Assembly and Purification of Prototype Foamy Virus Intasomes

Summary

Recombinant retroviral integrase and DNA oligomers mimicking viral DNA ends can form an enzymatically active complex known as an intasome. Intasomes may be used for biochemical, structural, and kinetic studies. This protocol details how to assemble and purify prototype foamy virus intasomes.

Abstract

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an integrase (IN) enzyme that catalyzes the covalent joining of viral to host DNA, which is known as strand transfer. Integration may be modeled in vitro with recombinant retroviral IN and DNA oligomers mimicking the ends of the viral genome. In order to more closely recapitulate the integration reaction that occurs in vivo, integration complexes are assembled from recombinant IN and synthetic oligomers by dialysis in a reduced salt concentration buffer. The integration complex, called an intasome, may be purified by size exclusion chromatography. In the case of prototype foamy virus (PFV), the intasome is a tetramer of IN and two DNA oligomers and is readily separated from monomeric IN and free oligomer DNA. The integration efficiency of PFV intasomes may be assayed under a variety of experimental conditions to better understand the dynamics and mechanics of retroviral integration.

Introduction

Integration of the viral genome into the host genome is a mandatory step in the life cycle of all retroviruses¹. The viral enzyme integrase (IN) catalyzes the covalent joining of each end of the viral DNA genome to the host DNA. During a cellular infection, IN is part of a pre-integration complex that mediates integration. Recombinant IN complexed with double stranded DNA oligomers mimicking the viral DNA ends can also perform integration into a target DNA in vitro². A common integration assay in vitro utilizes a supercoiled plasmid as the target DNA. Integration of both viral DNA oligomers (vDNA) to the plasmid results in a linear product and is termed concerted integration (Figure 2A). The integration assay in vitro may also yield products with only one vDNA covalently joined to the target plasmid resulting in a relaxed circle. This half-site integration product appears to be an artefact of the assay in vitro.

Recombinant IN and vDNA may perform integration in vitro, but they are not ideal reagents for the study of the dynamics or structure of integration complexes when monomeric IN would obscure relevant visualization. Purified integration complexes, or "intasomes," are required for dynamic single molecule analysis or structural studies. PFV IN and vDNAs may be assembled by dialysis from a relatively high salt concentration buffer to a lower salt concentration^3,4. During dialysis, a precipitate forms. This precipitate is removed from dialysis and the salt concentration is increased. The higher salt concentration solubilizes the precipitate containing PFV intasomes. The intasomes are then purified by size exclusion chromatography (SEC). Recombinant prototype foamy virus (PFV) IN has been shown to exist as a monomer in solution at concentrations up to 225 µM⁵. SEC fractionation effectively separates the PFV intasomes (225.5 kDa), which includes a tetramer of PFV IN and two vDNAs, from monomeric PFV IN (44.4 kDa) and free vDNA (24.0 kDa). The PFV intasomes may be frozen and retain integration activity for at least six months of storage at -80 ˚C.

Recombinant PFV intasomes may also be modified to include IN amino acid substitutions or truncation mutations or vDNAs labeled with fluorophores or biotin^4,6. The purified PFV intasomes readily perform integration into a supercoiled plasmid target DNA in vitro. Bulk biochemical integration assays with intasomes may test the effects of IN mutations, IN inhibitors, or other chemical additives. Biotinylated intasomes can be used to probe affinity with nucleic acids or proteins. PFV intasomes are functional at ambient temperature allowing for single molecule microscopy analysis by magnetic tweezers to measure the time between joining of the two vDNA ends or total internal reflection fluorescence to visualize the intasome search on target DNA⁶. In addition, PFV intasomes were the first to be structurally characterized significantly impacting the field of retroviral integration³.

Protocol

1. Annealing of vDNA

1. Combine 1X TEN Buffer (10X TEN stock: 100 mM Tris-HCl, pH 8.0, 1 M NaCl, 10 mM EDTA), 10 µM Oligo 1 (5' ATTGTCATGGAATTTTGTATATTGAGTGGCGCCCGAACAG 3', 100 µM stock), and 10 µM Oligo 2 (5' CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA 3', 100 µM stock) in a final volume of 1.5 mL. Aliquot 25 µL into sixty 0.2-mL polymerase chain reaction (PCR) tubes.
   NOTE: Depending on the application, oligomers may be modified with fluorophores or tags at the 5'-end of Oligo 2 or as an internal amino-T at base 13 from the 5'-end of Oligo 1. Modified oligomers should be purified by high-performance liquid chromatography (HPLC) before annealing. We have found that 5'-end Cy3 or Cy5 fluorophore labeling of Oligo 2 reduces the intasome assembly efficiency 10-fold. Internal fluorophore labeling does not reduce assembly efficiency.
2. Anneal using a thermocycler with the following times and temperatures: 1 cycle at 94.0 ˚C 3 min, 99 cycles at (94.0 ˚C 1 min, 93.6 ˚C 1 min) decreasing both temperatures by 0.8 ˚C per cycle (the last cycle is 14.8 ˚C 1 min, 14.4 ˚C 1 min), and store at 4.0 ˚C.
3. Combine the annealing reactions from all sixty tubes. Load 500 µL to two 0.5-mL 3 kDa molecular weight cutoff (MWCO) ultracentrifugal filter concentration units. Concentrate the annealed vDNA by centrifugation in a microcentrifuge at 14,000 x g for 10 min at room temperature (RT).
   NOTE: The retentate volume should be ~50 µL in each concentration unit.
4. Discard the flow through. Add 250 µL of the remaining annealed vDNA to each filter unit. Repeat the spin and discard the flow through. Buffer exchange into TE buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA) by washing three times with 450 µL TE.
5. Invert the filter unit and spin at 1,000 x g for 2 min at RT. The final retentate volume for each filter unit should be ~50 µL. Combine the retentates and transfer to a 1.5 mL screw cap tube.
6. Measure the 260-nm ultraviolet (UV) absorbance of the vDNA. Use this value to calculate the final molar DNA concentration. The extinction coefficient (ε₂₆₀) of this vDNA is 622,803 cm^-1 M^-1 and its molecular weight is 23,972 Da. Store at -20 ˚C.

2. Intasome Assembly

1. If possible, perform the intasome assembly in a small room with a variable thermostat. Adjust the thermostat to approximately 18-22 ˚C.
   NOTE: In our experience, intasome assembly at 4 ˚C is inefficient.
2. Prepare 1 L of dialysis buffer (20 mM Bis-tris propane, pH 7.5, 200 mM NaCl, 2 mM dithiothreitol (DTT), 25 µM ZnCl₂) in a 2 L beaker with a stir bar on a stir plate. Equilibrate the buffer in the 18-22 ˚C room for at least 6 h.
3. To assemble the intasomes, combine 50 mM Bis-tris propane, pH 7.5, 500 mM NaCl, 120 µM PFV IN, and 50 µM vDNA in a total volume of 150 µL.
   NOTE: The PFV IN should be free of contaminating nuclease activity^7,8. If the concentration of PFV IN is too dilute to accommodate 120 µM IN in 150 µL volume, then it is possible to increase the final volume to 200 µL. The critical factors of this step are to maintain the molar ratio of IN to vDNA (2.4:1) and to have enough complex to visualize during chromatography.
4. Clean a ~10-cm long piece of 10-mm 6-8 kDa MWCO dialysis tubing and clips with double distilled water (ddH₂O), or the highest purity water available. Clip one end of the tubing.
   NOTE: Dialysis tubing should be handled with care to prevent any possible contamination from the lab space.
5. Make 15 mL of dialysis tubing rinse buffer (50 mM Bis-tris propane, pH 7.5, 500 mM NaCl). Rinse the inside of the dialysis tubing three times with 1-2 mL rinse buffer. Remove as much of the rinse buffer as possible with a pipette and thin gel loading tip.
6. If necessary, use a clean razor blade or scalpel to cut the dialysis tubing so that a thin gel loading tip may reach the end of the tubing.
7. Transfer the intasome assembly from step 2.3 to the dialysis tubing with a pipette and a thin gel loading tip. Clip the open end of the dialysis tubing, minimizing the amount of air introduced within the tubing. Place the tubing into the dialysis buffer.
8. Dialyze overnight (16-20 h) with gentle stirring so that the tubing rotates but is not in a vortex. Ensure that the dialysis tubing is submerged and mobile. After approximately one hour, observe a visible precipitate inside the tubing.
   NOTE: With Cy3 or Cy5 fluorescently labeled vDNA, the precipitate is more obvious. This is true for both end labeled and internally labeled fluorescent vDNA.

3. Intasome Solubilization

1. Prepare two wide bore pipette tips by removing 2-4 mm from the end of a 200 µL tip with a new razor or scalpel blade on a clean surface.
   NOTE: The tips will be used in step 3.3 and 3.5.
2. Remove the dialysis tubing from the dialysis buffer. In order to prevent dilution of the intasome sample with dialysis buffer that may remain at the end of the tubing near the clip, use a micropipette with a small pipette tip to remove any excess dialysis buffer. Remove the clip from one end of the dialysis tubing.
3. Use a wide bore pipette tip from step 3.1 to transfer the sample including the precipitate inside the dialysis tubing to a 1.5-mL tube on ice. Note the total volume of the recovered material; the total volume is typically ~140 µL.
4. The sample with precipitate is at 200 mM NaCl; increase the salt to a final concentration of 320 mM NaCl by adding the appropriate volume of a stock 5 M NaCl solution. For example, for a sample of 150 µL, add 3.9 µL 5 M NaCl and 1.1 µL ddH₂O for a final volume of 155 µL. Transfer ice bucket with sample into a 4 ˚C cold room.
5. Use a wide bore pipette tip from step 3.1 to resuspend and solubilize the precipitate by pipetting. Repeat every 20 min for at least 1 h. Observe that most of the precipitate should go into solution.
   NOTE: Pipetting to resuspend the precipitate can be stopped when it is apparent that the precipitate is no longer noticeably reduced between time points. When vDNA is not labeled or is internally labeled, the precipitate is reduced by ~90% based on visual inspection. In the case of Cy5 end labeled vDNA, the precipitate is reduced by only ~20%; most of the precipitate with fluorophore end labeled vDNA will not solubilize. The amount of precipitate that is effectively solubilized is variable and should be empirically determined.

4. Intasome Purification

1. Prepare 250 mL of size exclusion chromatography (SEC) running buffer (20 mM Bis-tris propane, pH 7.5, 320 mM NaCl, 10% glycerol). Sterile filter the buffer with a 0.2-µm filter unit and store at 4 ˚C.
   NOTE: All purification steps are performed in a 4 ˚C cold room.
2. Equilibrate a cross-linked agarose SEC column (diameter = 10 mm; length = 300 mm; bed volume = 24 mL; sample volume = 25 - 500 µL; maximum pressure = 1.5 MPa; exclusion limit = 4 x 10⁷ Da; separates molecular weights between 5 and 5,000 kDa, see the Table of Materials) with SEC running buffer at a flow rate of 0.4 mL/min.
   NOTE: This purification may be adapted to different size exclusion columns if they are able to effectively separate 300 kDa from 44 kDa, such as Superose 12 10/300 GL or Superose 6 Increase. Superose 12 10/300 GL has lower resolution, leading to more overlap of peaks. Conversely, Superose 6 Increase has higher resolution and offers better separation.
3. Centrifuge the intasome sample in a microfuge at 14,000 x g for 10 min at 4 ˚C to pellet any remaining precipitate. Carefully remove the supernatant. Load the supernatant to a 200 µL injection loop (tubing that can hold ~200 μL). Apply the sample to the SEC column.
   NOTE: Smaller load volumes allow greater resolution by SEC.
4. Elute with 25 mL SEC running buffer and collect 95 fractions of 270 µL. Observe that the SEC chromatogram displays three A₂₈₀/A₂₆₀ peaks (Figure 1).
   NOTE: The first should be an aggregate (~9.0 - 11.5 mL elution), followed by the PFV tetramer intasome peak (~12.0 - 14.75 mL elution) and PFV IN monomer with free vDNA peak (~15.0 - 18.0 mL).

5. Integration Strand Transfer Assay, Fraction Selection, and Storage

1. Combine 2 µL of each intasome peak fraction and 50 ng 3 kb supercoiled plasmid DNA (stock concentration is 50 ng/µL) in reaction buffer (10 mM Bis-tris propane, pH 7.5, 110 mM NaCl, 5 mM MgSO₄, 4 µM ZnCl₂, 10 mM DTT) in a final reaction volume of 15 µL. Incubate at 37 ˚C for 5 min.
2. Include a negative control with no added PFV intasome. Stop the reaction with 0.75 µL proteinase K (20 mg/mL stock solution) and 0.75 µL SDS (10% stock solution). Incubate at 55 ˚C for 1 h. Store samples as needed at -20 ˚C for later analyses.
   NOTE: This assay is a qualitative assessment of integration activity. The intasome molar concentration of each fraction is not determined prior to this assay. Fractions included in the integration strand transfer assay can be stored on ice (including overnight storage) until integration activity is confirmed and selected fractions are aliquoted. Here we use pMP2, a pUC19 derivative⁹. We have also successfully used the 5.4 kb plasmid pcDNA 3.1. Any plasmid that may be resolved to relaxed circle, linear, and supercoiled forms may be used as a target for integration.
3. Prepare a 120 mL 1% weight per volume (w/v) agarose gel in 1X TAE buffer (40 mM Tris-acetate, 1 mM EDTA) with 0.1 μg/mL ethidium bromide (EtBr, 10 mg/mL stock solution)¹⁰. Melt the agarose solution and pour it into a 15 cm x 10 cm gel casting tray. Insert a 15-well comb with 5-mm wide, 0.75-mm thick wells.
   NOTE: Narrower wells yield better band resolution compared to 1.5-mm thick wells.
4. Allow the gel to solidify at ambient temperature. Immerse the gel in 1X TAE with 0.1 μg/mL EtBr.
5. Add 3 µL 50% glycerol to each integration reaction from step 5.2. Load the entire reaction volume to the gel. Load 1 µL of 10 kb DNA size marker (150 ng/µL stock concentration) to lanes on either side of the samples; in other words, the DNA size marker should flank the sample lanes.
6. In an outer lane, load 6 µL Orange G dye (0.25% Orange G, 30% glycerol). Run the gel at constant voltage, 10 V/cm (100 V) at ambient temperature for 1 h, or until the Orange G dye front reaches the end of the gel.
7. Immediately image the agarose gel with a fluorescent scanner set to detect EtBr (532 nm excitation, 610 nm emission filter). If fluorophore labeled vDNAs were used, also image with appropriate fluorophore settings.
   NOTE: For example, to detect Cy5 labeled DNA, image using 633 nm excitation and 670 nm emission filters. Concerted integration products (CI, linear DNA) should run true to size at ~3 kb, unreacted supercoiled plasmid (SC) should run faster (~2 kb), and half-site integration products (HSI, relaxed circle DNA) should run slower (~3.5 kb). Unreacted vDNA should run true to size at ~40 bp.
8. Quantify the bands in each lane with imaging software⁷. Calculate the fraction of DNA in each lane that is CI, HSI, or SC; vDNA is not included in this calculation.
   NOTE: Integration efficiency, or the fraction of SC converted to a linear product, was calculated by dividing the pixel volume of concerted integration products (CI) by the total pixel volume of three bands (HSI+CI+SC). If intasomes are fluorophore labeled, the HSI and CI products may also be quantitated by fluorescence.
9. Select fractions that have the most concerted integration activity.
   NOTE: In our experience, the peak concerted integration activity coincides with the protein peak identified as tetrameric PFV intasomes. Measure the A₂₈₀ of each of these fractions and calculate the final intasome concentration. The ε₂₈₀ for a tetramer of wild type PFV IN with two vDNAs described here is 908,339 cm^-1M^-1 and the molecular weight is 225.5 kDa. The concentrations should follow the same pattern as the SEC chromatogram peak and in the strand transfer assay.
10. Distribute each fraction in 5 µL aliquots and snap freeze in liquid nitrogen. Store aliquots at -80 ˚C. Fractions selected for storage are typically between 200 - 600 nM.

Results

PFV intasomes are assembled from recombinant IN and vDNA. After assembly, intasomes are purified by SEC (Figure 1). Integration activity of each fraction is assayed with a supercoiled DNA target and agarose gel electrophoresis (Figure 2). This gel is imaged with a fluorescent scanner set to detect EtBr (and fluorophore, if fluorophore-labeled vDNA is used). Using image analysis software, band pixel volumes can be used to calculat...

Discussion

Retroviral INs form a multimeric complex with viral genomic DNA to perform integration and continue the viral life cycle. The number of IN monomers per intasome may be tetramers, octamers, or possibly higher order multimers^11,12,13,14. PFV intasomes are a tetramer of recombinant IN with double-stranded DNA oligomers that mimic viral genomic DNA ends³. These inta...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
DNA Oligomers	IDT	N/A	Custom DNA Oligos
Tris Ultra Pure	Gojira Fine Chemicals	UTS1003
NaCl	P212121	RP-S23020
UltraPure EDTA	Invitrogen/Gibco	15575
Amicon Ultra 0.5 mL centrifugal filters	Sigma-Aldrich	Z677094-24EA	3 kDa MWCO
DTT	P212121	SV-DTT
BIS-TRIS propane,>=99.0% (titration)	Sigma-Aldrich	B6755-500G
ZnCl2	Sigma-Aldrich	208086
MgSO4	Amresco	0662
Glycerol	Thermo Fisher Scientific	G37-20
Gel-loading tips, 1 - 200 μL	Corning	CLS4853-400EA
Razor blade; Single-edged; 100/Pk.; Pack of 100	Fisher Scientific	12-640
Sterile Disposable Filter Units with PES Membrane > 250mL	Thermo Fisher Scientific	568-0020
Dialysis tubing clips	Spectrum Labs	132734
6-8 kDa 10 mm Dialysis Tubing	Spectrum Medical	132645
Superose 6 10/300 GL	GE Healthcare Life Sciences	17517201
Hi-Res Standard Agarose	AGTC Bioproducts	AG500D1
Ethidium bromide	Thermo Fisher Scientific	BP1302
Orange G	Fisher Scientific	0-267
Hyladder 10kb, 500 lanes	Denville Scientific	CB4225-4