אנו מתארים פרוטוקול צעד אחר צעד עבור טנדם כרומטין רצף immunoprecipitation (tChIP-Seq) המאפשרת הניתוח של שינוי היסטון הגנום כולו ייחודיים לסוג התא.
תקנה epigenetic ממלא תפקיד מרכזי ביטוי גנים. מאז שינוי היסטון התגלה בשנות השישים, תפקידיה פיזיולוגיים ופתולוגיים נחקרו בהרחבה. אכן, כניסתו של רצף עמוק הדור הבא, immunoprecipitation כרומטין (ChIP) באמצעות נוגדנים שינוי היסטון ספציפי יש מהפכה התפיסה שלנו לגבי רגולציה epigenetic ברחבי הגנום. לעומת זאת, רקמות בדרך כלל מורכבים של סוגי תאים שונים, תערובת מורכבת שלהם מציב אתגרים אנליטית כדי לחקור את epigenome בסוג לתא מסוים. כדי לטפל המדינה כרומטין ייחודיים לסוג התא באופן הגנום כולו, שפיתחנו לאחרונה טנדם כרומטין immunoprecipitation רצף (tChIP-Seq), אשר מבוססת על הטיהור סלקטיבי של כרומטין על-ידי הליבה מתויג חלבוני היסטון מתא סוגי ריבית, ואחריו שבב-תת סעיף. המטרה של פרוטוקול זה הוא ההקדמה של שיטות עבודה מומלצות של tChIP-תת סעיף. טכניקה זו מספקת כלי רב-תכליתי לחקירה רקמות ספציפיות epigenome שינויים היסטון מגוונים, מודל אורגניזמים.
ברקמות של בעלי חיים מורכבים של סוגי תאים שונים. הכונה בכל תא מגדיר את סוג התא. כרומטין שינויים – DNA מתילציה של היסטון-שינוי – ביסוד יחודיות תא-סוג של ביטוי גנים. לפיכך, המדידה של תקנה epigenetic בסוג התא כל רצונך בכך, אבל זה כבר אתגר טכני.
כדי לחקור את אפיגנטיקה בסוג לתא מסוים, היה רצף immunoprecipitation טנדם כרומטין (tChIP-Seq) פיתחה לאחרונה (איור 1)1. TChIP, מבוטא מתויג epitope הליבה היסטון חלבון ויזת עבודה H2B מ מקדם ייחודיים לסוג התא. תכונה זו מאפשרת את ניתוקה של chromatins את התאים של עניין, למרות החומר מתחיל תערובת של סוגי תאים שונים. השבב הבא-Seq — כרומטין טיהור באמצעות שינוי היסטון מארק בעלת רצף עמוק הדור הבא של מבודדים DNA – נוכל לעקוב אחר המצב epigenetic סוג התא יישוב באופן הגנום כולו.
בעזרת טכניקה זו, חקרנו לאחרונה נוירון ספציפי trimethylation של היסטון H3 חלבון-ליזין 4 (H3K4me3) סימני. במחקר זה, פיתחנו בטוק עכבר ב אילו C-סופני מתויג דגל ויזת עבודה H2B חלבון בא לידי ביטוי על רקומבינציה בתיווך Cre (Rosa26חטיבתי floxed-pA ויזת עבודה H2B-דגל…). על ידי מעבר עם עכבר אחזקת הגן רשת (ER) Cre-endoplasmic תחת השליטה של האמרגן CamK2a, הקו העכבר שהושג המושרה ויזת עבודה H2B-דגל בנוירונים פעיל עם טמוקסיפן הזרקה (Camk2aויזת עבודה H2B-דגל)1. החל מהמוח של הקו העכבר הוקמה, ביצענו tChIP-Seq עם נוגדן anti-H3K4me3. מאז H3K4me3 סימני לעיתים קרובות להתאים לאזורים יזם, נוכל לגלות מאות mRNAs במיוחד לידי ביטוי נוירונים1.
כאן, אנו מתארים שיטה tChIP טיפוסי-Seq שמכסה את השלבים של רקמות לנתיחה לבנייה הספרייה (איור 1). המטרה הסופית של פרוטוקול זה היא לשתף שלנו מומלצות עבור הביצועים של tChIP-Seq לבין היישום העתידי של שיטה זו על סוגי תאים אחרים והשינויים היסטון.
פרוטוקול שלנו היה ממוטב הנוירונים במוח העכבר, שבו הביטוי של ויזת עבודה H2B מתויג דגל הנגרמת על ידי הזרקת טמוקסיפן. היזמים להשתמש בביטוי ויזת עבודה H2B, חומרים רקמת המוצא של הסכום של הרקמות הם פרמטרים מרכזי עבור מוצלחת tChIP-תת סעיף. לפיכך, אופטימיזציה של גורמים אלה להתייחס לכל סוג התא של ריבית.
…The authors have nothing to disclose.
אנו מודים לכל חברי המעבדה איוואסאקי לקריאה ביקורתית של כתב היד. עבודה זו נתמכה בחלקו על ידי מענק הסיוע למחקר מדעי בתחומים חדשניים (#26113005 כיהן ו JP17H05679 ל ס. י); מענק הסיוע מדענים ומפתחים צעירים (א) (JP17H04998 ל ס. י) מ משרד החינוך, המדע, הספורט והתרבות של יפן (MEXT); והחלוץ פרויקטים “אבולוציה סלולרית” ו RIKEN כל פרוייקט “המחלה, Epigenome” מ RIKEN (כדי כיהן, ס. י).
Protein LoBind tube, 2 mL | Eppendorf | No. 0030108132 | For cell lysis |
Protein LoBind tube, 1.5 mL | Eppendorf | No. 0030108116 | For ChIP and library preparation |
DNA LoBind tube, 1.5 mL | Eppendorf | No. 0030108051 | For ChIP and library preparation |
8-strip PCR tube | BIO-BIK | 3247-00 | For ChIP and library preparation |
SK Mill | TOKKEN | SK-200 | Handy cryogenic grinder to make cell powder for fixation |
Metal bullet | TOKKEN | SK-100-DLC10 | Accessory of SK Mill |
2 mL stainless steel tube | TOKKEN | TK-AM5-SUS | An option for cell lysis |
2 mL stainless steel tube holder | TOKKEN | SK-100-TL | An option for cell lysis |
16% formaldehyde (w/v), methanol-free | Pierce | 28906 | To fix cells. Prepare 1% solution before use. |
Glycine | Nacalai Tesque | 17109-35 | Prepare 2.5 M stock |
D-PBS (-)(1x) | Nacalai Tesque | 14249-24 | For washing lysate and purified DNA |
HEPES | Nacalai Tesque | 02443-05 | For Lysis buffer 1. Prepare 1 M, pH 7.5 stock. |
5 M NaCl, molecular biology grade | Nacalai Tesque | 06900-14 | For Lysis buffer 1, Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer |
0.5 M EDTA, molecular biology grade | Wako Pure Chemical Industries, Ltd. | 311-90075 | For Lysis buffer 1, Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer |
Glycerol | Wako Pure Chemical Industries, Ltd. | 072-04945 | For lysis buffer 1 |
NP-40 | Nacalai Tesque | 25223-75 | For lysis buffer 1 |
Triton X-100, molecular biology grade | Nacalai Tesque | 12967-32 | For Lysis buffer 1 |
Tris | Nacalai Tesque | 35406-91 | For Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer. Prepare 1 M, pH 8.0 stock. |
0.1 M EGTA pH neutral | Nacalai Tesque | 08947-35 | For Lysis Buffer 2 |
Protease inhibitor cocktail (100x) | Nacalai Tesque | 25955-24 | To block degradation of protein |
RIPA buffer | Thermo Fisher Scientific | 89900 | For cell lysis and washing |
milliTUBE 1 mL AFA Fiber | Covaris | 520130 | Sonicator tube. Accessory of Focused-ultrasonicator |
Focused-ultrasonicator | Covaris | S220 or E220 | To digest DNA into adequate size for ChIP-Seq |
UltraPure 10% SDS | Thermo Fisher Scientific | 15553-027 | For ChIP Elution Buffer |
RNase A | Nacalai Tesque | 30141-14 | To purify DNA from lysate |
Proteinase K, recombinant, PCR Grade | Sigma-Aldrich | 3115887001 | To purify DNA from lysate |
Ethanol | Wako Pure Chemical Industries, Ltd. | 054-07225 | Make 70% solution |
Monoclonal anti-FLAG M2 antibody produced in mouse | Sigma-Aldrich | F1804 | To purify chromatin expressed in cells of interest |
Dynabead M-280 Sheep Anti-Mouse IgG | Thermo Fisher Scientific | 11201D | This can be used for anti-FLAG IP and anti-H3K4me3 IP |
Anti-tri-methyl histone H3 (K4), mouse monoclonal antibody | Wako Pure Chemical Industries, Ltd. | 301-34811 | Any other antibody that works for ChIP analysis will work |
10x Blocking Reagent | Sigma-Aldrich | 11096176001 | For blocking during affinity purification |
Denhardt’s solution | Nacalai Tesque | 10727-74 | For blocking during affinity purification |
Glycogen (5 mg/ml) | Thermo Fisher Scientific | AM9510 | To purify DNA from lysate |
Qubit 2.0 Fluorometer | Thermo Fisher Scientific | Q32866 | For quantification of isolated DNA |
Qubit dsDNA HS Assay Kit | Thermo Fisher Scientific | Q32851 | For quantification of isolated DNA |
0.5 mL tube | Axygen | 10011-830 | For quantification by Qubit |
Phenol/chloroform/isoamyl alcohol (25:24:1) | Nacalai Tesque | 25970-56 | To purify DNA from lysate |
AMPure XP beads | Beckman Coulter | A63881 | SPRI magnetic beads for library preparation |
Metal ice rack | Funakoshi | IR-1 | To keep the cell lysate frozen |
Sample Cooler | New England Biolabs | T7771S | Helps fix cells with minimal damage |
2100 Bioanalyzer | Agilent Technologies | G2939BA | To check the quality of isolated DNA fragments. Another fragment analyzer can be used. |
Bioanalyzer 2100 Expert Software | Agilent Technologies | G2946CA | Supplied with the Bioanalyzer |
High Sensitivity DNA Kit | Agilent Technologies | 5067-4626 | To check the quality of the isolated DNA fragments |
KAPA LTP Library Preparation Kit | Roche | 07961898001 | Supplied with 10x KAPA End Repair Buffer, KAPA End Repair Enzyme Mix, KAPA A-Tailing Buffer, KAPA A-Tailing Enzyme, KAPA Ligation Buffer, KAPA DNA Ligase, and PEG/NaCl solution |
NEXTflex DNA Barcodes | BIOO Scientific | NOVA-514101 | Adapter for library preparation. Supplied with DNA Barcode Adapters and Primer Mix. |
KAPA Real-Time Library Amplification Kit | Roche | 07959028001 | Supplied with 2x KAPA HiFi HS real-time PCR Master Mix, PCR Primer Mix, and Fluorescent Standards |
2x KAPA HiFi HotStart ReadyMix | Roche | KM2602 | For library preparation. Additionally, this enzyme may be required for the KAPA Real-Time Library Amplification Kit |
Buffer EB | Qiagen | 19086 | 10 mM Tris-Cl, pH 8.5 for elution of DNA |
386-well qPCR plate | Thermo Fisher Scientific | 4309849 | For real-time PCR |
QuantStudio 7 Flex Real-Time PCR System | Thermo Fisher Scientific | 4485701 | To quantify DNA |
MicroAmp Optical Adhesive Film | Thermo Fisher Scientific | 4311971 | For real-time PCR |
MicroAmp Clear Adhesive Film | Thermo Fisher Scientific | 4306311 | For plate sealing |
End-repair master mix | Combine 1.4 µL of 10x KAPA End Repair Buffer, 1 µL of KAPA End Repair Enzyme Mix, and 1.6 µL of H2O | ||
A-taling master mix | Combine 1 µL of KAPA A-Tailing Buffer, 0.6 µL of KAPA A-Tailing Enzyme, and 8.4 µL of H2O | ||
Ligation buffer mix | Combine 2 µL of KAPA ligation buffer and 6 µL of H2O | ||
Real-time PCR master mix | Combine 5 µL of 2x KAPA HiFi HS real-time PCR Master Mix, 0.35 µL of PCR Primer Mix (10 µM each of forward primer AATGATACGGCGACCACCGAG and reverse primer CAAGCAGAAGACGGCATACGAG), and 3.15 µL of H2O | ||
PCR master mix | Combine 10 µL of 2x KAPA HiFi Ready Mix, 0.9 µL of PCR Primer Mix, and 0.6 µL of H2O | ||
Integrative Genomics Viewer | Broad Institute | IGV_2.3.88 | Genome browser to visualize sequencing data |
DNA olgionucleotide: 5′-GCCTACGCAGGTCTTGCTGAC-3′ | Eurofins Genomics | A primer to amplify the promoter region of GAPDH | |
DNA olgionucleotide: 5′-CGAGCGCTGACCTTGAGGTC-3′ | Eurofins Genomics | A primer to amplify the promoter region of GAPDH | |
SYBR Premix Ex Taq | Takara | RR420L | To quantify the DNA corresponding to the GADPH promoter region |
Thermal Cycler Dice | Takara | TP870 | To quantify the DNA corresponding to the GADPH promoter region |