Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Drosophila Hücrelerinde Çekirdek içi Hi-C

Published: September 15, 2021 doi: 10.3791/62106

Summary

Genom, nükleer uzayda kromozom konformasyon yakalama teknolojileri ile ortaya sunulabilen farklı yapılara düzenlenmiştir. Çekirdek içi Hi-C yöntemi, Drosophila hücre hatlarında, kısıtlama parçası düzeyinde megabase çözünürlükte keşfedilebilen temas haritaları üreten, genom çapında bir kromatin etkileşimi koleksiyonu sağlar.

Abstract

Genom, etki alanları arasındaki etkileşimleri yalıtlayan sınırlarla sınırlandırılmış topolojik olarak ilişkili etki alanları (TAD' ler) halinde düzenlenmiştir. Drosophila'da TAD oluşumu ve sınırlarının altında kalan mekanizmalar halen araştırılmaktadır. Burada açıklanan çekirdek içi Hi-C yönteminin uygulanması, Çentik genini izole eden TAD sınırlarında mimari protein (AP) bağlayıcı bölgelerin işlevinin parçalanarak parçalanmasına yardımcı oldu. APS kaybına neden olan etki alanı sınırlarının genetik modifikasyonu TAD füzyonu, transkripsiyon kusurları ve uzun menzilli topolojik değişikliklerle sonuçlanır. Bu sonuçlar, Drosophila'da genetik elementlerin etki alanı sınır oluşumuna ve gen ekspresyon kontrolüne katkısını gösteren kanıtlar sağlamıştır. Burada, protokolle birlikte deneyin kalitesini değerlendirmek için önemli kontrol noktaları sağlayan çekirdek içi Hi-C yöntemi ayrıntılı olarak açıklanmıştır. Ayrıca, farklı genomik ölçeklerdeki genomik etkileşimleri analiz etmek için gerekli sayıda sıralama okuması ve geçerli Hi-C çiftleri gösterilmiştir. CRISPR/Cas9 aracılı genetik düzenleme düzenleyici unsurların ve bu çekirdek içi Hi-C protokolü kullanılarak genomik etkileşimlerin yüksek çözünürlüklü profillenmesi, genetik elementlerin yapısal işlevinin araştırılması için güçlü bir kombinasyon olabilir.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ökaryotlarda, genom, ara faz1sırasında nükleer alandaki belirli bölgeleri işgal eden kromozomlara bölünür. Kromozomları oluşturan kromatin iki ana hale ayrılabilir: biri transkripsiyonel olarak izin verilen erişilebilir kromatin ve diğeri transkripsiyonel olarak baskıcı olan kompakt kromatin. Bu kromatin durumları nükleer uzayda ayrışır ve nadiren karışır, çekirdekte iki ayrı bölme oluşturur2. Alt megabase ölçeğinde, sınırlar, kromozomal kuruluş3,4,5'i işaretleyen TAD adı verilen yüksek frekanslı kromatin etkileşimlerinin etki alanlarını ayırır. Memelilerde, TAD sınırları cohesin ve CCCTC bağlayıcı faktör (CTCF)6,7,8tarafından işgal edilir. Cohesin kompleksi kromatin ekstrüzyonları ve kararlı kromatin döngüleri oluşturmak için genomik dizideki yakınsak bir yönde bertaraf edilen CTCF bağlayıcı bölgelerde durur9,10,13,14. CTCF DNA bağlayıcı bölgenin sınırlarda genetik bozulması veya CTCF ve cohesin protein bolluğunda azalma, düzenleyici elementler arasında anormal etkileşimlere, TAD oluşumu kaybına ve gen ekspresyon deregülasyonuna neden olur9,10,11,13,14.

Drosophila'da, TAD'ler arasındaki sınırlar, sınır elemanı ile ilişkili faktör 32 kDa (BEAF-32), Motif 1 bağlayıcı protein (M1BP), centrosomal protein 190 (CP190), kıllı kanadın baskılayıcısı (SuHW) ve CTCF dahil olmak üzere çeşitliAP'ler tarafından işgal edilir ve aktif histone modifikasyonları ve Polymerase II16,17,18ile zenginleştirilir. Drosophila'da, TAD'lerin transkripsiyon13 , 17,19'unbir sonucu olarak ortaya çıktığı ve bağımsız AS'lerin sınır oluşumu ve yalıtım özelliklerindeki tam rolünün hala araştırıldığu ileri sürlenmiştir. Bu nedenle, Drosophila'daki etki alanlarının benzer transkripsiyon durumlarındaki bölgelerin toplanmasının tek sonucu olup olmadığı veya CTCF de dahil olmak üzere AP'lerin sınır oluşumuna katkıda bulunup bulunmadığı tam olarak karakterize olmaya devam etmektedir. Genomik temasların yüksek çözünürlükte araştırılması, kromozom konformasyon yakalama teknolojilerinin geliştirilmesi ve yeni nesil dizileme ile mümkün olmuştur. Hi-C protokolü ilk olarak kromatin parçaları arasında sahte ligasyon ürünlerini önlemek amacıyla "çözeltide"2 gerçekleştirilen ligasyon adımı ile tanımlanmıştır. Bununla birlikte, birkaç çalışma, verilerdeki yararlı sinyalin, çözelti20,21'deolmayan kısmen lile çekirdeklerinde oluşturulan ligasyon ürünlerinden geldiğinin farkına işaret etti.

Protokol daha sonra tek hücreli Hi-C deneyi22'ninbir parçası olarak çekirdeğin içindeki ligasyonu gerçekleştirmek için değiştirildi. Çekirdek içi Hi-C protokolü daha sonra tüm genomik mesafelerde daha tutarlı bir kapsama alanı sağlamak ve daha az teknik gürültü ile veri üretmek için hücre popülasyonuHi-C'yedahil edildi23,24. Burada ayrıntılı olarak açıklanan protokol, çekirdek içi Hi-C protokolü23,24'e dayanmaktadır ve CTCF ve M1BP için DNA bağlayıcı motiflerin Drosophila25'teki Çentik gen çekirgesinde bir etki alanı sınırından genetik olarak çıkarılmasının sonuçlarını araştırmak için kullanılmıştır. Sonuçlar, sınırdaki AP'ler için DNA bağlayıcı motiflerin değiştirilmesinin Çentik etki alanı oluşumu, Çentik çekirgesini çevreleyen bölgelerde daha büyük topolojik kusurlar ve gen ekspresyon deregülasyonu için büyük sonuçlar doğurdığını göstermektedir. Bu, etki alanı sınırlarındaki genetik elementlerin Drosophila25'tegenom topolojisinin ve gen ekspresyonunun sürdürülmesi için önemli olduğunu gösterir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Fiksasyon

  1. Oda sıcaklığında (RT) %10 fetal sığır serumu (FBS) içeren Schneider ortamında 17,5 mL hücre süspansiyonu hazırlamak için 10 milyon Schneider'ın hat 2 artı (S2R+) hücresiyle başlayın.
  2. Son konsantrasyonu% 2 elde etmek için metanol içermeyen formaldehit ekleyin. RT'de 10 dakika karıştırın ve kuluçkaya yatırarak her dakika karıştırmaya özen edin.
    NOT: Formaldehit tehlikeli bir kimyasaldır. Uygun sağlık ve güvenlik yönetmeliklerine uyun ve duman kaputunda çalışın.
  3. Son 0.125 M konsantrasyonunu elde etmek için glisine ekleyerek reaksiyonu söndür ve karıştırın. RT'de 5 dakika kuluçkaya yatır, ardından buzda 15 dakika.
  4. RT'de 5 dakika boyunca 400 × g ve ardından 4 °C'de 10 dakika santrifüj; üstnatant atın. Peletin 25 mL soğuk 1x fosfat tamponlu salin içinde dikkatlice yeniden depolanın.
  5. 4 °C'de 10 dakika boyunca 400 × g'da santrifüj, ardından süpernatantı atın.
    NOT: Protokole devam ediyorsanız, liziz için 2.1. aksi takdirde, peletin sıvı N2'de flaşla dondurulması ve peletin -80 °C'de saklanması.

2. Lizis

  1. Hücreleri 1 mL buz gibi lizis tamponunda (10 mM Tris-HCl, pH 8; iyonik olmayan yüzey aktif maddelerinin% 0,2'si (Malzeme Tablosunabakın); 10 mM NaCl; 1x proteaz inhibitörleri) yeniden depolar ve hacmi buz gibi lizis tamponu ile 10 mL'ye ayarlayın. 1 × 106 hücre/mL konsantrasyon elde etmek için hacmi ayarlayın. Tüpleri ters çevirerek her 2 dakikada bir karıştırarak 30 dakika buz üzerinde kuluçkaya yatırın.
  2. Çekirdeği 300 × g'da 4 °C'de 5 dakika santrifüj edin ve ardından süpernatantı dikkatlice atın. Pelezi 1 mL soğuk lizis tamponu ile 1x yıkayın ve bir mikrosantrifüj tüpüne aktarın. Peletin 1x'ini 1 mL soğuk 1,25x kısıtlama tamponu ile yıkayın ve her hücre peletini 360 μL 1,25x kısıtlama tamponunda yeniden depola.
  3. Tüp başına 11 μL sodyum dodecyl sülfat (SDS) ekleyin (%0,3 son konsantrasyon), pipetleme ile dikkatlice karıştırın ve 37 °C'de 45 dakika boyunca kuluçkaya yatırarak 700-950 rpm'de sallayın. Kuluçka sırasında birkaç kez kümelenmeyi bozmak için yukarı ve aşağı boru.
  4. Tüp başına 75 μL iyonik olmayan yüzey aktif madde (%10 çözelti, bkz. Malzeme Tablosunabakın) ekleyerek SDS'yi söndürün (%1,6 son konsantrasyon) ve 37 °C'de 45 dakika boyunca kuluçkaya yatırın, 950 rpm'de sallayarak. Kuluçka sırasında kümelenmeleri bozmak için birkaç kez yukarı ve aşağı borulayın.
    NOT: Kümeler büyükse ve bozulması zorsa, SDS ve yüzey aktif madde tedavileri sırasında dönme hızını 400 rpm'ye düşürün. Kümeler pipetleme ile ayrılması zorsa, örneği ikiye bölün; kısıtlama arabelleği, SDS ve yüzey aktif madde birimlerini ayarlayın; ve permeabilizasyona devam edin. Daha sonra, çekirdeği minimum hızda döndürün (200 × g),süpernatant'ı dikkatlice atın, örnekleri 1X kısıtlama tamponunda bir araya gelin ve sindirime devam edin. Sindirilmemiş örnek (UD) olarak 10 μL aliquot alın.

3. Enzymatic sindirim

  1. Tüp başına 200 birim (U) Mbo I ekleyerek kromatin sindirin ve dönerken 4 saat ile geceleme (950 rpm) arasında değişen bir süre boyunca 37 °C'de kuluçkaya yatırın.
  2. Ertesi gün, tüp başına ek 50 U Mbo I ekleyin ve dönerken 2 saat boyunca 37 °C'de kuluçkaya yaslanın (950 rpm).
  3. Tüpleri 60 °C'de 20 dakika kuluçkaya yatırarak enzimi inaktive edin. Tüpleri buza yerleştirin.
    NOT: Sindirilen örnek (D) olarak 10 μL aliquot alın.

4. DNA'nın biyotinilasyonu sona erer

  1. Kısıtlama parçası çıkıntılarını doldurmak ve DNA uçlarını biotin ile etiketlemek için, 10 mM dCTP, dGTP, dTTP, 20 μL 0,4 mM biotin dATP'nin her birini 1,5 μL ekleyin, Tüm tüplere 17,5 μL Tris düşük EDTA (TLE) tamponu [10 mM Tris-HCl, 0,1 mM EDTA, pH 8,0] ve 5 U/μL'nin 10 μL'si (DNA polimeraz I büyük parça). Dikkatlice karıştırın ve 37 °C'de 75 dakika kuluçkaya yatır. 30 sn boyunca her 10 s'de 700 rpm'de sallayın. Ligasyon karışımını hazırlarken tüm tüpleri buza yerleştirin.

5. Ligasyon

  1. Sindirilen her kromatin karışımını ligasyon karışımı (100 μL 10x ligasyon tamponu, 10 μL 10 mg/mL sığır serum albümini, 15 U T4 DNA ligazı ve 425 μL çift damıtılmış su [ddH2O]) ile ayrı bir 1 mL tüpe aktarın. Hafif pipetleme ile iyice karıştırın ve 16 °C'de gece boyunca kuluçkaya yatırın.

6. Crosslink ters çevrilmesi ve DNA saflaştırması

  1. Tüp başına 50 μL 10 mg/mL Proteinaz K ekleyerek proteinleri bozun ve 2 saat boyunca 37 °C'de kuluçkaya yatırın. Sıcaklığı 65 °C'ye artırarak çapraz bağlantıları ters çevirin ve bir gecede kuluçkaya yatırın.
  2. 10 mg/mL RNase A'nın 20 μL'si eklenerek RNA'yı bozun ve 1 saat boyunca 37 °C'de kuluçkaya yaslanın.
  3. Fenol:kloroform ekstraksiyonu ve ardından etanol çökelterek gerçekleştirin.
    1. 1 hacim fenol-kloroform ekleyin ve homojen bir beyaz faz elde etmek için ters çevrilerek iyice karıştırın.
      NOT: Fenol tehlikeli bir kimyasaldır. Uygun sağlık ve güvenlik yönetmeliklerine uyun. Duman kaputunda çalış.
    2. 15 dakika boyunca 15.000 × g'da santrifüj. Sulu fazı taze bir 2 mL mikrosantrifüj tüpüne aktarın. 100 μL TLE tamponu ile alt katmanın geri ekstraksiyonu gerçekleştirin ve sulu fazı aynı 2 mL tüpe aktarın.
    3. 2 cilt %100 etil alkol (EtOH), 0,1 cilt 3 M sodyum asetat ve 2 μL 20 mg/mL glikojen ekleyerek DNA'yı çökeltin. -20 °C'de 2 saat ile bir gece arasında değişen bir süre kuluçkaya yatırın.
    4. 4 °C'de 30 dakika boyunca 15.000 × g'da dön ve peletleri buz gibi % 70 EtOH ile 2x yıkayın. Peletleri RT'de kurutun ve 100 μL TLE tamponunda yeniden dirildi. Üreticinin talimatlarına göre DNA'ya ve florometreye seçici olarak bağlanan florojenik bir boya kullanarak DNA'yıölçün( Malzeme Tablosu ).
      NOT: Protokol burada duraklatılabilir. Ligasyon ürünlerini kısa vadede 4 °C'de veya uzun vadede -20 °C'de saklayın. Kalite kontrolü için liglenmiş numune (L) olarak malzemeden bir aliquot (100 ng) kullanın.

7. Hi-C şablon kalitesini değerlendirin

  1. Sindirim ve ligasyon nitel kontrolleri
    1. Çapraz bağlantıları tersine çevirerek DNA'yı UD ve D aliquotlardan arındırın ve yukarıda açıklandığı gibi fenol:kloroform ekstraksiyonu ve etanol çökeltme gerçekleştirin.
    2. %1,5 agarose jel içinde 100 ng UD, D ve L örnekleri yükleyin. D örneğinde yaklaşık 500 bp merkezli bir smear ve L örneği için yüksek moleküler ağırlık bandı arayın (bkz. temsili sonuçlar).
  2. Sindirim verimliliği nicel kontrolü
    NOT: Sindirim verimliliğini daha doğru değerlendirmek için, aşağıdaki gibi tasarlanmış astarları kullanarak nicel polimeraz zincir reaksiyonları (qPCR) gerçekleştirmek için UD ve D örneklerini şablon olarak kullanın.
    1. 7.2.3 adımındaki formülde R adı verilen sindirim için kullanılan enzim için DNA kısıtlama bölgesini içeren bir DNA parçasını (mevcut protokoldeki Mbo I) içeren bir astar çifti tasarlayın.
    2. 7.2.3 adımındaki formülde C adı verilen, sindirim için kullanılan enzim için kısıtlama bölgesini içermeyen bir kontrol DNA parçasını (mevcut protokol için Mbo I) içeren bir astar çifti tasarlayın.
    3. Aşağıda gösterilen formüle göre kısıtlama verimliliğini hesaplamak için amplifikasyonun döngü eşiği değerlerini (Ct değerleri) kullanın:
      Kısıtlama yüzdesi = 100 - 100/2{(ctr - ctc)d - (ctr - ctc)ud}
      Burada ToR, R parçasının Ct değerini, CtC ise örnek D ve örnek UD için C parçasının Ct değerini ifade eder.
      NOT: Kısıtlama yüzdesi, kısıtlama DNA'sını içermeyen bir kontrol (C) DNA parçasına kıyasla kısıtlı (R) DNA parçasını parçalayan kısıtlama enziminin verimliliğini yansıtır. %80'≥ bir kısıtlama verimliliği önerilir.
  3. Bilinen etkileşimlerin algılanmasını
    1. Kısa ve/veya orta veya uzun menzilli etkileşimleri incelemek üzere dahili ligasyon kontrolünü güçlendirmek için PCR gerçekleştirin (bkz. temsili sonuçlar).
    2. Alternatif olarak, astarların bitişik kısıtlama parçalarında ileri veya geri-geri yönde olduğu bir ligasyon ürününü yükseltmek için astarlar tasarlayın.
  4. Doldurma ve biotin etiketleme kontrolü
    1. Yukarıda açıklandığı gibi, genomdaki bitişik kısıtlama parçaları arasında bilinen bir etkileşimin veya ligasyon ürününün amplifikasyonu ve sindirimi ile Hi-C işaretleme ve ligasyon verimliliğini doğrulayın.
      NOT: Mbo I sitesinin (GATC) başarılı bir şekilde doldurulması ve ligasyonu, ligasyon kavşağında Cla I (ATCGAT) kısıtlama enzimi için yeni bir site oluşturur ve Mbo I sitesini yeniler.
    2. PCR ürününü Mbo I, Cla I veya her ikisiyle de sindirin. Numuneleri% 1,5-2 jel üzerinde çalıştırdıktan sonra, kesim ve kesilmemiş bantların yoğunluğunu ölçerek 3C ve Hi-C ligasyon bağlantılarının göreli sayısını tahmin edin26.
      NOT: %70'> bir verimlilik istenmek istenmemektedir (bkz. temsili sonuçlar).

8. Sonication

  1. 200-500 bp DNA parçaları elde etmek için örnekleri sonicate edin. Bu protokolde kullanılan cihaz için (Bkz. Malzeme Tablosu),numuneyi (5 ila 10 μg) tüp başına 130 μL ddH2O'da seyreltin ve cihazı 400 bp'ye sonicate edecek şekilde ayarlayın: doldurma seviyesi: 10; görev faktörü: %10; tepe olay gücü (w): 140; patlama başına döngü: 200; zaman (lar): 80.

9. Biotin kaldırma / bitiş onarımı

NOT: Aşağıda gösterilen adımlar 5 μg Hi-C DNA'sı için ayarlanır.

  1. Biotin çıkarma işlemini gerçekleştirmek için, numuneyi (130 μL) taze bir mikrosantrifüj tüpüne aktarın. 16 μL 10x ligasyon tamponu, 2 μL 10 mM dATP, 5 μL T4 DNA Polimeraz (15U) ve 7 μL ddH2O (toplam hacim 160 μL) ekleyin. 20 °C'de 30 dakika kuluçkaya yatır.
  2. 5 μL 10 mM dNTP, 4 μL 10x ligasyon tamponu, 5 μL T4 polinükleotid kinaz (10 U/μL), 1 μL Klenow ve 25 μL ddH 2 O (toplam hacim200μL) ekleyin. 20 °C'de 30 dakika kuluçkaya yatır.

10. Boyut seçimi

  1. Parçaları çoğunlukla 250-550 bp boyut aralığında seçmek için, önce 0,6x ile sıralı katı faz geri dönüşümlü hareketsizleştirme (SPRI) boyut seçimi, ardından üreticinin talimatlarına göre 0,90x gerçekleştirin ve 100 μL TLE kullanarak DNA'yı ayıklayın.

11. Biotin çekme/ A-tailing / adaptör ligasyonu

NOT: Manyetik boncukları girdaplayarak yeniden oluşturarak yıkamaları gerçekleştirin, numuneleri dönen bir tekerlek üzerinde 3 dakika döndürün ve ardından numuneyi kısa bir süre aşağı döndürün ve manyetik standa yerleştirin. Boncukların mıknatısa yapışmasına izin verin, üst saltant atın ve aşağıdaki yıkama adımına devam edin. Yıkamaları 55 °C'de dönen tekerlek yerine dönme ile bir termo blok üzerinde gerçekleştirin.

  1. Çekme için TLE ile numune başına 300 μL'ye kadar son hacmi yaratın. Boncuk yıkama tamponlarını hazırlayın: 1x Ara Tampon (TB) (TB: 5 mM Tris-HCl pH 8.0, 0,5 mM EDTA, 1 M NaCl, %0,05 Ara), 0,5x TB, 1x Arasız Tampon (NTB) (5 mM Tris-HCl pH 8,0, 0,5 mM EDTA, 1 M NaCl), 2x NTB.
  2. Kütüphane başına 150 μL streptavidin bağlantılı manyetik boncuk kullanın (Bkz. Malzeme Tablosu). Boncukları 400 μL 1x TB ile 2x yıkayın. Daha sonra boncukları 300 μL 2x NTB'de yeniden ıslatır.
  3. Boncukları 300 μL Hi-C malzemesiyle karıştırın ve streptavidin boncuklarına biyotin bağlanmasına izin vermek için dönen bir tekerlek üzerinde 30 dakika RT'de kuluçkaya yatırın.
  4. Boncukları 400 μL 0,5x TB ile yıkayın ve 55 °C'de 3 dakika kuluçkaya yaslanın, 750 rpm'de döndürün. Boncukları 200 μL 1x kısıtlama tamponunda yıkayın.
  5. Boncukları 100 μL dATP kuyruk karışımında (5 μL 10 mM dATP, 10 μL 10x kısıtlama tamponu, 5 μL Klenow exo-ve 80 μL ddH2O) yeniden ıslatın. 37 °C'de 30 dakika kuluçkaya yatır.
  6. Süpernatantı çıkarın, boncukları 3 dakika boyunca 55 °C'de inkübe ederek ve 750 rpm'de döndürerek 400 μL 0,5x TB ile 2x yıkayın.
  7. Boncukları 400 μL 1x NTB ve ardından 100 μL 1x ligasyon tamponu ile yıkayın.
  8. Boncukları 50 μL 1x ligasyon tamponunda yeniden ıslatır ve süspansiyonu yeni bir tüpe aktarın. 4 μL önceden tavlanmış PE adaptörü (15 μM stok) ve 2 μL T4 ligase (400 U/μL, yani 800 U/tüp) ekleyin; RT'de 2 saat kuluçkaya yatır.
    NOT: Hem PE 1.0 hem de PE 2.0 adaptörlerinin (30 μM stok) eşit hacimlerini ekleyerek ve RT'de 10 dakika kuluçkaya yatırarak adaptörleri önceden tavlama (Bkz. Malzeme Tablosu).
  9. Süpernatantları çıkararak ve boncukları 400 μL TB ile 2x yıkayarak boncukları yeniden yakalayın. Boncukları 200 μL 1x NTB ile yıkayın, ardından 100 μL 1x kısıtlama tamponu ile yıkayın ve boncukları 40 μL 1x kısıtlama tamponunda yeniden diriltin.

12. PCR amplifikasyonu

  1. 5, 6, 7 ve 8 döngülü 25 μL hacimli PCR'leri ayarlayın. Her PCR için şunları kullanın:
    Reaksiyon Tarifi
    Hi-C boncuklar 2,5 μL
    10 μM PE PCR astar 1 (Malzeme Tablası) 0,75 μL
    10 μM PE PCR astar 2 (Malzeme Tablası) 0,75 μL
    10 mM dNTP 0,6 μL
    5x reaksiyon tamponu 5 μL
    DNA polimeraz 0,3 μL
    ddH2O 14,65 μL
    Toplam 25 μL
    Döngü Sıcaklık Saat
    1 98 °C 30 sn
    n döngüleri 98 °C 10 sn
    65 °C 30 sn
    72 °C 30 sn
    1 72 °C 7 dk

13. Son PCR amplifikasyonu

  1. Yukarıda açıklanan koşulları ve seçilen döngü sayısını kullanarak son PCR amplifikasyonu gerçekleştirin. Numuneyi 50 μL reaksiyonlarda şablon olarak 5 μL Hi-C boncuk kullanarak bölün.
  2. Tüm PCR reaksiyonlarını toplayın ve yeni bir tüpe aktarın. Streptavidin boncuklarını çıkarmak ve süpernatant (PCR ürünleri) kurtarmak için mıknatısı kullanın. Boncukları taze bir tüpe aktarın, boncukları adım 11.2.9'da belirtildiği gibi yıkayın ve yedek olarak 4 °C'de 1x kısıtlama tamponunda saklayın.
  3. Üreticinin talimatlarına göre SPRI boncuklarının hacminin 0,85 katını kullanarak PCR ürünlerini arındırın. 30 μL TLE tamponu ile elute.
  4. Hi-C kütüphanesini florometrik bir alet kullanarak ölçün ve çip bazlı kılcal elektroforez ile kütüphanenin kalitesini onaylayın.
  5. Son kalite kontrol noktası olarak, 12.1 adımında açıklanan koşulları kullanarak 10 döngü kullanarak PCR reaksiyonsu gerçekleştirmek için şablon olarak Hi-C kitaplığının 1 μL'sini kullanın. PCR ürününü iki mikrosantrifüj tüpüne bölün: birini Cla I ile sindirin ve diğerini kontrol olarak sindirilmemiş bırakın. Ürünleri% 1.5-2 agarose jelde çalıştırın (bkz. temsili sonuçlar).
  6. Uygun bir sıralama platformunda 50 bp veya 75 bp eşleştirilmiş uç sıralamaya geçin.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Aşağıda başarılı bir Hi-C protokolünün sonuçları açıklanmıştır (Şekil 1A'dakiHi-C protokolü iş akışının özetine bakın). Çekirdek içi Hi-C deneyi sırasında çeşitli kalite kontrol noktaları vardır. Örnek aliquots önce (UD) ve sonra (D) kromatin kısıtlama adımı yanı sıra ligasyon (L) sonra toplanmıştır. Çapraz bağlar tersine çevrildi ve DNA arındırıldı ve agarose jel üzerinde çalıştırıldı. Mbo I ile kısıtlama başarılı olduğunda 200-1000 bp'lik bir leke gözlendi (Şekil 1B). Molekülün beklenen boyutu, tercih eden kısıtlama enzimine bağlıdır. Ligasyon başarılı olursa, jelin üst kısmında yüksek moleküler ağırlık bandı görülmüştür (Şekil 1B). Sindirim verimliliği, protokolde ayrıntılı olarak açıklandığı gibi qPCR ile de doğrulanabilir. Kabul edilebilir bir sindirim verimliliği% 80 veya daha yüksektir (Şekil 1C).

Hi-C ligasyon verimliliğini ayrıntılı olarak değerlendirmek için primerler, astarların bitişik kısıtlama parçalarında ileri veya geri yönde olduğu dahili bir ligasyon ürün kontrolünü güçlendirmek için tasarlanabilir. Alternatif olarak, primerler bilinen etkileşimleri güçlendirmek için tasarlanabilir. Şekil 2A, Drosophila25'te bilinen bir orta menzilli (300 kb) etkileşimin amplifikasyonu göstermektedir. Hi-C ligasyon ürünleri (biotin işaretleme, doldurma ve ligasyonun başarıyla gerçekleştiği) amplifikasyonda geri kazanılan PCR ürününün sindirimi ile tahmin edilebilir. Doldurma ve ligasyondan sonra, Hi-C amplicons, orijinal Mbo I sitesinde, künt uçlu ligasyon üzerine korunan yeni bir Cla I kısıtlama alanı içerecektir. Cla I ile kısıtlama tamamlanmazsa, dolgu reaksiyonı ve biotin işareti verimsiz olacaktır. Sıralamadan sonra kütüphaneler için yararlı olmayan okumaların büyük bir oranına sahip olmamak için% 70'ten fazla bir sindirim verimliliği önerilir(Şekil 2A, 3C'nin Cla I sindirimini Hi-C şablonuna karşı karşılaştırın).

Son Hi-C kütüphanesini güçlendirmek için yeterli sayıda PCR amplifikasyon döngüsü belirlemek için, PROTOKOLDE açıklandığı gibi, boncuklar üzerinde belirli bir kütüphanenin 2,5 μL'si kullanılarak PCR reaksiyonları kuruldu. Son amplifikasyon için PCR döngülerinin sayısı, smear'ın görünür olduğu döngü sayısından bir döngü daha azdır (Şekil 2B). Bu durumda 4 adet PCR amplifikasyonu seçilmiştir. Son kalite kontrol noktası olarak, Hi-C kütüphanesinin bir aliquot'u Cla I ile yeniden güçlendirildi ve sindirildi. Kütüphanenin sindirim seviyesi (smear boyutunda bir azalma) geçerli Hi-C çiftlerinin bolluğunu gösterir ve kütüphaneden elde edilecek yararlı okumaların oranını yansıtır (Şekil 2C). Üst boyut aralığının bir oranı (UD örneğinde bulunan boyuta göre belirlenir) ve hem UD hem de D örneklerinde alt boyut aralığı, UD için 1 > bir oran ve Cla I sindirimi verimliyse sindirilen örnek için 1 ≤ bir oran üretmelidir.

Eşleştirilmiş uç sıralamadan sonra, FASTQ dosyaları (Tablo 1) HiCPro28 ve oluşturulan istatistikler MultiQC28kullanılarak çizildi. HiCPro'ya alternatif bir araç, benzer sonuçlar veren HiCUP30 ardışık düzenidir (gösterilmez). Şekil 3 ve Tablo 2 sıralı okumaların ayrıntılı istatistiksel bilgilerini gösterir. Kırpmadan sonra tam okuma hizalaması ve hizalama rapor edilir. Bu iki kategori, geçerli Hi-C çiftlerini bulmak için sonraki analizde kullanılacak başarıyla hizalanmış okumalara karşılık gelir. Hizalama sonrası kategorisi, ilk adımda hizalanmamış ve ligasyon sahasında 5' ekstremitelerini genom28'e yeniden düzenlemek için kırpılan ligasyon birleşimini kapsayan okumaları ifade eder (Şekil 3B, C ve Tablo 2). İletişim istatistikleri, Hi-C kütüphanesinin % 82,2 geçerli çiftler ve% 7,6 yararlı olmayan okumaların aynı parçalı öz daireye, aynı parça sarkan uçlara, yeniden ligasyona, filtrelenmiş çiftlere ve terk edilmiş çiftler kategorilerine (Şekil 3A, Şekil 3Dve Tablo 2)düşen yüksek kalitede olduğunu göstermektedir. Ayrıca, PCR çoğaltmalarının sayısı çok düşüktür, bu da kütüphane karmaşıklığının yüksek olduğunu ve PCR döngülerinin minimum yapıt getirdiğini gösterir (Şekil 3E ve Tablo 2).

Benzersiz geçerli Hi-C çiftleri kullanılarak, çift dağılımının temel analizi HiCPro27kullanılarak gerçekleştirildi. Bu deney% 46.5 benzersiz cis kontakları ≤ 20 kbp, % 47.1 benzersiz cis kontakları > 20 kbp ve% 5.8 benzersiz trans kontaklar (Şekil 3D) verdi. Cis'in trans geçerli çiftlere dağılımı, aynı kromozom içinde tespit edilen etkileşimlerin çoğuyla başarılı bir Hi-C deneyi için beklenen sonuçlara karşılık gelir. Trans kontakların yüksek bir oranı verimsiz fiksasyonu gösterir. HiCPro27'denHi-C geçerli çiftleri kullanılarak, matrisler yinelemeli düzeltme ve eigenvector ayrıştırma (ICE)30ile normalleştirildi ve HiCPlotter30 , 31,32kullanılarak 1 kb ve5kb çözünürlüklü matrisler oluşturuldu. Drosophila'daki Çentik gen lokusu için 1 kb ve 5 kb çözünürlükte normalleştirilmiş kontak matrisleri sunulmuştur (Şekil 4A, Şekil 4Cve Şekil 4D). Şekil 4A'da Çentik gen çekirgesi AP'ler, etki alanı l ve II ile birlikte ve lokus boyunca histone modifikasyonları ile birlikte görülebilir ( Şekil 4A ve Tablo 1). CRISPR-Cas9 silme tasarımı CTCF ve M1BP(Şekil 4B)motifini içeriyordu.

Çentik lokusun 5' sınırında hem CTCF hem de M1BP DNA bağlayıcı bölgeleri içeren bölgenin silinmesi üzerine (5pN-delta343, Tablo 1), Çentik lokusu içindeki etkileşimlerin kaybı ve yukarı akış TAD ile temasların vahşi tipe (WT) göre kazanılmasıyla kromatin kontaklarında çarpıcı bir değişiklik gözlenebilir(Şekil 4C,D). Son olarak, Şekil 4E, Çentik geni 5' UTR'den kısıtlama parçası düzeyinde WT ve mutant etkileşim profillerinin ayrıntılı bir panoramasını gösterir ve Çentik gen çekirgesi ile yapılan temasların oranında bir azalma ve yukarı akış alanı ile temaslarda bir artış gösterir. Çentik geni 5' UTR'nin sanal 4C görünümleri HiC-Pro27kullanılarak elde edildi. Alternatif bir araç, SeqMonk'ta (SeqMonk (RRID:SCR_001913) http:www.bioinformatics.babraham.ac.uk/projects/seqmonk/ adresinde bulunan Hi-C diğer uçlar nicelemesidir. Şekil 4'te sunulan tüm sonuçlar Arzate-Mejía ve ark.25tarafından açıklandığı gibi WT ve mutant S2R + Drosophila hücrelerinde çekirdek içi Hi-C protokolü uygulanarak elde edilmiştir.

Figure 1
Şekil 1: Çekirdek içi Hi-C sindirim ve ligasyon kontrolleri. (A) Hi-C protokolüne genel bakış. Hücreler formaldehit ile çapraz bağlanır ve kromatin segmentleri (DNA parçaları: pembe, mor) ve proteinler arasında katvalent bağlantılara neden olur. Kromatin bir kısıtlama enzimi ile sindirilir (makasla temsil edilir), bu örnekte, Mbo I. Elde edilen yapışkan uçlar, biyotinillenmiş bir dATP (Koyu mavi daireler) dahil olmak üzere nükleotitlerle doldurulur. DNA saflaştırılmıştır ve biyotinilasyonlu kavşaklar streptavidin kaplı manyetik boncuklar (gri daireler) kullanılarak zenginleştirilir. Etkileşime giren parçalar, yeni nesil, eşleştirilmiş uç sıralama ile tanımlanır. (B) İki biyolojik kopya için Hi-C sindirim ve ligasyon kalite kontrolleri (Hi-C 1 ve Hi-C 2). Hi-C kütüphaneleri %1,5 agarose jel üzerinde çözümlendi. Her ikisi de sindirilmiş, D, kütüphaneler 600 bp civarında bir leke olarak çalışır. Liglenmiş numuneler, Lig, sindirilmemiş UD örneklerine benzer şekilde 10 kb'den daha büyük oldukça sıkı bir bant olarak çalışır. Sinyal gücündeki farklılıklar jel üzerindeki düzensiz miktarda yüklü DNA'dan kaynaklanmaktadır. (C) Hi-C sindirim nicel kontrolü ile nicel polimeraz zincir reaksiyonu ile aynı iki biyolojik yineleme için (B) (Hi-C 1 ve Hi-C 2) ile çevrim eşik değerlerini protokolde ayrıntılı olarak açıklanmıştır. Başarılı bir sindirim% 80 kısıtlama ≥. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 2
Şekil 2: Çekirdek içi Hi-C dolgu ve künt uçlu ligasyon kontrolleri. (A) Dolgu ve biotin etiketleme değerlendirmesi. Kromozom X'te 300 kb aralıklarla bulunan parçalar arasındaki bilinen bir etkileşim kontrol olarak kullanıldı ve siyah oklarla belirtilen astarlar kullanılarak yükseltildi (şemanın üst kısmına bakın (B), astar 1 (sol), astar 2 (sağ), Tablo 1), 347 bp amplicon üretti. Hi-C ligasyon ürünleri, ligasyon bölgesinin sindirimi ile 3C deneyde üretilenlerden ayırt edilebilir. Hi-C kavşakları, orijinal Mbo I sahasında Cla I tarafından sindirildi, çünkü bu künt uçlu ligasyon üzerine oluştu. Hi-C ve 3C kavşakları, kısıtlama bölgesi ligasyon (jelin solunda) üzerine yenilendikçe Mbo I ile sindirildi. Buna karşılık, 3C kavşakları Mbo I sitesinde Cla I tarafından sindirilmedi, ancak sadece Mbo I. Cla I kullanarak Hi-C ve 3C ürünlerinin sindirim profilini karşılaştırın. Hi-C ürünü sindirilerek 53 bp'lik bir parça elde edildi (Mbo I sitesinde oluşturulan Cla I sitesinin kısıtlanması ve bölgede zaten mevcut olan bir Cla I sitesinin kısıtlanması nedeniyle). Bu parça 3C ürün sindiriminde gözlenmedi, çünkü mevcut tek Cla I sitesi bölgede zaten mevcut olan siteydi. (B) Hi-C kütüphanesinin farklı PCR döngüleri kullanılarak PCR amplifikasyonu yapıldıktan sonra, ürünler% 1.5 agarose jel üzerinde çalıştırıldı. 400-1000 bp'lik bir smear bekleniyordu ve gözlendi. Son amplifikasyon PCR için uygun sayı döngüleri, bir smear'ın sadece göründüğünden hemen daha düşük bir sayı olarak alınmalıdır. (C) Son kütüphane Cla I sindirim. Son kütüphanenin bir aliquot'u Cla I ile yeniden güçlendirildi ve sindirildi. Smear'ın boyut küçültme, kütüphanedeki moleküllerin büyük bir kısmının geçerli Hi-C çiftleri olduğunu doğruladı. Bu jelin densitometrik analizi, temsili sonuçlar bölümünde ayrıntılı olarak belirtildiği gibi, BM ve D örnekleri arasında bir oran elde etmek için yapılabilir. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 3
Şekil 3: Hi-C kütüphanesinin HiC-Pro istatistikleri. (A) Geçerli Hi-C çiftlerinin şematik gösterimi ve deney sırasında üretilebilen ve HiCPro27 (Tablo2 ) tarafından filtrelenebilen farklı geçerli olmayan çiftler. Bunlar bitişik sıralara düşen okumaları, sarkan uçları, aynı parçayı, kendi kendine daireyi, yeniden ligasyonları ve PCR yinelemelerini içerir. (B) Haritalama istatistikleri. Hizalanamayan okumalar gösterilir (gri) ve kırpmadan sonra hizalanmış hem tamamen hizalanmış okumalar hem de okumalar sırasıyla mavi ve açık mavi renkte gösterilir. Bu iki kategori, sonraki analizlerde dikkate alınılan yararlı okumaları temsil eder. (C) Eşleştirme istatistikleri. Çok Hizalı okumalar (koyu turuncu), genomdaki birden çok bölgede hizalanmış okumaları temsil eder. Benzersiz Hizalanmış (koyu mavi) okumalar, genomda bir kez hizalanan okuma çiftlerini temsil eder ve singletonlar (açık turuncu), her iki okumada da yalnızca bir genomik bölgenin sıralı olduğu okuma çiftlerini temsil eder. (D) İstatistikleri filtreleme. Geçerli okuma çiftleri (mavi),(A)bölümünde açıklandığı gibi başarılı Hi-C ligasyon ürünlerini temsil eder. Kendinden parçalı öz çevreler (açık pembe),(A)içinde gösterilen aynı genomik parçayı temsil ettikleri için yararlı olmayan okumalardır. Aynı parça sarkan uçlar (turuncu), tek bir kısıtlama parçasının sıralandığı okumaları temsil eder. Filtrelenmiş ve dökülmüş çiftler (kahverengi) de yanlış boyuta sahip veya ligasyon ürününün yeniden yapılandırılamadığı yararlı olmayan okumalardır. Son olarak, yeniden ligasyon okumaları (kırmızı), bitişik iki parçanın yeniden lige alındığı okumaları temsil eder, böylece yararlı olmayan bilgiler üretir. (E) Geçerli okuma, genomdaki temas dağılımını eşleştirır. Benzersiz cis kontakları (mavi), benzersiz trans kontaktlardan (yeşil) daha sıktır. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 4
Şekil 4: Hi-C kontak matrisleri ve WT ve mutant S2R+ hücrelerinin sanal 4C analizi. (A) Çentik gen lokusu merkezli 1 kb çözünürlükte 50 kb'lık bir bölgenin Hi-C normalleştirilmiş ısı haritası. Çekirge için TAD ayırma puanı32, Çentik çekirgesinin iki topolojik etki alanına bölünmesiyle birlikte gösterilir (Etki Alanı 1 ve Etki Alanı 2). ISı haritası (Tablo 1)altında34, 35 , 36,37 S2/S2R+ hücreleri için ASP, RNA Pol II ve histone işaretleri için CHIP-seq verileri gösterilmiştir. Çentik etki alanı 1 sınırlarının konumları açık yeşil renkte vurgulanır. (B) B1 sınırı CRISPR mutantının şematik gösterimi. Yeşil dikdörtgen silinen 343 bp bölgesini gösterir. Makas, CRISPR aracılı genom düzenleme için kullanılan sgRNA'ları gösterir. APs için motif bağlama siteleri CTCF ve M1BP kutuları olarak gösterilir. (A)ile gösterilen DNA bağlayıcı APs için zirve zirveleri de35. (C) Hi-C, WT ve mutant hücreler için Çentik merkezli 50 kb'lık bir bölgeyi kapsayan 1 kb çözünürlükte ısı eşlemlerini normalleştirdi. Sol, Log2'nin Hi-C ısı haritaları WT ve mutant hücreler arasındaki etkileşim frekansında farklılıklar. (D) WT ve mutant hücreler için 5 kb çözünürlükte Çentik merkezli 250 kb'lık bir bölgeyi kapsayan Hi-C normalleştirilmiş ısı eşlemleri. Sol, Log2'nin Hi-C ısı haritaları WT ve mutant hücreler arasındaki etkileşim frekansında farklılıklar. (E) Görüş noktası olarak Çentiğin 5' UTR'sını kullanan WT ve mutant hücreler için Sanal-4C. Hem WT hem de mutant hücreler için yukarı akış kirredomain-2, Çentik etki alanı 1, Çentik etki alanı 2 ve aşağı akış dnc etki alanı içindeki bakış açısı ve bölgeler arasındaki etkileşimlerin yüzdeleri25gösterilir. Kısaltmalar: WT = vahşi tip; TAD = topolojik olarak ilişkili etki alanı; CHIP = kromatin immünprecipitasyonu; AP = mimari protein; RNA Pol = RNA polimeraz; S2R+ = S2 reseptör artı; sg RNA = tek kılavuz RNA; UTR = çevrilmemiş bölge. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Deney Örnek GEO Katılım numarası
Yonga CP190 GSM1015404
Yonga SuHW GSM1015406
Yonga Mod(mdg4) GSM1015408
Yonga CTCF GSM1015410
Yonga Ibf1 GSM1133264
Yonga Ibf2 GSM1133265
Yonga BEAF32 GSM1278639
Yonga Pide GSM1313420
Yonga ZIPIC GSM1313421
Yonga RNA PolII GSM2259975
Yonga H3K4me1 GSM2259983
Yonga H3K4me3 GSM2259985
Yonga H3K27ac GSM2259987
Yonga MSL2 GSM2469507
Yonga H4K16ac GSM2469508
Yonga M1BP GSM2706055
Yonga GAF GSM2860390
Yonga Girdi GSM1015412
Hi-C S2R+ WT hücreleri GSE136137
Hi-C S2R+ 5pN-delta343 hücreleri GSE136137

Tablo 1: GEO katılım numaraları.

HiC-Pro istatistikleri Okur Yüzde
İstatistikleri Eşleme
Tam okuma Hizalamaları 131515921 82.20%
Kırpılmış okuma Hizalamaları 16408309 10.30%
Hizalanamadı 12110964 7.60%
İstatistikleri Eşleştirme
Benzersiz Hizalanmış 79428455 50.90%
Singleton 19063418 12.20%
Çok Hizalı 57700021 36.90%
İstatistiklere Filtre Uygulanıyor
Geçerli Çiftler 71373989 90.12%
Aynı Parça: Kendi kendine daire 2340697 2.90%
Aynı Parça: Sarkan Uçlar 2578783 3.20%
Filtre Uygulanmış Çiftler 2773043 3.50%
Terk edilmiş çiftler 196565 0.20%
İlgili Kişi İstatistikleri
Benzersiz: cis ≤ 20 kbp 33108815 46.50%
Benzersiz: cis > 20 kbp 33539888 47.10%
Benzersiz: trans 4133602 5.80%
Yinelenen okuma çiftleri 398400 0.60%

Tablo 2: HiC-Pro istatistikleri.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Burada sunulan çekirdek içi Hi-C yöntemi, Drosophila genom topolojisinin yüksek çözünürlükte ayrıntılı olarak araştırılmasına izin verdi, farklı genomik ölçeklerdeki genomik etkileşimlerin bir görünümünü sağladı, organizatörler ve arttırıcılar gibi düzenleyici elementler arasındaki kromatin döngülerinden TAD'lere ve büyük bölmetanımlamasına 25. Aynı teknoloji bazı değişikliklerle memeli dokularına da verimli bir şekilde uygulanmıştır33. Örneğin, tek hücreli süspansiyon yerine bir doku işlenirken, doku 70 μm'lik bir filtreden elenir ve lizis adımı bir Dounce homojenizatör kullanılarak malzeme homojenizatörize edilirken gerçekleştirilir. Ek olarak, memeli genom drosophila genomdan 25 kat daha büyük olduğundan, 1-5 kb çözünürlüklü matrisler oluşturmak için gereken geçerli okuma çiftlerinin sayısı daha fazladır. Çekirdek içi Hi-C yöntemi, ligasyondan önce 65 °C'de% 1 SDS ile nükleer lizizden kaçınmasında orijinal Hi-C yöntemi2'den farklıdır, böylece nükleer bütünlüğü korur ve 7 mL yerine 1 mL'de ligleşerek23,24.

Protokolde yüksek verimlilik sağlamak için bazı önemli adımlar vardır. Sindirim ve dolgu verimsizliklerini ortaya çıkarabilecek ilk adım% 0.3 SDS permeabilizasyonu ve yüzey aktif tedavileri sırasında küme oluşumudur. Kümeler büyükse ve bozulması zorsa, SDS ve yüzey aktif madde tedavileri sırasında dönme hızı 400 rpm'ye düşürilmelidir. Kümeler pipetleme ile ayrılması zor kalırsa, permeabilizasyona devam etmeden önce kısıtlama arabelleği, SDS ve iyonik olmayan yüzey aktif madde ile birimler ayarlanarak örnek ikiye bölünmelidir. Daha sonra, çekirdek minimum hızda santrifüjlenmelidir (200 × g),süpernatan dikkatlice atılmalıdır ve numuneler sindirime devam etmeden önce 450 μL 1x kısıtlama tamponunda bir araya getirilmelidir. İkincisi, sindirim verimliliğinin tahmini, doldurma ve ligasyon için yeterli DNA parçası sağlamak için önemlidir. Nitel değerlendirme üzerine, sindirimin verimsiz olduğu tespit edilirse, kısıtlama enzimi ile 4 saat ila bir gece arasında değişen bir süre için ikinci bir sindirim turu yapılmalıdır.

Üçüncüsü, ligasyon verimliliğinin tahmini önemlidir. Nitel değerlendirme sonucunda ligasyonun verimsiz olduğu tespit edilirse (yani, yüksek moleküler ağırlık bandı yerine, sindirilen örnek için gözlenene benzer bir leke gözlenir), çekirdek 200 × g'da santrifüj edilerek ve taze 10x ligasyon tamponu ve ligase kullanılarak ligasyon karışımında yeniden canlandırılarak ligasyon tekrarlanmalıdır. Dördüncü olarak, Hi-C geçerli ürünlerin yüzdesi, Cla I ile beklenen bir etkileşimin PCR amplicon'u sindirilerek tahmin edilmelidir (Mbo I orijinal sindirim için). Beklenen etkileşimin ampliconunun verimli amplifikasyonu ve sindirimi, Hi-C bağlantılarının başarılı bir şekilde ligasyonunu ve oluşumunu doğrular. Amplicon sindirimi verimli değilse, moleküllerin çoğunluğu Hi-C ürünleri yerine 3C olacaktır ve kütüphane sıralanacaksa bu dikkate alınmalıdır. Bu, temsili sonuçlar bölümünde açıklandığı gibi son kütüphane Cla I sindirim kontrolü yapılarak da doğrulanabilir. Son olarak, PCR çoğaltmalarını önlemek için daha düşük sayıda PCR döngüsünün seçilmesi önemlidir. Sıralama sırasında, okuma çifti yinelemelerinin yüzdesinin yüksek olduğu tespit edilirse, PCR döngülerinin sayısı daha da azaltılmalıdır.

Bu çekirdek içi Hi-C tekniğinin bazı sınırlamaları vardır. İlk olarak, burada açıklanan protokol bir hücre popülasyonu için gerçekleştirilen Hi-C deneyini temsil eder. Bu nedenle, genomik temasların frekansının sinyali, değişken bireysel konformasyonlara sahip milyonlarca genomun sinyalini temsil eder. Genomik temas kümesini tek bir genomdan elde etmek için tek hücreli hi-cdeneyi 22 önerilir. İkincisi, Hi-C proksimal DNA parçalarının ligasyonuna dayanmaktadır. Bu nedenle, genomik bölgeler büyük bir protein kromatin kompleksinin bir parçasıysa, parçalar arasındaki mesafe ligasyonu engelleyebilir. Örneğin, trans kontakların Hi-C38'de kötü temsil edildiği gösterilmiştir. Ayrıca, Hi-C eşleştirilmiş uç dizilimi ile bitirir, böylece genomik kontak çiftlerini geri verir. Bununla birlikte, aynı kromatin kompleksinde aynı anda birkaç DNA parçası etkileşime girebilir. Bir kromatin kompleksinde birden fazla DNA parçasının kimliğini elde etmek için, Hi-C39'aalternatif dizileme yöntemleri uygulanabilir veya ligasyonun gerçekleştirilmediği farklı deneysel stratejiler kullanılabilir38,40,41. Son olarak, Hi-C genomik temasları ölçse de, etkileşimlere aracılık eden proteinlerin kimliğini ortaya koymaktadır. Belirli bir ilgi proteini42'nin aracılık ettiği genomik etkileşimleri veya belirli genomik elementlerdeki protein topluluğunun kimliğini tanımlamak için alternatif yöntemler uygulanmalıdır43.

Sonuç olarak, Drosophila genomunda(Tablo 2)açıklanan yüksek kaliteli bir Hi-C deneyi ile matrisler çok çeşitli çözünürlüklerde inşa edilebilir (1, 5 kb, 50 kb veya daha düşük; bkz. Şekil 4). Ek olarak, genomun belirli bir bölgesinin kısıtlama parçası düzeyinde değerlendirilmesi gerekiyorsa, veriler istenen bakış açısının sanal bir 4C manzarasını oluşturmak için kullanılabilir (örneğin, Şekil 4E'deki Çentik geni 5' UTR). SeqMonk'taki Hi-C diğer uçlar aracı, bu manzaranın görselleştirilmesini sağlayan çok kullanıcı dostu bir seçenektir. SeqMonk'un bir parçası olan 4C niceleme aracının bu manzaraya uygulanması istatistiksel olarak anlamlı temaslar sağlayabilir.

Burada açıklanan çekirdek içi Hi-C deneyinin TAD sınırlarında değiştirilmiş AP DNA bağlayıcı bölgelere sahip mutant hücre hatları koleksiyonuna uygulanması (Şekil 4), Drosophila genomunun etki alanlarında yapılandırılması ve Arzate-Mejía vd.25tarafından tam olarak tartışıldığı gibi gen ekspresyon düzenlemesini sürdürmek için sınırlarda genetik elementlere ihtiyaç duyulduğunu ortaya koydu. Bu nedenle, CRISPR/Cas9 sistemi ile düzenleyici elementlerin genetik olarak düzenlenmesi, burada açıklanan çekirdek içi Hi-C protokolünü kullanarak genomik etkileşimlerin yüksek çözünürlüklü profilleme ile birlikte, genetik elementlerin yapısal işlevini test etmek için güçlü bir strateji olabilir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar rakip çıkarlar beyan etmemektedir.

Acknowledgments

Bu çalışma UNAM Teknoloji Yenilik ve Araştırma Destek Programı (PAPIIT) hibe numarası IN207319 ve Bilim ve Teknoloji Ulusal Konseyi (CONACyT-FORDECyT) hibe numarası 303068 tarafından desteklendi. A.E.-L. Bilim ve Teknoloji Ulusal Konseyi (CONACyT) CVU numarası 968128 tarafından desteklenen bir yüksek lisans öğrencisidir.

Materials

Name Company Catalog Number Comments
16% (vol/vol) paraformaldehyde solution Agar Scientific R1026
Biotin-14-dATP Invitrogen CA1524-016
ClaI enzyme NEB R0197S
COVARIS Ultrasonicator Covaris LE220-M220
Cut Smart NEB B72002S
Dulbecco's Modified Eagle Medium (DMEM) 1x Life Technologies 41965-039
Dynabeads MyOne Streptabidin C1 Invitrogen 65002
Fetal bovine serum (FBS) sterile filtered Sigma F9665
Klenow Dna PolI large fragment NEB M0210L
Klenow exo(-) NEB M0210S
Ligation Buffer NEB B020S
MboI enzyme NEB R0147M
NP40-Igepal SIGMA CA-420 Non-ionic surfactant for addition in lysis buffer
PE adapter 1.0 Illumina 5'-P-GATCGGAAGAGCGGTTCAGCAG
GAATGCCGAG-3'
PE adapter 2.0 Illumina 5'-ACACTCTTTCCCTACACGACGCT
CTTCCGATCT-3'
PE PCR primer 1.0 Illumina 5'-AATGATACGGCGACCACCGAGAT
CTACACTCTTTCCCTACACGACG
CTCTTCCGATCT-3'
PE PCR primer 2.0 Illumina 5'-CAAGCAGAAGACGGCATACGAG
ATCGGTCTCGGCATTCCTGCTGA
ACCGCTCTTCCGATCT-3'
Phenol: Chloroform:Isoamyl Alcohol 25:24:1 SIGMA P2069
Primer 1 (known interaction, Figure 2A) Sigma 5'-TCGCGGTAATTTTGCGTTTGA-3'
Primer 2 (known interactions, Figure 2A) Sigma 5'-CCTCCCTGCCAAAACGTTTT-3'
Protease inhibitor cocktail tablet Roche 4693132001
Proteinase K Roche 3115879001
Qubit ThermoFisher Q33327
RNAse Roche 10109142001
SPRI Beads Beckman B23318
T4 DNA ligase Invitrogen 15224-025
T4 DNA polymerase NEB M0203S
T4 polynucleotide kinase (PNK)  NEB M0201L
TaqPhusion NEB M0530S DNA polymerase
Triton X-100 Non-ionic surfactant for quenching of SDS

DOWNLOAD MATERIALS LIST

References

  1. Cremer, T., Cremer, C. Chromosome territories, nuclear architecture and gene regulation in mammalian cells. Nature Review Genetics. 2, 292-301 (2001).
  2. Lieberman-Aiden, E., et al. Comprehensive mapping of long-range interactions reveals folding principles of the human genome. Science. 326, 289-293 (2009).
  3. Dixon, J. R., et al. Topological domains in mammalian genomes identified by analysis of chromatin interactions. Nature. 485, 376-380 (2012).
  4. Sexton, T., et al. Three-dimensional folding and functional organization principles of the Drosophila genome. Cell. 148, (3), 458-472 (2012).
  5. Dixon, J. R., Gorkin, D. U., Ren, B. Chromatin domains: the unit of chromosome organization. Molecular Cell. 62, 668-680 (2016).
  6. Bonev, B., Cavalli, G. Organization and function of the 3D genome. Nature Reviews Genetics. 17, 661-678 (2016).
  7. Lupiáñez, D. G., Spielmann, M., Mundlos, S. Breaking TADs: how alterations of chromatin domains result in disease. Trends in Genetics. 32, 225-237 (2016).
  8. Phillips, J. E., Corces, V. G. CTCF: master weaver of the genome. Cell. 137, (7), 1194-1211 (2009).
  9. Hong, S., Kim, D. Computational characterization of chromatin domain boundary-associated genomic elements. Nucleic Acids Research. 45, 10403-10414 (2017).
  10. Zuin, J., et al. Cohesin and CTCF differentially affect chromatin architecture and gene expression in human cells. Proceedings of the National Academy of Sciences of the United States of America. 111, (3), 996-1001 (2014).
  11. Guo, Y., et al. CRISPR inversion of CTCF sites alters genome topology and enhancer/promoter function. Cell. 162, 900-910 (2015).
  12. Lupiáñez, D. G., et al. Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions. Cell. 161, 1012-1025 (2015).
  13. Van-Steensel, B., Furlong, E. E. M. The role of transcription in shaping the spatial organization of the genome. Nature Reviews Molecular Cell Biology. 20, 327-337 (2019).
  14. Merkenschlager, M., Nora, E. P. CTCF and cohesin in genome folding and transcriptional gene regulation. Annual Review of Genomics and Human Genetics. 17, (1), 17-43 (2016).
  15. Hansen, A. S., Pustova, I., Cattoglio, C., Tjian, R., Darzacq, X. CTCF and cohesin regulate chromatin loop stability with distinct dynamics. Elife. 6, 1-10 (2017).
  16. Van Bortle, K., et al. Insulator function and topological domain border strength scale with architectural protein occupancy. Genome Biology. 15, 82 (2014).
  17. Ramírez, F., et al. High-resolution TADs reveal DNA sequences underlying genome organization in flies. Nature Communications. 9, 189 (2018).
  18. Ulianov, S. V., et al. Active chromatin and transcription play a key role in chromosome partitioning into topologically associating domains. Genome Research. 26, 70-84 (2016).
  19. Rowley, M. J., et al. Evolutionarily conserved principles predict 3D chromatin organization. Molecular Cell. 67, 837-852 (2017).
  20. Gavrilov, A. A., Golov, A. K., Razin, S. V. Actual ligation frequencies in the chromosome conformation capture procedure. PLoS One. 8, 60403 (2013).
  21. Gavrilov, A. A., et al. Disclosure of a structural milieu for the proximity ligation reveals the elusive nature of an active chromatin hub. Nucleic Acids Research. 41, 3563-3575 (2013).
  22. Nagano, T., et al. Single-cell Hi-C reveals cell-to-cell variability in chromosome structure. Nature. 502, 59-64 (2013).
  23. Rao, S. S. P., et al. A 3D map of the human genome at kilobase resolution reveals principles of chromatin looping. Cell. 159, (7), 1665-1680 (2014).
  24. Nagano, T., et al. Comparison of Hi-C results using in-solution versus in-nucleus ligation. Genome Biology. 16, 175 (2015).
  25. Arzate-Mejía, R., et al. In situ dissection of domain boundaries affect genome topology and gene transcription in Drosophila. Nature Communications. 11, 894 (2020).
  26. Schoenfelder, S., et al. Promoter capture Hi-C: high-resolution, genome-wide profiling of promoter interactions. Journal of Visualized Experiments. (136), e57320 (2018).
  27. Servant, N., et al. HiC-Pro: an optimized and flexible pipeline for Hi-C processing. Genome Biology. 16, 259 (2015).
  28. Philip, E., Måns, M., Sverker, L., Max, K. MultiQC: Summarize analysis results for multiple tools and samples in a single report. Bioinformatics. 10, 1093 (2016).
  29. Wingett, S., et al. HiCUP: pipeline for mapping and processing Hi-C data. F1000 Research. 4, 1310 (2015).
  30. Imakaev, M., et al. Iterative correction of Hi-C data reveals hallmarks of chromosome organization. Nature Methods. 9, (10), 999-1003 (2012).
  31. Akdemir, K. C., Chin, L. HiCPlotter integrates genomic data with interaction matrices. Genome Biolog. 16, 198 (2015).
  32. Ramirez, F., et al. High-resolution TADs reveal DNA sequences underlying genome organization in flies. Nature Communications. 9, 189 (2018).
  33. Ando-Kuri, M., et al. The global and promoter-centric 3D genome organization temporally resolved during a circadian cycle. bioRxiv. (2020).
  34. Cuellar-Partida, G., et al. Epigenetic priors for identifying active transcription factor binding sites. Bioinformatics. 28, (1), 56-62 (2012).
  35. Zhang, Y., et al. Model-based analysis of ChIP-Seq (MACS). Genome Biology. 9, 137 (2008).
  36. Ong, C. -T., et al. Poly(ADP-ribosyl)ation regulates insulator function and intrachromosomal interactions in Drosophila. Cell. 155, (1), 148-159 (2013).
  37. Fresán, U., et al. The insulator protein CTCF regulates Drosophila steroidogenesis. Biology Open. 4, (7), 852-857 (2015).
  38. Quinodoz, S., et al. RNA promotes the formation of spatial compartments in the nucleus. Cell. 174, 744-757 (2018).
  39. Olivares-Chauvet, P., et al. Capturing pairwise and multi-way chromosomal conformations using chromosomal walks. Nature. 540, (7632), 296-300 (2016).
  40. Beagrie, R., et al. Complex multi-enhancer contacts captured by genome architecture mapping. Nature. 543, 519-524 (2017).
  41. Redolfi, J., et al. DamC reveals principles of chromatin folding in vivo without crosslinking and ligation. Nature Structural and Molecular Biology. 26, 471-480 (2019).
  42. Maxwell, R., et al. HiChIP: efficient and sensitive analysis of protein-directed genome architecture. Nature Methods. 13, 919-922 (2016).
  43. Gao, X., et al. C-BERST: Defining subnuclear proteomic landscapes at genomic elements with dCas9-APEX2. Nature Methods. 15, (6), 433-436 (2018).
Drosophila Hücrelerinde Çekirdek içi Hi-C
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Esquivel-López, A., Arzate-Mejía, R., Pérez-Molina, R., Furlan-Magaril, M. In-Nucleus Hi-C in Drosophila Cells. J. Vis. Exp. (175), e62106, doi:10.3791/62106 (2021).More

Esquivel-López, A., Arzate-Mejía, R., Pérez-Molina, R., Furlan-Magaril, M. In-Nucleus Hi-C in Drosophila Cells. J. Vis. Exp. (175), e62106, doi:10.3791/62106 (2021).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter