bir biyosensördür (şimdi FRET partneri fluorophores Umi-Kinoko Green (mUKG: verici) ve turuncu-yayan floresan protein Kusabira Orange (mKOk: acceptor) monomerik versiyonu ile fosfataz (Ci-VSP) içeren 5 voltaj sensörü. Bu biyolojik sensör için, membranın depolarizasyonu ile uyarılan VSD alanının konformasyonel değişimleri, verici ve alıcı floresan proteinlerin yakınlığını arttırır, böylece aralarındaki enerji transferini arttırır (FRET Oranının arttırılması) 3 . VSD, plazma membranında biyo-sensörün etkin lokalizasyonunu sağlar. Biyosensörün nöronal ifadesi (omurilikte, sinyal hem internöronlarda hem de motor nöronlarda saptanabilir), Deniz Kızı opsiyonunun klonlanmasıyla elde edilirZebra balığı pan-sinir promotörü HuC 6'nın altında bir çerçeve (ORF) okuma.

  1. T3 Universal primerini ve Deniz Kızı Sma I primerini (5'TATCCCGGGATTCGACGGTTCAGATTTTA) kullanarak polimeraz zincir reaksiyonu (PCR) ile pCS4 + Mermaid plasmid 3'ten Mermaid ORF'yi Pfu (prova okuma) DNA polimeraz ile yükseltin ve böylece yukarıya bir Sma I sınırlama bölgesi yerleştirilir Denizkızı ORF.
    1. Aşağıdaki PCR karışımını kullanın: 0.5 uL Pfu DNA polimeraz, 7.5 uL özgül 10x tampon, 1 uL 10 mM dNTP, 2.5 uL dimetil sülfoksit (DMSO), 0.5 uL (50 ng) plazmid preparatı ve 1 Toplam 50 μL hacimdeki her bir primerin 20 μM stok solüsyonlarının μL'si.
    2. PCR karışımını 95 ° C'de 15 saniye boyunca ısıtın, 50 ° C'de 15 saniye boyunca başlatın ve toplam 35 devir boyunca 72 ° C'de 4 dakika boyunca uzatın.
  2. Belirli küntleri jel-arındırmakPCR ürünü, ticari bir jel arıtma kiti kullanılarak imalatçının protokolünü izleyerek.
  3. Üreticinin protokolünü izleyerek DNA parçasını pCMV-SC künt vektör içine klonlayın.
  4. HuC promoterinin aşağıdaki eklenmesi için Mermaid pozitif plasmidini (pCMV-SC_Mermaid olarak adlandırılır) Sma I restriksiyon enzimi ile lineerize edin.
    1. Restriksiyon reaksiyonunu aşağıdaki gibi ayarlayın: Sma I sınır enziminin 0.5 uL'si (10 U), kit 10x tampon maddenin 2 uL'si ve toplam 20 μL hacimdeki plasmid DNA'sının 5 μg'si. Reaksiyonu 25 ° C'de 1 saat inkübe edin.
  5. Üreticinin protokolünü izleyen ticari bir jel arıtma kiti kullanılarak sindirilmiş plazmiti jel-arındırın.
  6. Bir çift HuC-spesifik primer (HuCprom-forwl_SalI: 5'-GTAGTCGACCAGACTTGTCAAAAGGGTCCA ve HuCpro kullanılarak, şablon olarak Pfu DNA polimeraz ve zebrafish genomik DNA'sı ile HuC yükselticisini (pHuC) PCR ile çoğaltınM-rev1: 5'-TCCATTCTTGACGTACAAAGATG) ve ATG'nin akış yukarı akışında 3.150 bp'lik bir bölgeye yayılmıştır.
    1. Aşağıdaki şemayı kullanarak PCR karışımını ayarlayın: Pfu DNA polimerazın 0.5 uL'si, spesifik 10x tamponun 7.5 uL'si, 10 mM dNTP'lerin 1 uL'si, DMSO'nun 2.5 uL'si, genomik DNA'nın 200 ng'si ve 20-μM'lik 1 uL'lik Her primerin stok solüsyonları toplam 50 μL hacimdedir.
    2. 95 ° C'de 2 dakikalık bir başlangıç ​​basamağından sonra, PCR karışımını 95 ° C'de 15 saniye ısıtın, 50 ° C'de 15 saniye süreyle asın ve toplam 35 döngü için 72 ° C'de 4 dakika uzatın .
  7. Üreticinin protokolünü izleyerek ticari bir jel arıtma kiti kullanarak spesifik künt PCR ürününü jel-arındırın.
  8. 1 mcL T4 DNA ligaz ve 10 uL'lik bir toplam hacimde spesifik 10X tamponun 1 uL'si kullanılarak saflaştırılmış pCMV-SC_Mermaid'in (basamak 1.5) ve pHuC DNA'sının (basamak 1.7) eş molar bir miktarı ligatlandırın. Reaksiyonu 16 saat boyunca enkübe edin4 ° C.
  9. Üreticinin talimatlarını izleyen 5 μL ligasyon reaksiyonu ile (adım 1.8) yetkili hücrelerin bir bölümünü dönüştürün.
  10. Bir Sal I- Eco RV çift sindirimiyle (SalI kısıtlama bölgesi adım 1.6'da promoter fragmanının akış aşağısına sokuldu ise Eco RV kısıtlama bölgesi PCMV-SC plazmidinin poliadenilasyon bölgesi olan PolyA'nın akış aşağısında yer alır).
    1. Restriksiyon reaksiyonunu aşağıdaki gibi ayarlayın: hem Sal I hem de Eco RV kısıtlama enzimlerinin 0.5 uL'si (10 U), kit10X tamponunun 2 uL'si ve 1 μg pHuC_Mermaid DNA'nın toplam hacmi 20 uL olmalıdır. Reaksiyonu 37 ° C'de 1 saat inkübe edin. Tepkimeleri bir agaroz jel üzerine uygulayın.

2. Embriyo Mikroenjeksiyonu

  1. Döllenen örneği transfer edin(AB türü) ya da Sod1-G93R yetişkin zebra balığı 4'ten plastik bir pipet kullanılarak 10 mm'lik bir Petri kabuğundan elde edilen gs'dir.
  2. Embriyoları soğuk (4 ° C) balık suda durulayın ve bir microinjector kullanarak 200 μg pHuC_Mermaid plazmid ile hemen sarılı içine mikroenjekte edin (mikroenjeksiyon prosedürünün genel ve detaylı bir tarifi için bkz. Referanslar 7 ve 8).
  3. Plastik bir pipet kullanarak embriyoları bir Petri kabına aktarın ve aşağıdaki analizler için istenen gelişim evresine (20-24 saat sonrası dölleme, hpf) ulaşana kadar 28 ° C'de balık suyunda inkübe edin.

3. Spontan Kuyruk Sargısı Analizi

NOT: 20-24 hpf embriyolarında spontan kuyruk sarmalama davranışını riluzole ilaç ilacı olsun veya olmasın değerlendirin.

  1. % 0.2 DMSO (riluzole araç) içeren balık suyuyla doldurulmuş 90 mm'lik yuvarlak bir Petri kabına bir embriyo aktarın ve elle de tw kullanarak kapatıp çıkarınO Kuyumcunun forsepsleri keskin uçlarla. Embriyo 5 dakika inkübe edin.
  2. Bir stereomikroskopta monte edilmiş dijital bir kamera kullanarak 1 dakika video kaydı sırasında kuyruk sargısını RT'de algılayın. 30 karelik / s'lik bir zaman çözünürlüğünde zaman serileri elde edin.
  3. Zaman birimi başına viraj sayısını (hem kontralateral hem de ipsilateral) sayarak spontan kuyruk sargılar sıklığını hesaplayın.
  4. İlaç riluzolunun etkisini değerlendirmek için, 5 μM riluzol içeren balık suyu ile dolu yeni bir 90 mm Petri kabına embriyo aktarmak için hafifçe bir plastik Pasteur pipeti kullanın.
    1. 1 dk. Video kaydetmeden önce davranış analizi uygulayarak embriyo 5 dakika inkübe edin.

4. Yaşayan Embriyolarda Denizkızı Biyosensör Görselleştirme Görüntüleme Kurulumu: Verici ve Alıcı Sinyallerinin Eşzamanlı Tespiti

  1. 20-24 hpf embriyolarını% 1 düşük erime noktalı agarozda balık suyuna37 ° C'de 35 mm'lik cam tabanlı bir görüntüleme çanağının içinde. Embriyoların yanlarını yönlendirin. Agaroz oda sıcaklığında katılaşıncaya kadar bekleyin.
  2. Ters çevrilmiş mikroskopta monte edilmiş ters çevrilmiş bir konfokalın sahnesine görüntüleme çanağını aktarın. 488 nm argon lazer hattı ile mUKG'yi heyecanlandırarak ve 495 ila 525 nm arasındaki emisyonunu kaydeden biyolojik sensörü ifade eden motor nöronları 20X'lik bir objektifle (0,7 sayısal diyafram açıklığı, NA) tanımlayın.
  3. FRET ölçümü için, FRET çifti vericisi olan mUKG'yi 488 nm lazer hattı ile tahrik edin. Çift yönlü modda 8.000 Hz'de çalışan bir rezonant tarayıcı ile donör tarafından yayılan flüoresan (495 ila 525 nm arasında) ve mKOk alıcı tarafından yayılan flüoresan (550 ve 650 nm arasında FRET kanalı) eşzamanlı olarak algılayın. Varsa, 473 nm lazeri kullanın.
    NOT: Donörün uyarılma verimi hafifçe azalacaktır (488 nm'de% 93 yerine% 85), fakat alıcıın çapraz uyarımının(488 nm'de% 17'den 473 nm lazer hattıyla% 9'a) azaltılmalıdır.
  4. Fototoksisite ve florofor ağartmayı azaltmak için lazer hattının gücünü azaltarak (satın alma yazılımının kiriş yol penceresinde ) numunenin aydınlatmasını en aza indirin.
  5. Uyarıyı, denemenin başında belirlenen ve oturum boyunca sabit tutulan kazanç ve ofset parametreleriyle eşleşecek şekilde optimize edin. Ofseti ayarlamak için, görüntünün rengini yoğunluk değerlerine değiştirin (Q arama tablosunu kullanarak) ve lazer kapalıyken tarama yaparken ofset düğmesini çevirin (akıllı ofset), böylece arka plandaki piksellerin hafif yoğunluğa sahip olması gerekir Sıfırdan yüksek. Aynı tarama tablosunda, tarama sırasında lazeri açarak, doymuş pikselleri önlemeye dikkat ederek sinyal-gürültü oranını en üst düzeye çıkarmak için kazanç düğmesini çevirin (akıllı kazanç).
  6. Açık bir iğne deliği (2 havadar birimi) kullanarak nicel için yeterli dinamik aralık sağlamak için 16 bit görüntüler elde edinE analizleri. Edinme hızını artırmak ve photobleaching'i en aza indirgemek için ortalamalardan kaçının.
  7. Yazılım edinme penceresinde, açılır menüden 512 x 64 piksel (piksel boyutu: 605 nm) boyutundaki bir resim alanını seçin.
  8. Edinme modu penceresinden açılır menüden xyt (tek bir xy düzleminde zaman aşımı) seçin ve tek bir xy düzlemi edinerek embriyo spinal nöron voltajındaki değişiklikleri kaydedin , her bir görüntüyü 30 dakikada bir kaydetmek için edinme parametrelerini ayarlayın Ms 1 dakika boyunca.
  9. Aynı nöronda membran depolarizasyonu üzerine riluzole uygulanmasının etkisini değerlendirmek için, 5 μM riluzol içeren balık suyunun eklenmesinden 5 dakika sonra yeni bir veri kümesi edinin.
  10. FRET analizi için ImageJ makrosu Biosensor_FRET'i kullanın (tek zincirli FRET biyosensörlerini ifade eder.
  11. T1'deki her nöronun bazal membran FRET oranını ((FRET ortalama - FRET arka planı) / (Donör ortalama - Donör arka plan) gibi değerlendirin; burada FRET ve DonVeya ortalama yoğunluk, elde edilen her kanal için hücrenin etrafında çizilmiş olan aynı ilgi alanında (ROI) hesaplanan ortalama floresan yoğunluğudur ve FRET ve Donör arka plan, floresan numunesi olmadan görüş alanının bir ROI'sinde hesaplanan ortalama floresan yoğunluğudur.
    NOT: Eklentinin kullanımıyla ilgili ayrıntılı bir adım adım açıklama www.med.unc.edu/microscopy/resources/imagej-plugins-and-macros/biosensor-fret web sitesinde bulunabilir.
  12. Farklı deneysel paradigmalar arasındaki depolarizasyon frekansını, amplitüdünü ve süresini karşılaştırmak için bir grafik yazılımı kullanın. Eşlenmemiş bir Öğrencinin t- testi kullanarak iki grubu karşılaştırın ve P <0.05 olduğunda istatistiksel olarak farklı ortalama değerler düşünün.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Protein sentezini sadece sinir sisteminde yönlendiren pHuC pan-nöronal promotörün kontrolü altında FRET-esaslı Denizkızı biyosensör kodlama sekansını taşıyan bir ifade vektörü, tek hücreli döllenmiş yumurtalara bir mikroenjeksiyon vasıtasıyla Geçici transgenik embriyoların elde edilmesi için sipariş verme ( Şekil 1 , Sol panel). Mikroenjeksiyon tekniğini uyguladıktan sonra, Denizkızı pozitif embriyoların yüzdesi% 100'e yakıntı. Bunlardan FRET analizi / görüntüsü edinimi için sadece plazma zarında uygun miktarda Denizkızı biyosensörünü ifade eden embriyolar düşünülmüştür.

Spontan sargılar, yalnızca kuyruk ucunu baş 9 , 10'a getiren tam bir vücut kasılması içeren motor yanıtları 20 evre kaydedildi-24 hpf ( Şekil 1 , merkez paneli ve Video 1 ) ve 5 μM riluzole ( Video 2 ) inkübasyondan sonra. Riluzol ilacı tarafından tetiklenen spontan kuyruk sargılarındaki frekans değişikliklerinin istatistiksel analizleri başka yerlerde bildirilmiştir 4 .

Omurga motor nöronlarının elektriksel aktivitesindeki değişiklikler spontan sargı frekansındaki riluzole bağlı değişikliklerin temelinde olup olmadığını test etmek için, embriyo omurilik motor nöronlarındaki zar potansiyeli invaziv olmayan bir şekilde incelendi ve floresan yoğunluğunu ölçtü Mermaid biyosensörün donör / alıcısı FRET çifti oranı (FRET oranı: Şekil 1 , sağ panel). Biyosensörü ifade eden primer spinal motor nöronlar tespit edildi ( Şekil 2A ) ve bazal spontan depolarizasyon aktiviteleri kaydedildi ( Şekil 2B ve Videolar 3 ve 4 ). Kuyruk sargısı hareketlerinin sıklığında azalma ile birlikte, rilozol uygulaması spontan depolarizasyon olaylarının sıklığını azalttı ( Şekil 2C ).

Şekil 1
Şekil 1: Deneysel İşlemin Akış Şeması. Tek hücre aşamalı embriyolar toplanır ve hemen pHuC_Mermaid plazmid ile mikro-enjekte edilir ve böylece Mermaid FRET voltaj biyosensörünün pan-nöronal modele dönüştürülmesi sağlanır. 28 ° C'de inkübasyon ile 20-24 hpf'de, tekli embriyolar bir stereomikroskop altında transfer edilir ve balık suyunda bulunan riluzol ilacı olan veya içermeyen spontan kuyruk sarmalama etkinliği video kaydedilir ve analiz edilir. Aynı embriyolar, motor nöron zar potansiyelindeki değişiklikleri ölçmek için in vivo FRET analizine tabi tutulur.Href = "http://ecsource.jove.com/files/ftp_upload/55297/55297fig1large.jpg" target = "_ blank"> Bu rakamın daha büyük bir sürümünü görmek için lütfen tıklayınız.

şekil 2
Şekil 2: Motor Nöron Membran Potansiyelindeki Değişiklikleri Ölçmek İçin In Vivo FRET Analizi. ( A ) Omurga nöronunda FRET tabanlı voltaj biyosensörü Mermaid'in mozaik ifadesi ile vahşi tip zebra balığı embriyoları. (A) Parlak alan görüntüsü, kara kutu tarafından tanımlanan zebra branşı gövdesinin alanını gösterir (sc: omurilik; ms: miyozim; m: miyotom). (A) Tespit edilen flüoresans sinyali (b) üzerine bindirilerek, biosensörün primer omurga motor nöronunda (PM) etkili bir şekilde ifade edilmesi açıkça görülebilir. Tespit edilen donör (c) ve FRET (d) kanalı, ilgili yeşil ve macenta arama tablolarıyla (LUT)sağ tarafta. Tüm embriyolar kafa-kaudal oryantasyonda monte edilirler. Ölçek çubuğu = 10 μm. ( B ) FRET oranı haritası, aynı motor nöronda her 0,03 saniyede hesaplanan FRET oranını gösterir. Bu, hücrenin maruz kaldığı bazal spontan depolarizasyon aktivitesini gösterir. Mermaid biyosensör için, membran potansiyeli arttığında FRET oranındaki artış oluşur. Ölçek çubuğu = 10 μm. ( C ) Bir 1 dakika süreyle bir Sod1-G93R zebrafish embriyo spinal motor nöronunda meydana gelen kendiliğinden ortalama FRET oranı değişikliklerinin temsili örneği. Riluzol uygulaması spontan depolarizasyon sıklığını azaltmaktadır. Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

Film 1
Film 1:24 saatlik spontan kuyruk sarımı Yabani tip kontrol Embriyoları. Balık suda inkübe edilen 24 hpf vahşi tipli kontrol embriyosunda spontan kuyruk sargısını gösteren temsilci kaydı. Bu videoyu izlemek için lütfen tıklayınız. (İndirmek için sağ tıklayın.)

Film 2
Film 2: 24-hpf Vahşi tipli rilüzole tabi tutulmuş embriyolarda spontan kuyruk sarımı . Temsilci kayıt, 5 uM riluzole (+ R) inkübe edilmiş 24 hpf vahşi tipli kontrol embriyosunda spontan kuyruk sarma işlemini göstermektedir. Kontrollerle karşılaştırıldığında, + R embriyoları, 24 hpf'de spontan kuyruk sarmalama davranışının frekansında önemli bir azalma gösterdi. Bu videoyu izlemek için lütfen tıklayınız. (TeçhizatIndirmek için ht-tıklayın.)

Film 3
Film 3: 20 hpf'de Vahşi Bir Zebra balığı Embriyo'sunun Spinal Kordundaki Primer Bir Motor Nöronun Bazal Spontan Depolarizasyon Aktivitesi. Mermaid biyo-sensörü, hassas embriyoların spinal kordlarındaki motor nöron membran potansiyelindeki hızlı değişimleri algılayacak kadar hassas. Bu videoyu izlemek için lütfen tıklayınız. (İndirmek için sağ tıklayın.)

Film 4
Film 4: Spontan Depolarizasyon Aktivitesi, Kas Kasılması ile birleştirilir. 20 hpf'de vahşi tip zebra bağı embriyonunun omuriliğinde ikincil bir motor nöron spontan depolarizasyona uğrar. Bu durumda, her biriKutuplaşma, zebra balığı kaslarının, bu gelişim evresinde işlevsel olarak senkronize bir sinsityumda düzenlenmiş bir kasılmaya eşlik eder. Bu videoyu izlemek için lütfen tıklayınız. (İndirmek için sağ tıklayın.)

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Burada sunulan protokol, zebrafish embriyo omurga motor nöronlarının elektriksel özellikleri ile embriyonik gelişimin yaklaşık 17 hpf'sinde görülen ve 24 hpf 10'a kadar uzanan ilk stereotipik motor aktivite olan spontan sarmal davranış arasındaki ilişkiyi keşfetmemizi sağladı.

Yaklaşımımız araştırmacılara, bozulmamış embriyoların sinir sistemini incelemek için geliştirilmiş bir işlevsel ağdaki hücreler arasındaki etkileşimlerin karmaşıklığını tamamen koruyan bir araç sağlar. Zebra balığı embriyolarının in vivo olarak görüntülenmesi, onları düşük erime noktasına sahip agaroza batırarak basitçe immobilize ederek gerçekleştirildi. Bir biyosensör kullanarak hücre zarı potansiyelindeki değişiklikler bu yöntemin en önemli avantajlarından birini temsil eder. Nöronların zarflama dokularını 11 çıkararak fiziksel olarak erişilmesi gereken kanonik elektrofizyolojik yaklaşımlar, işlemdirİnceleme altındaki hücrelerin elektriksel özelliklerini değiştirebilecek hallerde. Dahası, FRET tabanlı biyosensör yaklaşımı, kimyasalların ( yani burada riluzole) verilmesiyle ilişkili herhangi bir potansiyel rahatsızlıktan kaçınarak , anestezik kullanmadan ( yani, bir tricaine, bir sodyum kanalı bloke edici) hücre elektriksel özelliklerinin çalışılmasını sağlar; Deney planında çok önemli olabilir. Bu yöntem hem elektriksel aktivitenin hem de spontan kuyruk sarmallarının frekansının modülasyonuna odaklanmamıza izin verdi, bu davranış davranıyordu ki çoğu zaman elektrofizyolojik kayıtların anestezi uygulanmadan yapılmasını engelliyordu. Son olarak, GEVI'lerin istihdamı, en yüksek zamansal deneysel kontrol sağlar, çünkü belirli bir embriyonik gelişim aşamasında çalışmayı sağlar. Görüntüleme / kayıt oturumlarımız, farklı embriyoların gelişim aşamalarını gerçek zamanlı olarak tam olarak karşılaştırmamıza olanak tanıyan çok sınırlı bir süre pencereye yayılmış durumda. HerşeyAksine geleneksel elektrofizyolojik kayıtlar genellikle daha büyük ve daha az hassas zaman aralıklarında yürütülür.

Bununla birlikte, görüntüleme teknikleriyle voltaj değişimlerinin ölçülmesi, hızın, frekansta ve membran potansiyelindeki değişikliklerin boyutlarında değişebilen sinyalin kendisinin doğasından ötürü esasen zordur. İdeal bir voltaj sensörü hızlı yanıt verme, yüksek hassasiyet ve yüksek foton emisyonunu bir araya getirmelidir. Çoğu FRET tabanlı GEVI için, oran değişiklikleri membran voltajı değişkenliklerinin bir fonksiyonu olarak değişir, ancak flüoresans oranlarının genliği, depolarizasyon olaylarının süresiyle sıkı bir şekilde ilişkilidir. Son zamanlarda, yeni GEVI'ler geliştirildi ve karakterize edildi, böylece deneysel yayın türü, model ve görüntüleme cihazı türüne göre en iyi prob seçimi mümkün hale geldi.

Voltaj biyosensörleri, integral membran proteinleridir. Kültürlenmiş hücrelere veya eksprese aktarıldığındaD ile canlı organizmalarda plazma zarının lokalize edilmiş sensörünün flüoresansı bir dereceye kadar diğer hücre içi bölmelerdeki sensörün flüoresansıyla ilişkilendirilir - burada protein yanlış toplanır veya bir araya getirilebilir - böylece bir arka plan sinyali üretilir. Canlı organizmalardaki biyosensörleri kullanmadan önce ifade seviyesi ve her yapının doğru membran lokalizasyonu basitleştirilmiş deneysel modellerle ( yani hücre hatlarını veya birincil kültürleri transfekte ederek) izlenmelidir.

Mevcut deney düzeneğinde, protokolün bir başka potansiyel kritik basamağı, transgenez prosedürünün etkinliği ile temsil edilebilir. Gerekirse, plazmit pozitif hücrelerin yüzdesi, Tol2 transpozon sistemi 12 kullanılarak ispatlanabilir. Dikkate alınması gereken ek önemli bir husus, verici fluoroforda floresans emisyonunun kaybedilmesi ve FRET sigYoğun görüntü nedeniyle görüşme sırasında meydana gelen nal. Bu, kullanılan lazer çizgisinin gücünü azaltarak, numunenin aydınlatmasını en aza indirgeyerek önlenmelidir. Benzer şekilde, fotomültektörlerin kazançları ve ofsetleri, elde edilen görüntülerde en iyi sinyal / gürültü oranını elde etmek ve doymuş pikselleri önlemek için her kayıt oturumunun başlangıcında dikkatlice ayarlanmalıdır. Bütün bu parametreler, incelenen hücre türüne, biyosensörün özelliklerine ve görüntü elde etmek için kullanılan aletlere (geniş alanlı floresan mikroskoplar, son zamanlarda açıklandığı gibi kullanılabilir 13 ) bağlı olarak değişebilir. Bununla birlikte, araştırmacı, in vivo görüntüleme sırasında, gürültü seviyesinin sensörün spesifik sinyalini in vitro kayıtlara göre daha fazla etkileyebileceğini her zaman düşünmelidir. Sonunda, mevcutsa, voltaja cevap vermeyen mutant probları kullanarak kontrol ölçümleri, uygun bir yol olurduSisteme özgü ses ve / veya eserler düzeyini değerlendirmek.

Zebra balığı embriyolarının çalışması, genetik manipülasyona ve mikroskobik araştırmalara olan tepkileri sayesinde bu yaklaşımın anahtar bir özelliğini temsil etmektedir. Aslında, bu özellikler geçici transgenezyondur ve nöronal elektriksel özelliklerin FRET temelli analizi mümkün kılmaktadır. Görüşümüze göre, en uygun uyarıcının ve biyolojik sensör kombinasyonlarının, muhtemel herhangi bir hücre türünün elektriksel aktivitesini seçici olarak analiz edebilmesi ve embriyonik fenotip ile bu tür etkinliklerin paralel olması mümkündür.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Low Melting Point Agarose  Sigma-Aldrich A9414
DMSO  Sigma-Aldrich W387520
Riluzole Sigma-Aldrich R116
Pfu Ultra HQ DNA polymerase  Agilent Technologies - Stratagene Products Division 600389
T3 Universal primer  Sigma-Aldrich
Wizard SV Gel and PCR Clean-Up system Promega A9280
Universal SmaI primer  Eurofins
StrataClone Mammalian Expression Vector System / pCMV-SC blunt vector  Agilent Technologies - Stratagene Products Division  240228
SmaI  New England Biolabs R0141S
T4 DNA ligase Promega M1801
SalI New England Biolabs R0138S
EcoRV New England Biolabs R0195S
35 mm, glass-bottomed imaging dish  Ibidi 81151
forceps Sigma-Aldrich F6521
Stereomicroscope Leica Microsystems M10 F
Digital camera Leica Microsystems DFC 310 FX
Leica Application Suite 4.7.1 software  Leica Microsystems
QuickTime Player, v10.4 Apple
Confocal microscope (inverted) Leica Microsystems TCS SP5
Microinjector  Eppendorf  Femtojet
ImageJ macro Biosensor_FRET 
GraphPad Prism 6.0c  GraphPad Software, Inc

DOWNLOAD MATERIALS LIST

References

  1. Knöpfel, T., Gallero-Salas, Y., Song, C. Genetically encoded voltage indicators for large scale cortical imaging come of age. Curr Opin Chem Biol. 27, 75-83 (2015).
  2. Chemla, S., Chavane, F. Voltage-sensitive dye imaging: Technique review and models. J Physiol Paris. 104, (1-2), 40-50 (2010).
  3. Tsutsui, H., Karasawa, S., Okamura, Y., Miyawaki, A. Improving membrane voltage measurements using FRET with new fluorescent proteins. Nat Methods. 5, (8), 683-685 (2008).
  4. Benedetti, L., et al. INaP selective inhibition reverts precocious inter- and motorneurons hyperexcitability in the Sod1-G93R zebrafish ALS model. Sci Rep. 6, 24515 (2016).
  5. Pennati, R., et al. Morphological differences between larvae of the Ciona intestinalis species complex: hints for a valid taxonomic definition of distinct species. PLoS ONE. 10, (5), 0122879 (2015).
  6. Park, H. C., et al. Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic zebrafish with fluorescent neurons. Dev Biol. 227, (2), 279-293 (2000).
  7. Yuan, S., Sun, Z. Microinjection of mRNA and morpholino antisense oligonucleotides in zebrafish embryos. J Vis Exp. (27), (2009).
  8. Rosen, J. N., Sweeney, M. F., Mably, J. D. Microinjection of zebrafish embryos to analyze gene function. J Vis Exp. (25), (2009).
  9. Drapeau, P., et al. Development of the locomotor network in zebrafish. Prog Neurobiol. 68, (2), 85-111 (2002).
  10. Brustein, E., et al. Steps during the development of the zebrafish locomotor network. J Physiol Paris. 97, (1), 77-86 (2003).
  11. Drapeau, P., Ali, D. W., Buss, R. R., Saint-Amant, L. In vivo recording from identifiable neurons of the locomotor network in the developing zebrafish. J Neurosci Methods. 88, 1-13 (1999).
  12. Kawakami, K. Tol2: a versatile gene transfer vector in vertebrates. Genome Biol. 8, Suppl 1S7 (2007).
  13. Sungmoo, L., et al. Imaging Membrane Potential with Two Types of Genetically Encoded Fluorescent Voltage Sensors. J Vis Exp. (108), e53566 (2016).
Canlı Zebra balığı Embriyolarında Biosense Motor Nöron Membranı Potansiyeli
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Benedetti, L., Ghilardi, A., Prosperi, L., Francolini, M., Del Giacco, L. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (124), e55297, doi:10.3791/55297 (2017).More

Benedetti, L., Ghilardi, A., Prosperi, L., Francolini, M., Del Giacco, L. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (124), e55297, doi:10.3791/55297 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter