हम मिलकर क्रोमेटिन immunoprecipitation अनुक्रमण (tChIP-Seq) के लिए चरण-दर-चरण प्रोटोकॉल का वर्णन करते है जो कोशिका-प्रकार-विशिष्ट जीनोम-वाइड हिस्टोन संशोधन के विश्लेषण को सक्षम करता है ।
Epigenetic विनियमन जीन अभिव्यक्ति में केंद्रीय भूमिकाओं निभाता है । चूंकि हिस्टोन संशोधन 1960 के दशक में खोजा गया था, इसके शारीरिक और रोग कार्यों को बड़े पैमाने पर अध्ययन किया गया है । दरअसल, विशिष्ट हिस्टोन संशोधन एंटीबॉडी के माध्यम से अगली पीढ़ी के गहरे अनुक्रमण और क्रोमेटिन immunoprecipitation (चिप) के आगमन के जीनोम में epigenetic विनियमन के हमारे विचार क्रांति की है । इसके विपरीत, ऊतकों को आम तौर पर विविध प्रकार के सेल से मिलकर बनता है, और उनके जटिल मिश्रण एक विशेष कोशिका प्रकार में epigenome की जांच करने के लिए विश्लेषणात्मक चुनौतियों बन गया है । एक जीनोम में व्यापक तरीके से सेल प्रकार विशिष्ट क्रोमेटिन राज्य को संबोधित करने के लिए, हम हाल ही में मिलकर विकसित क्रोमेटिन immunoprecipitation अनुक्रमण (tChIP-Seq) है, जो क्रोमेटिन के चयनात्मक शुद्धीकरण से टैग कोर हिस्टोन प्रोटीन पर आधारित है सेल ब्याज के प्रकार, चिप Seq द्वारा पीछा किया । इस प्रोटोकॉल का लक्ष्य tChIP-Seq की सर्वोत्तम पद्धतियों का परिचय है. इस तकनीक के विभिंन हिस्टोन संशोधनों और मॉडल जीवों में ऊतक विशिष्ट epigenome जांच के लिए एक बहुमुखी उपकरण प्रदान करता है ।
पशुओं के ऊतकों विविध कोशिका प्रकार से मिलकर बनता है । प्रत्येक कोशिका में जीन विनियमन कोशिका प्रकार को परिभाषित करता है. क्रोमेटिन संशोधन-डीएनए मिथाइल और हिस्टोन संशोधन-आबाद जीन अभिव्यक्ति की कोशिका-प्रकार की विशिष्टता । इस प्रकार प्रत्येक कोशिका प्रकार में epigenetic नियमन की माप चाही गई है, लेकिन यह एक तकनीकी चुनौती रही है.
एक विशेष कोशिका प्रकार में epigenetics की जांच करने के लिए, मिलकर क्रोमेटिन immunoprecipitation अनुक्रमण (tChIP-Seq) हाल ही में विकसित किया गया था (चित्रा 1)1. tChIP में epitope-टैग की गई कोर हिस्टोन प्रोटीन H2B एक कोशिका-प्रकार-विशिष्ट प्रवर्तक से व्यक्त की जाती है. हालांकि सामग्री विभिन्न प्रकार के सेल के मिश्रण से शुरू होता है यह सुविधा, ब्याज की कोशिकाओं से chromatins के अलगाव की अनुमति देता है. निंनलिखित चिप-Seq-क्रोमेटिन शुद्धीकरण एक संशोधित-हिस्टोन निशान और अगली पीढ़ी अलग डीएनए की गहरी अनुक्रमण के माध्यम से-हम एक जीनोम चौड़ा तरीके से लक्षित सेल प्रकार की epigenetic स्थिति की निगरानी कर सकते हैं ।
इस तकनीक का प्रयोग, हम हाल ही में lysine 4 (H3K4me3) के निशान पर हिस्टोन H3 प्रोटीन के न्यूरॉन विशिष्ट trimethylation की जांच की । उस अध्ययन में, हम एक दस्तक माउस में जो सी-टर्मिनल फ्लैग-टैग H2B प्रोटीन Cre मध्यस्थता पुनर्संयोजन (Rosa26सीएजी floxed-पीए H2B-झंडा) पर व्यक्त किया गया था विकसित की है । एक माउस के साथ पार करके Cre-endoplasmic जालिका (एर) जीन CamK2a प्रवर्तक के नियंत्रण में, प्राप्त माउस लाइन H2B इंजेक्शन (tamoxifenCamK2a-झंडा)1पर सक्रिय ंयूरॉंस में-झंडा प्रेरित किया । स्थापित माउस लाइन के मस्तिष्क से शुरू, हम विरोधी H3K4me3 एंटीबॉडी के साथ tChIP-Seq प्रदर्शन किया । के बाद से H3K4me3 मार्क्स अक्सर प्रमोटर क्षेत्रों के अनुरूप है, हम mRNAs के सैकड़ों विशेष रूप से न्यूरॉन्स1में व्यक्त की खोज सकता है ।
यहां, हम एक ठेठ tChIP-Seq विधि है कि ऊतक विच्छेदन से पुस्तकालय निर्माण (चित्रा 1)के लिए कदम कवर का वर्णन । इस प्रोटोकॉल का अंतिम लक्ष्य है tChIP-Seq के प्रदर्शन के लिए हमारी सर्वोत्तम प्रथाओं का साझा करना और भविष्य में इस विधि के अनुप्रयोग को अन्य कोशिका प्रकारों और हिस्टोन संशोधनों के लिए.
हमारे प्रोटोकॉल माउस मस्तिष्क के ंयूरॉंस के लिए अनुकूलित किया गया था, जिसमें झंडा-टैग H2B की अभिव्यक्ति tamoxifen इंजेक्शन द्वारा प्रेरित है । प्रमोटरों H2B अभिव्यक्ति के लिए इस्तेमाल किया, ऊतक सामग्री शुरू कर?…
The authors have nothing to disclose.
हम पांडुलिपि के महत्वपूर्ण पढ़ने के लिए Iwasaki लैब के सभी सदस्यों को धंयवाद । इस काम के भाग में एक अनुदान के द्वारा समर्थित किया गया था पर वैज्ञानिक अनुसंधान के लिए सहायता में अभिनव क्षेत्रों (#26113005 करने के लिए S.N. और JP17H05679 करने के लिए S.I.); युवा वैज्ञानिकों के लिए एक अनुदान में सहायता (ए) (JP17H04998 to S.I.) शिक्षा मंत्रालय से, विज्ञान, खेल, और जापान की संस्कृति (MEXT); और अग्रणी परियोजनाओं “सेलुलर विकास” और सभी आरआईकेईएन परियोजना “रोग और Epigenome” आरआईकेईएन से (S.N. और S.I. के लिए).
Protein LoBind tube, 2 mL | Eppendorf | No. 0030108132 | For cell lysis |
Protein LoBind tube, 1.5 mL | Eppendorf | No. 0030108116 | For ChIP and library preparation |
DNA LoBind tube, 1.5 mL | Eppendorf | No. 0030108051 | For ChIP and library preparation |
8-strip PCR tube | BIO-BIK | 3247-00 | For ChIP and library preparation |
SK Mill | TOKKEN | SK-200 | Handy cryogenic grinder to make cell powder for fixation |
Metal bullet | TOKKEN | SK-100-DLC10 | Accessory of SK Mill |
2 mL stainless steel tube | TOKKEN | TK-AM5-SUS | An option for cell lysis |
2 mL stainless steel tube holder | TOKKEN | SK-100-TL | An option for cell lysis |
16% formaldehyde (w/v), methanol-free | Pierce | 28906 | To fix cells. Prepare 1% solution before use. |
Glycine | Nacalai Tesque | 17109-35 | Prepare 2.5 M stock |
D-PBS (-)(1x) | Nacalai Tesque | 14249-24 | For washing lysate and purified DNA |
HEPES | Nacalai Tesque | 02443-05 | For Lysis buffer 1. Prepare 1 M, pH 7.5 stock. |
5 M NaCl, molecular biology grade | Nacalai Tesque | 06900-14 | For Lysis buffer 1, Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer |
0.5 M EDTA, molecular biology grade | Wako Pure Chemical Industries, Ltd. | 311-90075 | For Lysis buffer 1, Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer |
Glycerol | Wako Pure Chemical Industries, Ltd. | 072-04945 | For lysis buffer 1 |
NP-40 | Nacalai Tesque | 25223-75 | For lysis buffer 1 |
Triton X-100, molecular biology grade | Nacalai Tesque | 12967-32 | For Lysis buffer 1 |
Tris | Nacalai Tesque | 35406-91 | For Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer. Prepare 1 M, pH 8.0 stock. |
0.1 M EGTA pH neutral | Nacalai Tesque | 08947-35 | For Lysis Buffer 2 |
Protease inhibitor cocktail (100x) | Nacalai Tesque | 25955-24 | To block degradation of protein |
RIPA buffer | Thermo Fisher Scientific | 89900 | For cell lysis and washing |
milliTUBE 1 mL AFA Fiber | Covaris | 520130 | Sonicator tube. Accessory of Focused-ultrasonicator |
Focused-ultrasonicator | Covaris | S220 or E220 | To digest DNA into adequate size for ChIP-Seq |
UltraPure 10% SDS | Thermo Fisher Scientific | 15553-027 | For ChIP Elution Buffer |
RNase A | Nacalai Tesque | 30141-14 | To purify DNA from lysate |
Proteinase K, recombinant, PCR Grade | Sigma-Aldrich | 3115887001 | To purify DNA from lysate |
Ethanol | Wako Pure Chemical Industries, Ltd. | 054-07225 | Make 70% solution |
Monoclonal anti-FLAG M2 antibody produced in mouse | Sigma-Aldrich | F1804 | To purify chromatin expressed in cells of interest |
Dynabead M-280 Sheep Anti-Mouse IgG | Thermo Fisher Scientific | 11201D | This can be used for anti-FLAG IP and anti-H3K4me3 IP |
Anti-tri-methyl histone H3 (K4), mouse monoclonal antibody | Wako Pure Chemical Industries, Ltd. | 301-34811 | Any other antibody that works for ChIP analysis will work |
10x Blocking Reagent | Sigma-Aldrich | 11096176001 | For blocking during affinity purification |
Denhardt’s solution | Nacalai Tesque | 10727-74 | For blocking during affinity purification |
Glycogen (5 mg/ml) | Thermo Fisher Scientific | AM9510 | To purify DNA from lysate |
Qubit 2.0 Fluorometer | Thermo Fisher Scientific | Q32866 | For quantification of isolated DNA |
Qubit dsDNA HS Assay Kit | Thermo Fisher Scientific | Q32851 | For quantification of isolated DNA |
0.5 mL tube | Axygen | 10011-830 | For quantification by Qubit |
Phenol/chloroform/isoamyl alcohol (25:24:1) | Nacalai Tesque | 25970-56 | To purify DNA from lysate |
AMPure XP beads | Beckman Coulter | A63881 | SPRI magnetic beads for library preparation |
Metal ice rack | Funakoshi | IR-1 | To keep the cell lysate frozen |
Sample Cooler | New England Biolabs | T7771S | Helps fix cells with minimal damage |
2100 Bioanalyzer | Agilent Technologies | G2939BA | To check the quality of isolated DNA fragments. Another fragment analyzer can be used. |
Bioanalyzer 2100 Expert Software | Agilent Technologies | G2946CA | Supplied with the Bioanalyzer |
High Sensitivity DNA Kit | Agilent Technologies | 5067-4626 | To check the quality of the isolated DNA fragments |
KAPA LTP Library Preparation Kit | Roche | 07961898001 | Supplied with 10x KAPA End Repair Buffer, KAPA End Repair Enzyme Mix, KAPA A-Tailing Buffer, KAPA A-Tailing Enzyme, KAPA Ligation Buffer, KAPA DNA Ligase, and PEG/NaCl solution |
NEXTflex DNA Barcodes | BIOO Scientific | NOVA-514101 | Adapter for library preparation. Supplied with DNA Barcode Adapters and Primer Mix. |
KAPA Real-Time Library Amplification Kit | Roche | 07959028001 | Supplied with 2x KAPA HiFi HS real-time PCR Master Mix, PCR Primer Mix, and Fluorescent Standards |
2x KAPA HiFi HotStart ReadyMix | Roche | KM2602 | For library preparation. Additionally, this enzyme may be required for the KAPA Real-Time Library Amplification Kit |
Buffer EB | Qiagen | 19086 | 10 mM Tris-Cl, pH 8.5 for elution of DNA |
386-well qPCR plate | Thermo Fisher Scientific | 4309849 | For real-time PCR |
QuantStudio 7 Flex Real-Time PCR System | Thermo Fisher Scientific | 4485701 | To quantify DNA |
MicroAmp Optical Adhesive Film | Thermo Fisher Scientific | 4311971 | For real-time PCR |
MicroAmp Clear Adhesive Film | Thermo Fisher Scientific | 4306311 | For plate sealing |
End-repair master mix | Combine 1.4 µL of 10x KAPA End Repair Buffer, 1 µL of KAPA End Repair Enzyme Mix, and 1.6 µL of H2O | ||
A-taling master mix | Combine 1 µL of KAPA A-Tailing Buffer, 0.6 µL of KAPA A-Tailing Enzyme, and 8.4 µL of H2O | ||
Ligation buffer mix | Combine 2 µL of KAPA ligation buffer and 6 µL of H2O | ||
Real-time PCR master mix | Combine 5 µL of 2x KAPA HiFi HS real-time PCR Master Mix, 0.35 µL of PCR Primer Mix (10 µM each of forward primer AATGATACGGCGACCACCGAG and reverse primer CAAGCAGAAGACGGCATACGAG), and 3.15 µL of H2O | ||
PCR master mix | Combine 10 µL of 2x KAPA HiFi Ready Mix, 0.9 µL of PCR Primer Mix, and 0.6 µL of H2O | ||
Integrative Genomics Viewer | Broad Institute | IGV_2.3.88 | Genome browser to visualize sequencing data |
DNA olgionucleotide: 5′-GCCTACGCAGGTCTTGCTGAC-3′ | Eurofins Genomics | A primer to amplify the promoter region of GAPDH | |
DNA olgionucleotide: 5′-CGAGCGCTGACCTTGAGGTC-3′ | Eurofins Genomics | A primer to amplify the promoter region of GAPDH | |
SYBR Premix Ex Taq | Takara | RR420L | To quantify the DNA corresponding to the GADPH promoter region |
Thermal Cycler Dice | Takara | TP870 | To quantify the DNA corresponding to the GADPH promoter region |