Method Article

Differentiating Chondrocytes from Peripheral Blood-derived Human Induced Pluripotent Stem Cells

DOI:

10.3791/55722

July 18th, 2017

In This Article

Erratum Notice

Important: There has been an erratum issued for this article. View Erratum Notice

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

We present a protocol to generate a chondrogenic lineage from human peripheral blood (PB) via induced pluripotent stem cells (iPSCs) using an integration-free method, which includes embryoid body (EB) formation, fibroblastic cells expansion, and chondrogenic induction.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

In this study, we used peripheral blood cells (PBCs) as seed cells to produce chondrocytes via induced pluripotent stem cells (iPSCs) in an integration-free method. Following embryoid body (EB) formation and fibroblastic cell expansion, the iPSCs are induced for chondrogenic differentiation for 21 days under serum-free and xeno-free conditions. After chondrocyte induction, the phenotypes of the cells are evaluated by morphological, immunohistochemical, and biochemical analyses, as well as by the quantitative real-time PCR examination of chondrogenic differentiation markers. The chondrogenic pellets show positive alcian blue and toluidine blue staining. The immunohistochemistry of collagen II and X staining is also positive. The sulfated glycosaminoglycan (sGAG) content and the chondrogenic differentiation markers COLLAGEN 2 (COL2), COLLAGEN 10 (COL10), SOX9, and AGGRECAN are significantly upregulated in chondrogenic pellets compared to hiPSCs and fibroblastic cells. These results suggest that PBCs can be used as seed cells to generate iPSCs for cartilage repair, which is patient-specific and cost-effective.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Cartilage tissue has a very poor capacity for self-repair and regeneration. Various surgical interventions and biological treatments are used to restore cartilage and joint function, with unsatisfying results. The recent development of stem cell technology may change the entire cartilage repair field1. Various stem cells have been studied as seed cells, but human induced pluripotent stem cells (hiPSCs) appear to be the most promising choice, as they can provide many types of patient-specific cells without causing rejection reactions2. Furthermore, they can overcome the limited proliferative nature of adult cells and maintain their self-renewal and pluripotent abilities. Moreover, gene targeting can be used to change the genotype to obtain specific types of chondrocytes.

Fibroblasts have been widely used to generate iPSCs because their reprogramming potentials have also been well studied. However, there are still some limitations that must be overcome, such as the painful biopsy from patients and the need for the in vitro expansion of the fibroblasts, which may result in gene mutations3. Recently, PBCs were found to be advantageous for reprogramming4; moreover, they were commonly utilized and abundantly stored. It is possible that they may redirect study focus from the skin. However, to the best of our knowledge, there are few reports on PBC reprogramming followed by differentiation into chondrocytes.

In the current study, we utilize PBCs as an alternative source by reprogramming them into iPSCs and then differentiating the iPSCs into the chondrogenic lineage through a pellet culture system in order to mimic chondrocyte formation.

Access restricted. Please log in or start a trial to view this content.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The protocol for the generation of hiPSCs from PBCs can be found in our previous study5. The study was approved by the Institutional Review Board of our institution.

1. Embryoid Body (EB) Formation

  1. Make 50 mL of hiPSC medium: Knockout Dulbecco's Modified Eagle Medium (DMEM) supplemented with 15% knockout serum replacement (KSR), 5% fetal bovine serum (FBS), 1× nonessential amino acids, 55 μM 2-mercaptoethanol, 2 mM L-glutamine, and 8 ng/mL basic fibroblast growth factor (bFGF).
  2. Make 50 mLof EB formation medium: DMEM supplemented with 15% KSR, 5% FBS, 1x nonessential amino acids, 55 μM 2-mercaptoethanol, and 2 mM L-glutamine.
  3. Make 50 mL of basal culture medium: DMEM supplemented with 20% FBS, 1× nonessential amino acids, 55 μM 2-mercaptoethanol, and 2 mM L-glutamine.
  4. Prepare 10 mL of dispase solution, 1 mg/mL in knockout DMEM.
  5. Culture hiPSCs onto 60-mm tissue culture dishes with feeder cells (i.e., a monolayer of irradiated mouse embryonic fibroblast cells). When the cells are 80-90% confluent, disassociate the cells with dispase and passage the hiPSCs 1:3 every 4-5 days. Place the cells into a 37 °C and 5% CO2 incubator.
  6. Dissect the undifferentiated hiPSC colonies into smaller pieces (about 50-100 µm in diameter) using a fire-drawn glass needle when the iPSCs are 80-90% confluent. Generally, use hiPSC colonies in a 60-mm dish to generate EBs in a 100 mm Petri dish.
    1. Culture less than 100 small pieces of colonies in a 100 mm, non-adherent Petri dish containing 10 mL of EB formation medium. Place the dishes into a 37 °C and 5% CO2 incubator.
  7. Replace approximately 25% of the initial medium with an equal amount of the basal culture medium every 2 days. Tilt the dish to let the EBs settle. Carefully remove 3 mL of upper medium and add 4 mL of fresh basal culture medium. Do not disturb the EBs.
    NOTE: The EBs are morphologically characterized by the pieces of colonies, taking on a round appearance with smooth borders under the microscope.
  8. After 10 days of culture in the non-adherent Petri dish, coat a new 100-mm tissue culture dish with 4 mL of 0.1% gelatin for 30 min at 37 °C before use.
  9. Transfer the medium plus EBs from a 100 mm, non-adherent Petri dish to a 15-mL conical tube. Let the EBs sediment for 4-5 min. Aspirate the supernatant carefully and leave less than 0.5 mL of medium plus EBs
  10. Seed less than 100 EBs onto a 100 mm, gelatin-coated tissue culture dish with 10 mL of basal culture medium. Place the dishes into a 37 °C and 5% CO2 incubator.

2. Cell Pellet Formation and Chondrocyte Differentiation

  1. Make 10 mL of 0.25% trypsin/ethylenediaminetetraacetic acid (EDTA). Make 80 mL of basal culture medium: DMEM supplemented with 20% FBS, 1x nonessential amino acids, 55 μM 2-mercaptoethanol, and 2 mM L-glutamine.
  2. Make 10 mL of chondrogenic differentiation medium: DMEM (high glucose) supplemented with 10% insulin-transferrin-selenium solution (ITS), 0.1 µM dexamethasone, 1 mM ascorbic acid, 1% sodium pyruvate, and 10 ng/mL transforming growth factor-beta 1(TGF-β1).
  3. Refresh the medium with 10 mL of basal culture medium after 48 h. Thereafter, refresh the medium every three days with 10 mL of basal culture medium.
    NOTE: After 10 days in culture, fibroblastic cell outgrowths should have expanded from the EBs.
    1. Coat the 100 mm dishes with 4 mL of 0.1% gelatin for 30 min at 37 °C before use. Discard the cell supernatant and wash the cells with Dulbecco's Phosphate-Buffered Saline (DPBS) once.
    2. Digest the cells with 3 mL of 0.25% trypsin/EDTA at 37 °C for 5 min and neutralize with 4 mL of basal culture medium.
  4. Dissociate the cells into single cells by pipetting up and down 5-10 times and passing them through a 70 µm nylon mesh. Centrifuge the cell suspension at 200 x g for 5 min. Re-seed the cells on a new 100 mm, gelatin-coated tissue culture dish with 10 mL of basal culture medium.
  5. Refresh the medium with 10 mL of basal culture medium after 48 h. Thereafter, refresh the medium every three days with 10 mL of basal culture medium.
    NOTE: The cells acquire a homogenous, fibroblast-like morphology.
  6. When ~90-100% confluence is reached (i.e., about 5-7 days), harvest the cells with 3 mL of 0.25% trypsin/EDTA at 37 °C for 5 min. Neutralize with 4 mL of basal culture medium. Dissociate the cells into single cells by pipetting up and down 5 times. Use a hemocytometer to count the cell number.
    1. Place 3 x 105 cells in a 15 mL polypropylene tube. Centrifuge at 200 x g for 5 min at room temperature (RT). Re-suspend the cells in 1 mL of chondrogenic differentiation medium.
  7. Re-centrifuge the cells at 300 x g for 3 min and maintain the cells in small pellet form. Put the tube into the 37 °C and 5% CO2 incubator for 21 days. Do not screw the lid on tightly and let the gas exchange.
  8. Replace 3/4 of the culture medium every three days with fresh chondrogenic differentiation medium.
    NOTE: After 21 days in culture, hiPSC-chondrogenic pellets (hiPSC-Chon) should have formed. Human mesenchymal stem cells (MSCs), as a positive control, are also collected and cultured in the chondrogenic differentiation medium for 21 days to form chondrogenic pellets (hMSC-Chon).

3. Analysis of Chondrogenic Differentiation

  1. Prepare 10 mL of 10% neutral-buffered formalin.
  2. Prepare 50 mL of 0.1% alcian blue reagent and 50 mL of 1% toluidine blue reagent.
  3. Prepare 1 mL of the primary antibodies: rabbit polyclonal antibodies against collagen II (1:50) or mouse monoclonal antibodies against collagen X (1:50). Also, prepare anti-rabbit or mouse secondary antibodies.
  4. Make 1 mL of papain solution: 10 U/mL in PBS with 0.1 M sodium acetate, 2.4 mM EDTA, and 5 mM L-cysteine.
  5. Make 100 mL dimethylmethylene blue (DMMB) dye solution: 100 µL of 16 mg/L 1,9-dimethylmethylene blue, 40 mM glycine, 40 mM NaCl, and 9.5 mM HCl; pH 3.0.
  6. Assess chondrogenic differentiation by alcian blue and toluidine blue stains of the pellet sections.
    1. Fix one hiPSC-Chon pellet or hMSC-Chon pellet in 1 mL of 10% neutral-buffered formalin for 24 h.
    2. Transfer the pellet to 1 mL of 70% ethanol in H2O. Dehydrate the pellet with 1 mL of a graded ethanol series (i.e., 25, 50, 75, 90, 95, 100, and 100%, 3 min each).
    3. Clarify the pellet in 1 mL of 100% xylene three times. Infiltrate the pellet with paraffin for 1 h in a 65 °C oven. Embed the pellet into paraffin blocks with a 7 x 7 x 5 mm3 base mold, following routine histological procedures6.
    4. Make adjacent sections by microtome with a thickness of approximately 4 µm7. Adhere the sections onto glass slides.
    5. Dry the slides for 2 h at 60 °C in an oven. Deparaffinize the sections in three cycles (3 min each) using 100% xylene.
    6. Use a decreasing alcohol series for rehydration (i.e., 100, 100, 95, 95, 70, 50, and 25% in H2O, 3 min each) and then perform a final rinse with deionized water for 5 min.
    7. Stain the sections with 0.1% alcian blue reagent or 1% toluidine blue staining for 4-5 h and then rinse them with distilled water.
    8. Dehydrate with a graded ethanol series (i.e., 25, 50, 75, 90, 95, 100, and 100%, 3 min each) followed by three consecutive steps of clarification in 100% xylene. Mount the slides and visualize them under a microscope.
  7. Perform immunohistochemistry.
    NOTE: Additional pellet sections are further assessed by immunohistochemistry.
    1. After deparaffinization and rehydration, bring the slides to a boil in 1 mM EDTA, pH 8.0 (waterproof in water boiled by autoclave). Let them sit for 8 min at a sub-boiling temperature and then allow the slides to cool at RT.
    2. Rinse the slides with deionized water 3 times. Incubate the sections in 3% H2O2 solution in methanol at RT for 15 min to block endogenous peroxidase activity.
    3. Rinse the slides with deionized water and immerse them in DPBS for 5 min. Apply 50-100 µL of appropriately diluted (1:50) primary antibody to the sections on the slides and then incubate them in a humidified chamber at RT for 1 h.
    4. Wash the slides 3 times (5 min each) with DPBS. Incubate the samples with the corresponding secondary antibodies (i.e., anti-rabbit or mouse) for 15 min at RT.
    5. Wash the slides 3 times (for 5 min each) with DPBS. Perform DAB detection under a microscope.
    6. Wash the slides with DPBS 3 times (2 min each). Counterstain the cell nuclei by immersing the slides in hematoxylin for 1-2 min. Dehydrate with a graded ethanol series (25, 50, 75, 90, 95, 100, and 100%; 3 min each) followed by three consecutive steps of clarification with xylene. Finally, mount the slides and visualize them under the microscope.
  8. Detect sGAG content.
    1. Digest chondrogenic pellets in papain solution at 60 °C for 2 h.
    2. Determine the DNA content using the dsDNA assay kit and fluorometer system. Measure the sGAG content by mixing it with DMMB dye solution under measuring absorbance at 525 nm8.
    3. Calculate the concentration of sGAG against a standard curve of shark chondroitin sulfate.
  9. Perform the real-time PCR analysis of the chondrogenic differentiation markers in hiPSC-Chon pellets.
    1. Harvest 3-4 of the same chondrogenic pellets by adding 500 µL of ice-cold extraction reagent to one tube. Vortex thoroughly. Incubate the sample for 5 min at RT.
    2. Add 0.1 mL of chloroform. Vortex the sample for 15 s and incubate it at RT for 3 min. Centrifuge the sample for 15 min at 12,000 x g and 4 °C. Transfer the upper aqueous phase (about 250 µL) into a new 1.5 mL microcentrifuge tube.
    3. Add 25 µL of sodium acetate and 1 µL of glycogen to the sample. Precipitate the RNA by mixing it with 250 µL of isopropyl alcohol. Mix thoroughly. Incubate the sample at RT for 10 min.
    4. Centrifuge for 10 min at 12,000 x g and 4 °C. Remove the supernatant completely. Wash the RNA pellet twice with 500 µL of 75% ethanol.
    5. Centrifuge for 5 min at 7,500 x g and 4 °C. Remove all leftover ethanol and air-dry the RNA pellet for 5-10 min. Dissolve the RNA in 10 µL of nuclease-free water.
    6. Convert the RNA into cDNA using a reverse transcriptase system. Subject the cDNA samples to real-time PCR using qPCR kit master mix (2x) and a real-time PCR system9.
      NOTE: The primer sequences are:
      hAGGRECAN-F:TCGAGGACAGCGAGGCC;
      hAGGRECAN-R: TCGAGGGTGTAGCGTGTAGAGA;
      hβ-ACTIN-F: TTTGAATGATGAGCCTTCGTCCCC;
      hβ-ACTIN-R: GGTCTCAAGTCAGTGTACAGGTAAGC;
      hCOL2-F:TGGACGATCAGGCGAAACC;
      hCOL2-R:GCTGCGGATGCTCTCAATCT;
      hSOX9-F:AGCGAACGCACATCAAGAC;
      hSOX9-R:CTGTAGGCGATCTGTTGGGG;
      hCOL10-F: ATGCTGCCACAAATACCCTTT;
      hCOL10-R: GGTAGTGGGCCTTTTATGCCT.

Access restricted. Please log in or start a trial to view this content.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Chondrogenic Differentiation of hiPSCs:

EB formation medium and basal culture medium were used to differentiate the hiPSCs into the mesenchymal lineage. A multi-step culture method was used (Figure 1). First, the hiPSCs were spontaneously differentiated via EB formation for 10 days (D10; Figure 2A). Second, cells outgrew from the EBs for another 10 days (D10+10). During th...

Access restricted. Please log in or start a trial to view this content.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Here, we provide a protocol to generate chondrocytes from PBCs via iPSCs. Because PBCs are more common and widely used in the clinical field, they are presented as a potential alternative for reprogramming. In this study, episomal vectors (EV) were utilized to reprogram PBCs into iPSCs, following the method established by Zhang et al.11. This integration-free approach does not involve integrating virus-associated genotoxicity, which is believed to have a broad effect in the clinical field...

Access restricted. Please log in or start a trial to view this content.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors have nothing to disclose.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors wish to thank Xiaobin Zhang for his plasmid. We also thank Shaorong Gao and Qianfei Wang for their kind help during the experiment. This study is supported by the National Natural Science Foundation of China (No.81101346, 81271963, 81100331), the Beijing 215 high-level talent project (No.2014-3-025), and the Beijing Chao-Yang Hospital Fund (No. CYXX-2017-01), and the Youth Innovation Promotion Association of Chinese Academy of Sciences (Y.L.).

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Knockout DMEMInvitrogen10829018Basal medium used for hiPSC culture and EB formation medium
Knockout Serum Replacement (KSR)Invitrogen10828028A more defined, FBS-free medium supplement used for hiPSC culture and EB formation medium
Fetal bovine serum (FBS)Hyclonesh30070.03Used for hiPSC culture and EB formation medium,offers excellent value for cell culture
Nonessential amino acidsChemiconTMS-001-CUsed as a growth supplement in all the cell culture medium, to increase cell growth and viability
L-glutamineInvitrogenTMS-002-CAn amino acid required for cell culture
Basic fibroblast growth factor (bFGF)Peprotech100-18BA cytokine used for sustaining the pluripotency and self-renewal of hiPSCs
DispaseInvitrogen17105041Used for hiPSC dissociation for subculture
DMEMGibcoC11960Basal medium used for MSC culture medium
0.1% gelatinMilliporeES-006-BUsed for cell attachment onto the dishes
0.25% trypsin/EDTAGibco25200072Used for cell dissociation
DPBSGibco14190250A balanced salt solution used for cell wash or reagent preparing
2-mercaptoethanolinvitrogen21985023Used as a growth supplement in all the cell culture medium.
ITSinvitrogen41400045Insulin, Transferrin, Selenium Solution.Used for chondrogenic differentiation.
Ascorbic acidSigma4403Known as vitamin C. It helps in active growth and has antioxidant property.
Sodium pyruvateGibco11360070Added to cell culture medium as an energy source in addition to glucose.
Transforming growth factor-beta 1PeprotechAF-100-21CA cytokine that regulate cell proliferation, growth and chondrogenic differentiation.
Rabbit polyclonal antibodies against Collagen IIAbcamab34712This antibody reacts with Type II collagens,which is specific for cartilaginous tissues.
Mouse monoclonal antibodies to Collagen XAbcamab49945This antibody reacts with Type X collagen,which is a product of hyperthrophic chondrotocytes.
PermountFisher ScientificSP15-100For mounting and long-term storage of slides
Toluidine blueSigma89640Used for proteoglycans detection.
Alcian blueAmresco#0298Used for glucosaminoglycans detection.
PapainSigmaP4762-25MGUsed to digest chondrogenic pellets.
Dimethylmethylene blueSigma341088-1GUsed to quantitate glycosaminoglyans
Chondroitin sulfate sodium salt from shark cartilageSigmaC4384-250MGUsed to draw the standard curve for sGAG content measurement.
Qubit dsDNA HS assay kitInvitrogenQ32851 (100)Used to determine DNA content
TRIzolInvitrogen15596018Used for RNA isolation from cells
Reverse Transcriptase SystemPromegaA3500Used to convert RNA into cDNA
SYBR FAST qPCR kit Master MixKapaKK4601Used for Real-time PCR

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Diekman, B. O., et al. Cartilage tissue engineering using differentiated and purified induced pluripotent stem cells. Proc Natl Acad Sci USA. 109 (47), 19172-19177 (2012).
  2. Park, I. H., et al. Disease-specific induced pluripotent stem cells. Cell. 134 (5), 877-886 (2008).
  3. Loh, Y. H., et al. Generation of induced pluripotent stem cells from human blood. Blood. 113 (22), 5476-5479 (2009).
  4. Zhang, X. B. Cellular reprogramming of human peripheral blood cells. Genomics Proteomics Bioinformatics. 11 (5), 264-274 (2013).
  5. Li, Y., et al. Reprogramming of blood cells into induced pluripotent stem cells as a new cell source for cartilage repair. Stem Cell Res Ther. 7 (31), (2016).
  6. Canene-Adams, K. Preparation of formalin-fixed paraffin-embedded tissue for immunohistochemistry. Methods Enzymol. 533, 225-233 (2013).
  7. Solchaga, L. A., Penick, K. J., Welter, J. F. Chondrogenic differentiation of bone marrow-derived mesenchymal stem cells: tips and tricks. Methods Mol Biol. 698, 253-278 (2011).
  8. Oldershaw, R. A., et al. Directed differentiation of human embryonic stem cells toward chondrocytes. Nat Biotechnol. 28 (11), 1187-1194 (2010).
  9. Monje, L., Varayoud, J., Luque, E. H., Ramos, J. G. Neonatal exposure to bisphenol A modifies the abundance of estrogen receptor alpha transcripts with alternative 5'-untranslated regions in the female rat preoptic area. J Endocrinol. 194 (1), 201-212 (2007).
  10. Teramura, T., et al. Induction of mesenchymal progenitor cells with chondrogenic property from mouse-induced pluripotent stem cells. Cell Reprogram. 12 (3), 249-261 (2010).
  11. Su, R. J., et al. Efficient generation of integration-free ips cells from human adult peripheral blood using BCL-XL together with Yamanaka factors. PLoS One. 8 (5), e64496(2013).
  12. Carey, B. W., et al. Reprogramming factor stoichiometry influences the epigenetic state and biological properties of induced pluripotent stem cells. Cell Stem Cell. 9 (6), 588-598 (2011).
  13. Okita, K., et al. An efficient nonviral method to generate integration-free human-induced pluripotent stem cells from cord blood and peripheral blood cells. Stem Cells. 31 (3), 458-466 (2013).
  14. Staerk, J., et al. Reprogramming of human peripheral blood cells to induced pluripotent stem cells. Cell Stem Cell. 7 (1), 20-24 (2010).
  15. Qu, C., et al. Chondrogenic differentiation of human pluripotent stem cells in chondrocyte co-culture. Int J Biochem Cell Biol. 45 (8), 1802-1812 (2013).
  16. Guzzo, R. M., Gibson, J., Xu, R. H., Lee, F. Y., Drissi, H. Efficient differentiation of human iPSC-derived mesenchymal stem cells to chondroprogenitor cells. J Cell Biochem. 114 (2), 480-490 (2013).
  17. Koyama, N., et al. Human induced pluripotent stem cells differentiated into chondrogenic lineage via generation of mesenchymal progenitor cells. Stem Cells Dev. 22 (1), 102-113 (2013).
  18. Liu, X., et al. Role of insulin-transferrin-selenium in auricular chondrocyte proliferation and engineered cartilage formation in vitro. Int J Mol Sci. 15 (1), 1525-1537 (2014).
  19. Guzzo, R. M., Scanlon, V., Sanjay, A., Xu, R. H., Drissi, H. Establishment of human cell type-specific iPS cells with enhanced chondrogenic potential. Stem Cell Rev. 10 (6), 820-829 (2014).
  20. Goepfert, C., Slobodianski, A., Schilling, A. F., Adamietz, P., Portner, R. Cartilage engineering from mesenchymal stem cells. Adv Biochem Eng Biotechnol. 123, 163-200 (2010).
  21. Ingber, D. E., et al. Tissue engineering and developmental biology: going biomimetic. Tissue Eng. 12 (12), 3265-3283 (2006).
  22. Yoshida, Y., Yamanaka, S. Recent stem cell advances: induced pluripotent stem cells for disease modeling and stem cell-based regeneration. Circulation. 122 (1), 80-87 (2010).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Erratum

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Formal Correction: Erratum: Differentiating Chondrocytes from Peripheral Blood-derived Human Induced Pluripotent Stem Cells
Posted by JoVE Editors on 1/01/1970. Citeable Link.

An erratum was issued for: Differentiating Chondrocytes from Peripheral Blood-derived Human Induced Pluripotent Stem Cells.

The corresponding author was updated from:

Yueying Li
yueyinglee2010@hotmail.com
Key Laboratory of Genomic and Precision Medicine, Beijing Institute of Genomics, Chinese Academy of Sciences

The corresponding author is now listed as:

Tie Liu
waterkins@163.com
Department of Orthopedics, Beijing Chao-Yang Hospital, Capital Medical University

Tags

Chondrocyte DifferentiationPeripheral Blood CellsEmbryoid Body FormationChondrogenic DifferentiationSerum Free CultureXeno Free CultureCollagen II StainingGlycosaminoglycan AnalysisChondrogenic Markers

Related Articles