게놈은 핵 공간에서 염색체 형성 포획 기술을 통해 드러나게 할 수 있는 다른 구조물로 조직됩니다. 핵 내 Hi-C 방법은 드로소필라 세포주에서 크로마티닌 상호작용의 게놈 전체 컬렉션을 제공하며, 이는 제한 단편 수준에서 메가베이스 해상도로 탐색할 수 있는 접촉 맵을 생성합니다.
게놈은 도메인 간의 상호 작용을 격리하는 경계에 의해 구분되는 토폴로지적으로 연관된 도메인(TADs)으로 구성됩니다. Drosophila에서 TAD 형성과 경계의 기본 메커니즘은 여전히 조사 중입니다. 여기에 설명된 핵 내 Hi-C 방법의 적용은 노치 유전자를 분리하는 TAD 경계에서 건축 단백질(AP)결합 부위의 기능을 해부하는 데 도움이 되었다. AP의 손실을 일으키는 도메인 경계의 유전자 변형은 TAD 융합, 전사 결함 및 장거리 토폴로지 변경을 초래합니다. 이 결과는 Drosophila에 있는 도메인 경계 형성 및 유전자 발현 통제에 유전 요소의 기여를 보여주는 증거를 제공했습니다. 여기서, 핵 내 Hi-C 방법은 프로토콜과 함께 실험의 품질을 평가하기 위한 중요한 체크포인트를 제공하는 상세하게 기술되었다. 또한 다른 게놈 비늘에서 게놈 상호 작용을 분석하기 위해 시퀀싱 판독 및 유효한 Hi-C 쌍의 필요한 숫자가 도시되어 있습니다. CRISPR/Cas9 매개 유전자 편집 은 규제 요소의 유전자 편집 및 이 핵 내 Hi-C 프로토콜을 사용하여 게놈 상호 작용의 고해상도 프로파일링은 유전 적 요소의 구조적 기능의 조사를위한 강력한 조합이 될 수 있습니다.
진핵생물에서, 게놈은1단계도중 핵 공간에 있는 특정 영토를 차지하는 염색체로 분할된다. 염색체를 형성하는 염색체는 두 개의 주요 국가로 나눌 수 있습니다: 전사적으로 허용되는 접근 가능한 크로마틴 의 하나, 그리고 전사적으로 억압되는 소형 크로마틴의 다른. 이 크로마틴 상태는 핵2에두 개의 뚜렷한 구획을 형성하여 핵 공간에서 분리하고 거의 혼합되지 않습니다. 서브 메가베이스 척도에서 경계는 염색체조직3,4,5를표시하는 TAD라는 고주파 크로마틴 상호 작용의 도메인을 분리합니다. 포유류에서 TAD 경계는 응집력 및 CCCTC 결합 계수(CTCF)6,7,8에의해 점령된다. 응집력 복합체는 크롬라틴을 압출하고 유전체 서열에서 수렴 방향으로 배치되는 CTCF 결합 부위에서 정지하여 안정적인 크로마틴 루프9,10,13,14를형성한다. CTCF DNA 결합 부위의 유전적 중단은 CTCF 및 응집력 있는 단백질 풍부의 경계 또는 감소로 조절 원소, TAD 형성의 손실 및 유전자 발현 완화9,10, 11,13,14사이의 비정상적인 상호 작용을 초래한다.
드로소필라에서, TAD사이의 경계는 경계 요소 관련 인자 32 kDa(BEAF-32), 모티프 1 결합 단백질(M1BP), 센트로소말 단백질 190(CP190), 털이 날개(SuHW), 및 CTCF를 포함한 여러 EP에 의해 점유되고, 그의 변형 및18,18,폴리머1에서 풍부하게 된다. 드로소필라에서는13,17,19의전사의 결과로 TAD가 나타나고 경계 형성 및 절연 특성에서 독립적 인 AP의 정확한 역할은 아직 조사 중입니다. 따라서, Drosophila의 도메인이 유사한 전사 상태의 영역 집합의 유일한 결과인지 또는 CTCF를 포함한 AP가 경계 형성에 기여하는지 여부는 완전히 특징지어져야 한다. 차세대 시퀀싱과 결합된 염색체 형태 포획 기술의 개발을 통해 고해상도에서 게놈 접촉의 탐사가 가능해졌습니다. Hi-C 프로토콜은 크로마틴 단편 간의 스퓨리어스 결찰 제품을 피하기 위해 “솔루션”2를 수행한 결찰 단계로 처음 설명되었다. 그러나, 여러 연구는 데이터에서 유용한 신호가 용액20,21에없었던 부분적으로 리세드 핵에서 형성된 결찰 제품으로부터 왔다는 것을깨달았다.
그런 다음 프로토콜은 단일 세포 Hi-C실험(22)의일부로 핵 내부의 결찰을 수행하도록 수정하였다. 핵 내 Hi-C 프로토콜은 이후 세포 인구 Hi-C에 통합되어 전체 범위의 게놈 거리에서 보다 일관된 커버리지를 산출하고 덜 기술적노이즈(23,24)로데이터를 생성한다. 여기서 상세히 기술된 프로토콜은, 핵 내의정서(23,24)를 기반으로 하며 드로소필라(Drosophila)의 노치 유전자 궤적에서 도메인 경계에서 CTCF 및 M1BP에대한 DNA 결합 모티브를 유전적으로 제거하는 결과를 조사하는 데 사용되었다. 결과는 경계에 있는 AP를 위한 DNA 결합 모티프를 바꾸는 것은 노치 도메인 형성, 노치 메큐를 둘러싼 지역에 있는 더 큰 토폴로지 결함 및 유전자 발현 변압에 대한 과감한 결과를 가지고 있다는 것을 보여줍니다. 이것은 도메인 경계에 있는 유전 원소가 Drosophila25에있는 게놈 토폴로지 및 유전자 발현의 유지를 위해 중요하다는 것을 표시합니다.
여기에 제시된 핵 내 Hi-C 방법은 고해상도로 드로소필라 게놈 토폴로지의 상세한 탐구를 허용하고, 발기인과 증강제 와 같은 조절 요소 간의 크로마틴 루프에서 부터 TAD 및 대형 구획식별(25)에이르기까지 다양한 게놈 비늘에서 게놈 상호 작용의 전망을 제공한다. 동일한 기술은 또한 일부 수정33을가진 포유류 조직에 효율적으로 적용되었습니다. 예를 들어, 단?…
The authors have nothing to disclose.
이 작품은 UNAM 기술 혁신 및 연구 지원 프로그램 (PAPIIT) 교부금 번호 IN207319 및 과학기술 국가 위원회 (CONACyT-FORDECyT) 교부금 번호 303068 의해 지원되었다. A.E.L. 과학 기술 국가 위원회 (CONACyT) CVU 번호 968128 의해 지원 석사 학생입니다.
16% (vol/vol) paraformaldehyde solution | Agar Scientific | R1026 | |
Biotin-14-dATP | Invitrogen | CA1524-016 | |
ClaI enzyme | NEB | R0197S | |
COVARIS Ultrasonicator | Covaris | LE220-M220 | |
Cut Smart | NEB | B72002S | |
Dulbecco's Modified Eagle Medium (DMEM) 1x | Life Technologies | 41965-039 | |
Dynabeads MyOne Streptabidin C1 | Invitrogen | 65002 | |
Fetal bovine serum (FBS) sterile filtered | Sigma | F9665 | |
Klenow Dna PolI large fragment | NEB | M0210L | |
Klenow exo(-) | NEB | M0210S | |
Ligation Buffer | NEB | B020S | |
MboI enzyme | NEB | R0147M | |
NP40-Igepal | SIGMA | CA-420 | Non-ionic surfactant for addition in lysis buffer |
PE adapter 1.0 | Illumina | 5'-P-GATCGGAAGAGCGGTTCAGCAG GAATGCCGAG-3' |
|
PE adapter 2.0 | Illumina | 5'-ACACTCTTTCCCTACACGACGCT CTTCCGATCT-3' |
|
PE PCR primer 1.0 | Illumina | 5'-AATGATACGGCGACCACCGAGAT CTACACTCTTTCCCTACACGACG CTCTTCCGATCT-3' |
|
PE PCR primer 2.0 | Illumina | 5'-CAAGCAGAAGACGGCATACGAG ATCGGTCTCGGCATTCCTGCTGA ACCGCTCTTCCGATCT-3' |
|
Phenol: Chloroform:Isoamyl Alcohol 25:24:1 | SIGMA | P2069 | |
Primer 1 (known interaction, Figure 2A) | Sigma | 5'-TCGCGGTAATTTTGCGTTTGA-3' | |
Primer 2 (known interactions, Figure 2A) | Sigma | 5'-CCTCCCTGCCAAAACGTTTT-3' | |
Protease inhibitor cocktail tablet | Roche | 4693132001 | |
Proteinase K | Roche | 3115879001 | |
Qubit | ThermoFisher | Q33327 | |
RNAse | Roche | 10109142001 | |
SPRI Beads | Beckman | B23318 | |
T4 DNA ligase | Invitrogen | 15224-025 | |
T4 DNA polymerase | NEB | M0203S | |
T4 polynucleotide kinase (PNK) | NEB | M0201L | |
TaqPhusion | NEB | M0530S | DNA polymerase |
Triton X-100 | Non-ionic surfactant for quenching of SDS |