Determining the Role of Maternally-Expressed Genes in Early Development with Maternal Crispants

Summary

Early development is dependent on maternally-inherited products, and the role of many of these products is currently unknown. Herein, we described a protocol that uses CRISPR-Cas9 to identify maternal-effect phenotypes in a single generation.

Abstract

Early development depends on a pool of maternal factors incorporated into the mature oocyte during oogenesis that perform all cellular functions necessary for development until zygotic genome activation. Typically, genetic targeting of these maternal factors requires an additional generation to identify maternal-effect phenotypes, hindering the ability to determine the role of maternally-expressed genes during development. The discovery of the biallelic editing capabilities of CRISPR-Cas9 has allowed screening of embryonic phenotypes in somatic tissues of injected embryos or "crispants," augmenting the understanding of the role zygotically-expressed genes play in developmental programs. This article describes a protocol that is an extension of the crispant method. In this method, the biallelic editing of germ cells allows for the isolation of a maternal-effect phenotype in a single generation, or "maternal crispants." Multiplexing guide RNAs to a single target promotes the efficient production of maternal crispants, while sequence analysis of maternal crispant haploids provides a simple method to corroborate genetic lesions that produce a maternal-effect phenotype. The use of maternal crispants supports the rapid identification of essential maternally-expressed genes, thus facilitating the understanding of early development.

Introduction

A pool of maternally deposited products (e.g., RNAs, proteins, and other biomolecules) is necessary for all early cellular processes until the embryo's zygotic genome is activated¹. The premature depletion of these products from the oocyte is typically embryonic lethal. Despite the importance of these genes in development, the role of many maternally-expressed genes is currently unknown. Advancement in gene-editing technology in zebrafish, such as CRISPR-Cas9, enables the targeting of maternally-expressed genes^2,3,4. However, the identification of a maternal-effect phenotype requires an extra generation when compared to a zygotic phenotype, thus requiring more resources. Recently, the biallelic editing capability of CRISPR-Cas9 has been used to screen for embryonic phenotypes in somatic tissues of injected (F0) embryos, known as "crispants"^5,6,7,8,9,10. The crispant technique permits resource-efficient screening of candidate genes in somatic cells, facilitating understanding of specific aspects in development. The protocol described in this paper allows for the identification of maternal-effect phenotypes, or "maternal crispants," in a single generation¹¹. This scheme is attainable by multiplexing guide RNAs to a single gene and promoting biallelic editing events in the germline. These maternal crispant embryos can be identified by gross morphological phenotypes and undergo primary characterization, such as labeling for cell boundaries and DNA patterning¹¹. Combined analysis of the observable phenotype and basic molecular characterization of the induced INDELs allows for the prediction of the targeted gene's role in early development.

In zebrafish, during the first 24 h post-fertilization (hpf), a small group of cells develops into the primordial germ cells, a precursor to the germline^12,13,14,15. In clutches laid by F0 females, the proportion of maternal crispant embryos recovered depends on how many germ cells contain a biallelic editing event in the targeted gene. In general, the earlier the editing event occurs in the embryo, the higher the probability of CRISPR-Cas9 mutations being observed in the germline. In most cases, the phenotypes of maternal crispant embryos come from the loss of function in the two maternal alleles present in the developing oocyte. As the oocyte finishes meiosis, one of the maternal alleles is extruded from the embryo via the polar body, while the other allele becomes incorporated into the maternal pronucleus. The sequencing of multiple maternal crispant haploids will represent a mixture of the mutations (insertions and/or deletions (INDELs)) present in the germline that contribute to the phenotype¹¹.

The following protocol describes the necessary steps to create CRISPR-Cas9 mutations in maternal-effect genes and identify the corresponding phenotype using a maternal crispant approach (Figure 1). Section one will explain how to effectively design and create guide RNAs, while sections two and three contain critical steps for creating maternal crispants by microinjection. After injecting the CRISPR-Cas9 mixture, injected embryos are screened for somatic edits via PCR (section four). Once the injected F0 embryos develop and reach sexual maturity, the F0 females are crossed to wild-type males, and their offspring are screened for maternal-effect phenotypes (section five). Section six includes instructions on making maternal crispant haploids that can be combined with Sanger sequencing to identify the CRISPR-Cas9-induced INDELs. In addition, the Discussion contains modifications that can be made to the protocol to increase the sensitivity and power of this method.

Protocol

In studies leading to the development of this protocol, all zebrafish housing and experiments were approved by the University of Wisconsin-Madison Institutional Animal Care and Use Committee (IACUC-M005268-R2).

1. Synthesis of Guide RNAs

NOTE: Zygotic crispants have been created using a single guide RNA or multiplexing multiple guide RNAs to a single target^5,6,7,8,9,10. The multiplexing of guide RNAs increases the percentage of embryos showing a zygotic crispant phenotype¹⁰. Due to this increased frequency of embryos exhibiting a phenotype, maternal crispants are created by multiplexing four guide RNAs to a single gene. A more detailed protocol on using CHOPCHOP to design guide RNAs and an annealing method to synthesize guide RNAs for zebrafish can be found elsewhere^{16,17,18,19,20}.

1. To identify a maternally-expressed gene to target, ascertain the mRNA transcript levels during development via an RNA-sequence database that provides transcriptome information from zygote to 5 days²¹. In general, maternal-specific genes are highly expressed in the early embryo and are degraded after the zygotic genome is activated²².
2. Once a maternally-expressed target gene has been identified, determine the first predicted protein domain using the "domains and features" section available on the Ensembl genome browser²³. Use this domain as the target region for the four guide RNAs.
3. Use the guide RNA selection program CHOPCHOP to identify four guide RNA target sites in the first active domain. Design gene-specific oligonucleotides, as shown below for each target site. In the gene-specific oligonucleotide, the N²⁰ section corresponds to the target sequence minus the PAM site (NGG) from CHOPCHOP. Order these gene-specific oligonucleotides and the constant oligonucleotide using standard desalt purification (see Table of Materials).
   Gene-specific oligonucleotide:
   5' TAATACGACTCACTATA- N²⁰ -GTTTTAGAGCTAGAAATAGCAAG 3'
4. To create a guide RNA template for each gene-specific oligonucleotide, anneal it to the constant oligonucleotide and fill in the overhangs with T4-DNA polymerase as previously described¹⁶. After the four guide RNA templates are assembled, purify and concentrate them together using a DNA clean-up and concentrator kit according to the manufacturer's instructions (see Table of Materials).
5. Synthesize the sgRNA mixture from the pooled guide RNA template using an in-vitro T7 transcription kit (see Table of Materials). Perform the in-vitro transcription according to the manufacturer's instructions. Using half-reactions of the T7 Transcription kit can decrease the cost per reaction.
6. After RNA synthesis, purify the resulting pool of sgRNAs using an ethanol/ammonium acetate protocol as previously described^16,20,24. After the RNA has been isolated, resuspend it in 20 µL of nuclease-free water. If half-reactions of the T7 Transcription kit were used to transcribe the pool of sgRNAs, resuspend the purified RNA into 10-15 µL of nuclease-free water.
7. Quantify the amount of pooled sgRNAs that were created using a spectrophotometer. Dilute the pool of sgRNAs in nuclease-free water to a dilution of 1500 ng/µL ± 500 ng/µL. Typically, the final volume of the working dilution ranges from 30-50 µL.
8. After determining the concentration of the pool of sgRNAs, verify the integrity of the sgRNAs on a 1% agarose gel.
   1. Cast a 1% agarose/0.5 µg/mL ethidium bromide/TBE gel. Once the gel has solidified, place it in TBE running buffer.
   2. Mix 1 µL of the sgRNA mixture and 1 µL of RNA gel loading buffer (see Table of Materials). Load this sample in the gel and run the gel at 100 V for 5 min.
9. Visualize the bands using ultraviolet (UV) light. The pool of sgRNAs should appear as a single band. If a smear is observed, RNA degradation has likely occurred.
10. Store the pool of sgRNAs in single-use 1 µL aliquots in nuclease-free PCR strip tubes in the -80 °C freezer. For large volumes of sgRNAs mixture (30 µL or more), aliquot half of the volume into the nuclease-free PCR strip tubes and store the other half as a larger volume in a nuclease-free microcentrifuge tube. Thaw out and aliquot when needed.
11. To prevent RNA degradation, ensure that the samples in the microcentrifuge tube undergo no more than two freeze-thaw cycles.

2. Preparing reagents and materials for microinjection

NOTE: In zebrafish, the injection of Cas9 mRNA can create zygotic crispants. However, studies have shown that Cas9 protein is more efficient in creating INDELs in injected embryos^16,25. This protocol uses Cas9 protein to generate maternal crispants because this protein does not experience the same lag in activity as injected Cas9 mRNA. In theory, this should increase the probability of a biallelic mutation early in development resulting in an increased chance of a more extensive section of the germline being affected. Other protocols and resources detailing how to prepare for microinjections can be found elsewhere^24,26.

1. Purchase or generate Cas9 protein (see Table of Materials). Resuspend the Cas9 protein in nuclease-free water to make a 2 mg/mL solution and aliquot 1 µL into RNase-free polypropylene microcentrifuge tubes. Store these as single-use tubes at -80 °C.
2. The afternoon before the injection, use a micropipette puller to pull a glass capillary and create an injection needle. Store the unbroken needle in an enclosed needle holder until the morning of microinjections.
3. To create an injection plate, pour 20 mL of 1.5% agarose/sterile H₂O to fill half of a 100 mm X 15 mm Petri dish and wait for it to solidify. Once the agarose solution is set, add 20 mL of 1.5% agarose/sterile H₂O to the Petri dish and place the plastic mold (see Table of Materials) into the liquid agarose and allow it to harden.
4. After the agarose has hardened, remove the plastic mold and store the injection plate upside down in a refrigerator until the morning of injections. A single plate can be used for multiple injections as long as the wells maintain their integrity.

3. Microinjection of CRISPR-Cas9 cocktail into a one-cell zebrafish embryo to generate maternal crispants

NOTE: More resources for microinjection into zebrafish embryos can be found elsewhere^24,26,27. Injecting the CRISPR-Cas9 mixture into the developing blastodisc of one-cell embryos may increase the probability of creating maternal crispants. The mixture can also be injected into the yolk sac up to the 2-cell stage. However, mixtures injected into the yolk depend on ooplasmic streaming to reach the blastodisc, so CRISPR-Cas9 injected into the yolk could decrease the cutting efficiency of the CRISPR-Cas9²⁸.

1. The afternoon before microinjections, set up wild-type crosses in zebrafish mating boxes. Keep both the male and female fish in the same tank but separate them with a mating box divider or place the female inside an egg-laying insert.
2. On the morning of the experiment, take out one 2 mg/mL aliquot of Cas9 protein and one aliquot of the pool of sgRNAs. In the RNase-free polypropylene microcentrifuge tube that contains the Cas9 protein, assemble a 5 µL injection mixture that includes the pool of sgRNAs, 1 µL of 0.5% phenol red solution, and nuclease-free water. Aim for a final concentration of 400 ng/µL Cas9 protein and 200 ng/µL of the pooled sgRNAs in RNase-free water or a 2:1 ratio of Cas9 protein to sgRNAs in the injected embryo. This injection mixture can be stored on ice for the morning of the injection.
3. Remove an injection plate from the refrigerator and let it warm up to room temperature (RT) for at least 20 min.
4. After the injection cocktail is assembled, allow the male and female to mate, e.g., by removing the mating box divider or by placing the male in the same egg-laying insert as the female, as appropriate.
5. After the fish have laid but before the embryos have been collected, cut the tip of an unbroken needle using a new razor blade or fine forceps to create a needle that has a bore small enough to avoid embryo damage but is wide enough so that it will not become clogged with injection mixture. After the needle has been cut, load the needle with the injection mixture using a microloader pipette tip inserted into the back end of the capillary (see Tables of Materials).
6. After the needle is filled, incubate the needle for 5 min at RT to assemble Cas9-sgRNA complexes.
7. Turn the microinjector on and insert the needle into the micromanipulator. Place a drop of mineral oil onto a micrometer slide and calibrate the needle by adjusting the injection pressure until the needle ejects a 1 nL bolus into the mineral oil.
   NOTE: When injecting into the mineral oil, a 1 nL bolus will have a diameter of approximately 0.125 mm (or radius of 0.062 mm) as measured with the micrometer slide.
8. To synchronize the embryos, collect them after 10 min using a plastic strainer and rinse them into a Petri dish using 1x E3 media (5 mM NaCl, 0.17 mM KCl, 0.33 mM CaCl₂, 0.33 mM MgSO₄, and add 20 µL of 0.03 M Methylene Blue per 1 L of 1x E3). Remove 10-15 embryos and place them into a separate Petri dish to be kept as uninjected controls.
9. Transfer the rest of the developing embryos into the wells of the injection plate.
10. Inject 1 nL of solution (a total of 400 pg of Cas9 protein and 200 pg of sgRNAs) into the developing blastodisc of a one-cell embryo. If the tip of the needle becomes clogged, use forceps to break the tip back and recalibrate the needle to eject a 1 nL bolus. Ensure to inject all embryos during the first 40 min of development after fertilization.
11. After the injection is completed, return the injected embryos into a labeled Petri dish that contains 1x E3 media and allow them to develop throughout the day. Remove any embryos that are unfertilized or are not developing normally according to the zebrafish staging series²⁹.

4. Screening for somatic INDELs in F0 injected embryos

NOTE: Other methods for identifying INDELs, such as T7 endonuclease I assay or high-resolution melting analysis, can be used when determining if the embryos contain somatic INDELs ³⁰.

1. The next day after injections, remove defective and lysed embryos from the Petri dish and replace the 1x E3 media to maintain embryo health.
2. After cleaning out the dish, collect six healthy injected embryos and two control embryos from the uninjected plate. Place each embryo individually into a single well of a PCR strip tube and label the top of the tubes.
3. To extract the genomic DNA of individual embryos, remove the excess E3 media from the wells of the strip tube and add 100 µL of 50 mM NaOH per well.
4. Incubate the embryos at 95 °C for 20 min. Then cool the samples down to 4 °C, add 10 µL of 1 M Tris HCL (pH 7.5), and vortex them for 5 to 10 s. This extracted DNA can be stored at -20 °C for at least 6 months without significant DNA degradation.
5. Design unique screening primers for each guide site to amplify a 100-110 bp DNA fragment that includes the CRISPR-Cas9 target site. If possible, place the target site in the middle of the amplified fragment, allowing for the identifications of larger deletions.
6. For each of the four guide target sites, set up eight 25 µL PCR reactions using 5 µL of the prepared single-embryo genomic DNA, PCR mix, and the guide-specific screening primers to identify somatic mutations in the target site (Table 1).
7. Cast a 2.5% agarose/0.5 µg/mL ethidium bromide/TBE gel using combs that create approximately 0.625 cm wide wells. This wide comb allows for better resolution when detecting size changes to the genomic sequence. After the gel has solidified, place it into an electrophoresis chamber that contains TBE running buffer.
8. Add 5 µL of 6x loading dye to the PCR product and load 25 µL of this mixture into the gel. Make sure that the injected and control samples are run on the same row of the gel. After all the samples are loaded, add 5 µL of ethidium bromide per 1 L of TBE running buffer to the positive end of the gel box.
9. Run the gel at 120 V until the DNA bands resolve or the DNA has approached the end of the lane. If the Cas9 created INDELs in the target site, a smear is typically observed in injected samples but not the controls.
10. If smears are observed in a minimum of three out of the four guide sites in embryos injected with four guide RNAs, grow up the sibling injected embryos.
11. Whenever the injected samples do not contain smears in the required number of guide sites, design new guide RNAs to replace those that did not work and create a new pool of guide RNAs that includes the ones that worked and the newly designed ones. Inject and test the new pool for somatic INDELs as described above.

5. Identification of maternal-effect phenotypes in maternal crispant embryos

NOTE: Once the injected F0 females have reached sexual maturity, their germline cells have the potential to generate a mixture of maternal crispant and wild-type embryos. Even though this mixture allows for internal controls for fertilization and developmental timing, it is still beneficial to set up a wild-type incross as an external control in case a clutch from F0 female contains only maternal crispant embryos.

1. The afternoon before the experiment, set up the F0 injected females against wild-type males and control wild-type crosses in standard zebrafish mating boxes. Place both the male and female fish in the same tank but separate them with a mating box divider or place the female inside an egg-laying insert.
2. On the morning of the experiment, allow the male and female to start mating, e.g., by removing the mating box divider or placing the male in the same egg-laying insert as the female.
3. Collect the embryos every 10 min by moving the egg-laying insert into a new mating tank bottom that contains fresh system water and label the tank with a tag identifying the individual F0 female. Take the old mating tank and pour the water through a tea strainer to collect the embryos from one individual 10-min clutch.
4. Once the embryos from a single 10-min clutch have been collected in the strainer, transfer them to a Petri dish containing 1x E3 media. Label the Petri dish with the time of collection and the fish information.
5. Under a dissecting microscope with a transmitted light source, observe the embryos undergoing development every hour for the first 6-8 h and daily for the next 5 days.
6. Identify potential maternal crispant embryos by gross morphological changes in their development compared to time-matched wild-type controls²⁹.
7. Move the potential maternal crispant embryos to a Petri dish that contains 1x E3 media and assay for morphological phenotype at 24 hpf and viability (e.g., swim bladder inflation) at 5 days post fertilization.

6. Sequencing alleles in maternal crispant haploids

NOTE: Maternal crispant haploids contain a single allele in the targeted locus, allowing for the identification of INDELs in the target gene via Sanger sequencing. Maternal crispant haploids embryos can also be analyzed using next-generation sequencing assays. Embryos that show a maternal crispant phenotype are expected to carry a lesion in at least one of the four target sites (See Discussion).

1. The afternoon before the experiment, set up mating pairs of F0 females known to produce maternal crispant embryos crossed to wild-type males. Keep the wild-type males physically separated from the females using a mating box divider or place the female in the egg-laying insert.
2. On the morning of the experiment, remove the physical partition or place both the males and females within the egg-laying insert to initiate mating. At the first sign of egg-laying, interrupt breeding by separating the male and F0 females. Keep each separated F0 female in individual mating boxes.
3. Prepare UV-treated sperm solution using testes from one wild-type male for every 100 µL of Hank's solution (Table 2), sufficient to fertilize extruded eggs from one female, as previously described³¹.
4. Manually extrude mature eggs from the pre-selected F0 females and perform in vitro fertilization (IVF) using the UV-treated sperm³¹.
5. After in vitro fertilization, allow the haploid embryos to develop until the maternal crispant phenotype is observed and place those embryos into a different Petri dish.
6. Once the maternal crispant haploid embryos have been identified, allow them to develop for at least 6 h post-fertilization.
7. To extract the genomic DNA from at least ten maternal crispant haploid embryos, place a single haploid embryo into an individual well of a PCR strip tube, remove excess E3 media from the well and add 50 µL of 50 mM NaOH.
8. Incubate the embryos at 95 °C for 20 min. Then cool the samples down to 4 °C, add 5 µL of 1 M Tris HCL (pH 7.5), and vortex for 5-10 s. The extracted DNA can be stored at -20 °C for up to 6 months.
9. To identify which guide sites contain INDELs, design sequencing primers to amplify a DNA fragment that includes all four CRISPR-Cas9 target sites. These sequencing primers allow for the identification of INDELs that span multiple guide sites.
10. Set up two 25 µL PCR reactions per embryo using 5 µL of the prepared genomic DNA and the sequencing primers.
11. After the PCR is finished, purify and concentrate the two samples using a DNA clean-up and concentrator kit (see Table of Materials). Then submit the DNA fragment to Sanger sequencing using both the forward and reverse sequencing primers.
12. After the haploid maternal crispant fragment has been sequenced, align it to the wild-type sequence and identify INDELs in the target sites using a sequence alignment program.

Results

The experimental approach described in this protocol allows for the identification of maternal effect phenotypes in a rapid, resource-efficient manner (Figure 1).

Generating maternal crispants:
When designing the four guide RNAs to target a single candidate maternal-effect gene, special consideration should be given to where the guide RNAs will bind to DNA. In general, they should all be clustered together with minimal to no overlapping region...

Discussion

The protocol presented in this manuscript allows for the identification and primary molecular characterization of a maternal-effect phenotype in a single generation instead of the multiple generations required for both forward and reverse genetic techniques. Currently, the role of many maternally expressed genes is unknown. This lack of knowledge is partly due to the extra generation required to visualize a phenotype when identifying maternal-effect genes. In the past, the rapid identification of maternal-effect genes in...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
1 M Tris-HCl (pH 8.4)	Invirogen	15568025	For PCR mix
1.5 mL Eppendorf Tubes	Any Maker
10 mM dNTPs	Thermo Fischer Scientific	18427013	Synthesis of gRNA
100 BP ladder	Any Maker		For gel electrophoresis
100% RNAse free ethanol	Any Maker
100% RNAse free ethanol	Any Maker
100ml Beaker	Any Maker		For IVF
5 M Ammonium Accetate	Thermo Fischer Scientific	Found in the MEGAshortscript T7 Transcription Kit	Synthesis of gRNA
70% Ethanol			Synthesis of gRNA (70 mL of ethanol + 30 mL of  nuclease free water)
Borosil 1.0 mm OD x 0.5 mm ID	FHC INC	27-30-1	for Microinjection
Bulk Pharma Sodium Bicarbonate 35 pounds	Bulk Reef Supply	255	Fish supplies
CaCl2	MiliporeSigma	C7902
Cas9 Protein with NLS	PNABio	CP01
ChopChop			https://chopchop.cbu.uib.no/
Constant oligonucleotide	Integrated DNA Technologies (IDT)		AAAAGCACCGACTCGGTGCCAC TTTTTCAAGTTGATAACGGACTA GCCTTATTTTAACTTGCTATTTC TAGCTCTAAAAC
Depression Glass Plate	Thermo Fischer Scientific	13-748B	For IVF
Dissecting Forceps	Dumont	SS	For IVF
Dissecting Scissors	Fine Science Tools	14091-09	For IVF
Dissecting Steroscope( with transmitted light source)	Any Maker		For IVF
DNA Clean & Concentrator -5	Zymo Research	D4014	Synthesis of gRNA
DNA Gel Loading Dye (6x)	Any Maker		For gel electrophoresis
EconoTaq DNA Polymerase	Lucigen	30032-1	For PCR mix
Electropheresis Power Supply	Any Maker		For gel electrophoresis
Ensemble			https://useast.ensembl.org/index.html
Eppendorf Femtotips Microloader Tips for Femtojet Microinjector	Thermo Fischer Scientific	E5242956003	for Microinjection
Ethanol (200 proof, nuclease-free)	Any Maker
FemtoJet 4i	Eppendorf	5252000021	for Microinjection
Fish Net	Any Maker		Fish supplies
Frozen Brine Shrimp	Brine Shrimp Direct		Fish supplies
General All Purpose Agarose	Any Maker		For gel electrophoresis
Gene-Specific oligonucleotide	Integrated DNA Technologies (IDT)		TAATACGACTCACTATA- N20 -GTTTTAGAGCTAGAAATAGCAAG
Gloves	Any Maker
Ice Bucket	Any Maker
Instant Ocean salt	Any Maker		Fish supplies
Invitrogen UltraPure Ethidium Bromide, 10 mg/mL	Thermo Fischer Scientific	15-585-011
KCl	MiliporeSigma	P5405
KH2PO4	MiliporeSigma	7778-77-0
Kimwipes	Thermo Fischer Scientific	06-666
Male & Female zebrafish
MEGAshortscript T7 Transcription Kit	Thermo Fischer Scientific	AM1354	Synthesis of gRNA
Methylene Blue	Thermo Fischer Scientific	AC414240250	For E3
MgCl2	MiliporeSigma	7791-18-6	For PCR mix
MgSO2·7H2O	MiliporeSigma	M2773
Microinjection plastic mold	World Precision Instruments	Z-Molds	for Microinjection
Micromanipulator	Any Maker		for Microinjection
Micropipeters	Any Maker
Micropipette Puller	Sutter	P-87	for Microinjection
Micropipetter tips with filters (all sizes)	Any Maker
Micropippetter tips without filters ( all sizes)	Any Maker
Microwave	Any Maker
Mineral Oil	MiliporeSigma	m5904-5ml	for Microinjection
MS-222 ( Tricaine-D)	Any Maker		FDA approved
Na2HPO4	MiliporeSigma	S3264
NaCl	MiliporeSigma	S5886
NaHC03	MiliporeSigma	S5761
Nanodrop	Any Maker
NaOH	MiliporeSigma	567530
Nonstick, RNase-free Microfuge Tubes, 1.5 mL	Ambion	AM12450	Synthesis of gRNA
nuclease-free water	Any Maker
Paper Towel	Any Maker
Pastro Pipettes	Any Maker
PCR Strip Tubes	Any Maker
Petri Plates 100 mm diameter	Any Maker
Phenol Red solution	MiliporeSigma	P0290	for Microinjection
Plastic Pestals	VWR	47747-358	For IVF
Plastic Spoon	Any Maker		For IVF
Premium Grade Brine Shrimp Eggs	Brine Shrimp Direct		Fine Mesh
RNA Gel Loading Dye		found in MEGAshortscript T7 Transcription Kit	For gel electrophoresis
RNAse AWAY	Thermo Fischer Scientific	21-402-178
Scale	Any Maker
Sharpie	Any Maker
Spatula	Any Maker
Sterile H2O	Any Maker		For PCR mix
T4 DNA Polymerase	NEB	M0203	Synthesis of gRNA
Tape	Any Maker
TBE (Tris-Borate-EDTA) 10x	Any Maker		For gel electrophoresis
Tea Stainer	Amazon	IMU-71133W	Fish supplies
Thermo Scientific Owl 12-Tooth Comb, 1.0/1.5 mm Thick, Double Sided for B2	Thermo Fischer Scientific	B2-12	For gel electrophoresis
Thermo Scientific Owl EasyCast B2 Mini Gel Electrophoresis Systems	Thermo Fischer Scientific	09-528-110B	For gel electrophoresis
Thermocycler	Any Maker
Thermocycler	Any Maker
Transilluminator	Any Maker
UV lamp	UVP	Model XX-15 (Cat NO. UVP18006201)	For IVF
UV safety glasses	Any Maker		For IVF
Wash Bottle	Thermo Fischer Scientific	S39015	Fish supplies
Zebrafish mating boxes	Aqua Schwarz	SpawningBox1	Fish supplies
1.5ml Eppendorf Tubes	Fisher Scientific	05-402-11
10 Molar dNTPs	Thermo Fischer Scientific	18427013
100 BP ladder	Thermo Fischer Scientific	15628019
100% RNAse free ethanol	any maker
5m Ammonium Accetate	Thermo Fischer Scientific
70% Ethanol			70ml ethanol and 30 ml of nuclease free water
Accessories for Horizontal Gel Box	Fisher Scientific		0.625 mm
Agarose	any maker
CaCl2	Sigma	10043-52-4
CaCl2, dihydrate	Sigma	10035-04-8	E3 Medium
Capillary Tubing	Cole-Parmer	UX-03010-68	for injection needles
Cas9 Protein	Thermo Fischer Scientific	A36496
ChopChop	https://chopchop.cbu.uib.no/
Computer	any maker
Dissecting Forcepts	any maker
Dissecting Microscope	any maker
Dissecting Scissors	any maker
DNA Clean & Concentrator -5	Zymo Research	D4014
DNA Gel Loading Dye (6X)	Thermo Fischer Scientific	R0611
EconoTaq DNA Polymerase	Lucigen	30032-1
Ensemble	https://useast.ensembl.org/index.html
Eppendorf Microloader PipetteTips	Fischer Scientific	10289651	20 microliters
Ethanol (200 proof, nuclease-free)	any maker
Ethidium Bromide	Thermo Fischer Scientific	15585011
Fish Net	any maker		fine mesh
Frozen Brine Shrimp	LiveAquaria	CD-12018	fish food
Gel Comb (0.625mm)	any maker
Gel Electropheresis System	any maker
Gene-Specific oligonucleotide	Integrated DNA Technologies (IDT)
Glass Capilary Needle	Grainger	21TZ99	https://www.grainger.com/product/21TZ99?ef_id=Cj0KCQjw8Ia GBhCHARIsAGIRRYpqsyA3-LUXbpZVq7thnRbroBqQTbrZ_a88 VVcI964LtOC6SFLz4ZYaAhZzEAL w_wcB:G:s&s_kwcid=AL!2966!3! 264955916096!!!g!438976 780705!&gucid=N:N:PS:Paid :GGL:CSM-2295:4P7A1P:20501 231&gclid=Cj0KCQjw8IaGBh CHARIsAGIRRYpqsyA3-LUXbp ZVq7thnRbroBqQTbrZ_a88VVcI 964LtOC6SFLz4ZYaAhZzEALw _wcB&gclsrc=aw.ds
Glass Dishes	any maker
Gloves	any maker
Hank's Final Working Solution			Combine 9.9 ml of Hank's Premix with 0.1 ml HS Stock #6
Hank's Premix			combine the following in order: (1) 10.0 ml HS #1, (2) 1.0 ml HS#2, (3) 1.0 ml HS#4, (4) 86 ml ddH2O, (5) 1.0 ml HS#5. Store all HS Solotions at 4C
Hanks Solution
Hank's Solution			https://www.jove.com/pdf-materials/51708/jove-materials-51708-production-of-haploid-zebrafish-embryos-by-in-vitro-fertilization
Hank's Stock Solution #1			8.0 g NaCl, 0.4 g KCl in 100 ml ddH2O
Hank's Stock Solution #2			0.358 g Na2HPO4 anhydrous; 0.60 g K2H2PO4 in 100 ml ddH2O
Hank's Stock Solution #4			0.72 g CaCl2 in 50 ml ddH2O
Hank's Stock Solution #5			1.23 g MgSO47H2O in 50 ml ddH20
Hank's Stock Solution #6			0.35g NaHCO3 in 10.0 ml ddH20; make fresh day of use
HCl	Sigma	7647-01-0
Ice Bucket	any maker
Instant Ocean salt	any maker		for fish water
In-Vitro Transcription Kit Mega Short Script	Thermo Fischer Scientific	AM1354
Invitrogen™ UltraPure™ DNase/RNase-Free Distilled Water	Fisher Scientific	10-977-023
KCl	Sigma	7447-40-7	E3 Medium
KH2PO4	Sigma	7778-77-0
Kimwipes	Fisher Scientific	06-666
Male and Female zebrafish
Mega Short Script T7 Transciption Kit	Thermo Fischer Scientific	AM1354
methylene blue	Fisher Scientific	AC414240250	E3 Medium
MgSO2-7H2O	Sigma	M2773
Microimicromanipulator
Microinjection plastic mold	World Precision Instruments	Z-Molds
Microinjector
Microneedle Slide
Micropipeter (1-10) with tips	any maker		need filtered p10 tips
Micropipetter (20-200) with tips	any maker
Micropippetter (100-1000) with tips	any maker
Microplastic slide
Microwave	any maker
MiliQ Water	any maker
mineral oil	sigma-aldrich	m5904-5ml
Na2HPO4	Sigma
NaCl	Sigma	S9888
NaHC02	Sigma	223441
Nanodrop
NaOH	Sigma	567530
Narrow Spatula	any maker
Needle Puller	Sutter	P-97
Paper Towel	any maker
Pastro Pipettes	Fisher Scientific	13-678-20A
PCR primer flanking guide site	Integrated DNA Technologies (IDT)
PCR primers flanking guide RNA cut site	Integrated DNA Technologies (IDT)		Standard desalted
PCR Strip Tubes	Thermo Fischer Scientific	AB0771W
Petri Dishes	Fisher Scientific	FB0875714	10 cm diameter 100mm x 15mm
Phenol Red	Fisher Science	S25464	https://www.fishersci.com/shop/products/phenol-red-indicator-solution-0-02-w-v-2/S25464
Pipette Tips	any maker		10ul, 200ul and 1000ul tips
Plastic Pestals	Fisher Scientific	12-141-364
Plastic Spoon	any maker
Primer Guide Site	Integrated DNA Technologies (IDT)
Razor Blade	Uline	H-595B
RNA gel Loading Dye	in megashort script kit(in vitro transciption kit)
RNAse away	Fisher	21-402-178
RNAse free polypropylene microcentrifuge tubes	Thermo Fischer Scientific	AM12400	https://www.thermofisher.com/order/catalog/product/AM12400#/AM12400
RNAse free water	Fisher Scientific	10-977-023
Scale	any maker
Sharpie	any maker
Sodium bicarbonate (cell culture tested)	Sigma	S5761	fish water
Sodium Bromide Solotion	Sigma	E1510
Software for sanger sequencing Analysis
Spectrophotometer
Sterlie H2O	any brand
T4 DNA Polymerase	NEB	M0203S	https://www.neb.com/products/m0203-t4-dna-polymerase#Product%20Information
Tape	any brand
TBE (Tris-Borate-EDTA) 10X	Thermo Fischer Scientific	B52	https://www.thermofisher.com/order/catalog/product/B52#/B52
Tea Stainer	amazon	IMU-71133W	avaible in most kitchen stores
Thermocycler
Transfer Pipette	Uline	S-24320
Transilluminator
Tricaine	fisher scientific	NC0872873
Tris HCl 7.5	Thermo Fischer Scientific	15567027
Universal Primer	Integrated DNA Technologies (IDT)		AAAAGCACCGACTCGGTGCCAC TTTTTCAAGTTGATAACGGACTAG CCTTATTTTAACTTGCTATTTCTA GCTCTAAAAC
UV lamp	UVP
UV safety glasses	any maker
Wash Bottle	fisher scientific	S39015
Zebrafish mating boxes	any maker
PCR Buffer Recipe	Add 171.12mL sterile H20; 0.393 mL 1M MgCl2; 2.616mL 1M MgCl2; 2.618 mL 1M Tris-HCl (pH 8.4) 13.092mL 1M KCl; 0.262 mL 1% Gelatin. Autoclave for 20 minutes then chill the solotion on ice. Next add 3.468 mL 100mg/mL BSA; 0.262 mL dATP (100mM), 0.262mL dCTP (100mM); 0.262 mL dGTP (100mM);  0.262 mL dTTP (100mL). Alliquote into sterile eppendorf tubes