Déterminer le rôle des gènes exprimés par la mère dans le développement précoce des croustillants maternels
Summary
Le développement précoce dépend des produits hérités de la mère, et le rôle de bon nombre de ces produits est actuellement inconnu. Ici, nous avons décrit un protocole qui utilise CRISPR-Cas9 pour identifier les phénotypes d’effet maternel en une seule génération.
Abstract
Le développement précoce dépend d’un ensemble de facteurs maternels incorporés dans l’ovocyte mature au cours de l’oogenèse qui remplissent toutes les fonctions cellulaires nécessaires au développement jusqu’à l’activation du génome zygotique. En règle générale, le ciblage génétique de ces facteurs maternels nécessite une génération supplémentaire pour identifier les phénotypes d’effet maternel, ce qui entrave la capacité de déterminer le rôle des gènes exprimés par la mère au cours du développement. La découverte des capacités d’édition biallélique de CRISPR-Cas9 a permis le criblage de phénotypes embryonnaires dans les tissus somatiques d’embryons injectés ou de « crispants », augmentant ainsi la compréhension du rôle que jouent les gènes exprimés zygotiquement dans les programmes de développement. Cet article décrit un protocole qui est une extension de la méthode crispant. Dans cette méthode, l’édition biallélique des cellules germinales permet d’isoler un phénotype d’effet maternel en une seule génération, ou « crispants maternels ». Le multiplexage des ARN guides vers une seule cible favorise la production efficace de crispants maternels, tandis que l’analyse de séquence des haploïdes maternels crispants fournit une méthode simple pour corroborer les lésions génétiques qui produisent un phénotype d’effet maternel. L’utilisation de crispants maternels favorise l’identification rapide des gènes essentiels exprimés par la mère, facilitant ainsi la compréhension du développement précoce.
Introduction
Un pool de produits déposés par la mère (par exemple, ARN, protéines et autres biomolécules) est nécessaire pour tous les processus cellulaires précoces jusqu’à ce que le génome zygotique de l’embryon soit activé1. L’épuisement prématuré de ces produits de l’ovocyte est généralement létal embryonnaire. Malgré l’importance de ces gènes dans le développement, le rôle de nombreux gènes exprimés par la mère est actuellement inconnu. Les progrès de la technologie d’édition de gènes chez le poisson zèbre, tels que CRISPR-Cas9, permettent de cibler les gènes exprimés par la mère 2,3,4. Cependant, l’identification d’un phénotype d’effet maternel nécessite une génération supplémentaire par rapport à un phénotype zygotique, nécessitant ainsi plus de ressources. Récemment, la capacité d’édition biallélique de CRISPR-Cas9 a été utilisée pour dépister les phénotypes embryonnaires dans les tissus somatiques d’embryons injectés (F0), connus sous le nom de « crispants »5,6,7,8,9,10. La technique de crispant permet un criblage efficace des gènes candidats dans les cellules somatiques, facilitant ainsi la compréhension des aspects spécifiques du développement. Le protocole décrit dans cet article permet d’identifier les phénotypes de l’effet maternel, ou « crispants maternels », en une seule génération11. Ce schéma est réalisable en multiplexant les ARN guides vers un seul gène et en favorisant les événements d’édition bialléliques dans la lignée germinale. Ces embryons maternels crispants peuvent être identifiés par des phénotypes morphologiques macroscopiques et faire l’objet d’une caractérisation primaire, telle que l’étiquetage des limites cellulaires et la structuration de l’ADN11. L’analyse combinée du phénotype observable et la caractérisation moléculaire de base des INDEL induites permettent de prédire le rôle du gène ciblé dans le développement précoce.
Chez le poisson zèbre, au cours des premières 24 heures post-fécondation (HPF), un petit groupe de cellules se développe dans les cellules germinales primordiales, un précurseur de la lignée germinale12,13,14,15. Dans les couvées pondues par les femelles F0, la proportion d’embryons maternels crispants récupérés dépend du nombre de cellules germinales contenant un événement d’édition biallélique dans le gène ciblé. En général, plus l’événement d’édition se produit tôt dans l’embryon, plus la probabilité que des mutations CRISPR-Cas9 soient observées dans la lignée germinale est élevée. Dans la plupart des cas, les phénotypes des embryons maternels crispants proviennent de la perte de fonction des deux allèles maternels présents dans l’ovocyte en développement. Lorsque l’ovocyte termine la méiose, l’un des allèles maternels est extrudé de l’embryon via le corps polaire, tandis que l’autre allèle est incorporé dans le pronucleus maternel. Le séquençage de multiples haploïdes maternels crispants représentera un mélange des mutations (insertions et/ou délétions (INDEL)) présentes dans la lignée germinale qui contribuent au phénotype11.
Le protocole suivant décrit les étapes nécessaires pour créer des mutations CRISPR-Cas9 dans les gènes de l’effet maternel et identifier le phénotype correspondant à l’aide d’une approche de crispant maternel (Figure 1). La première section expliquera comment concevoir et créer efficacement des ARN guides, tandis que les sections deux et trois contiennent des étapes critiques pour la création de crispants maternels par micro-injection. Après l’injection du mélange CRISPR-Cas9, les embryons injectés sont examinés pour les modifications somatiques par PCR (section quatre). Une fois que les embryons F0 injectés se développent et atteignent la maturité sexuelle, les femelles F0 sont croisées avec des mâles de type sauvage, et leur progéniture est examinée pour les phénotypes d’effet maternel (section cinq). La section six comprend des instructions sur la fabrication d’haploïdes maternels crispants qui peuvent être combinés avec le séquençage de Sanger pour identifier les INDEL induites par CRISPR-Cas9. En outre, la discussion contient des modifications qui peuvent être apportées au protocole pour augmenter la sensibilité et la puissance de cette méthode.
Protocol
Representative Results
Discussion
Le protocole présenté dans ce manuscrit permet l’identification et la caractérisation moléculaire primaire d’un phénotype d’effet maternel en une seule génération au lieu des générations multiples requises pour les techniques génétiques directes et inverses. Actuellement, le rôle de nombreux gènes exprimés par la mère est inconnu. Ce manque de connaissances est en partie dû à la génération supplémentaire nécessaire pour visualiser un phénotype lors de l’identification des gènes de l’effet…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Nous remercions les membres passés et actuels du personnel d’élevage du laboratoire Pelegri pour les soins qu’ils ont prodigués à l’installation aquatique. Nous sommes également reconnaissants pour les commentaires et la perspicacité sur le manuscrit par Ryan Trevena et Diane Hanson. Le financement a été fourni par la subvention des NIH à F.P. (GM065303)
Materials
| 1 M Tris-HCl (pH 8.4) | Invirogen | 15568025 | For PCR mix |
| 1.5 mL Eppendorf Tubes | Any Maker | ||
| 10 mM dNTPs | Thermo Fischer Scientific | 18427013 | Synthesis of gRNA |
| 100 BP ladder | Any Maker | For gel electrophoresis | |
| 100% RNAse free ethanol | Any Maker | ||
| 100% RNAse free ethanol | Any Maker | ||
| 100ml Beaker | Any Maker | For IVF | |
| 5 M Ammonium Accetate | Thermo Fischer Scientific | Found in the MEGAshortscript T7 Transcription Kit | Synthesis of gRNA |
| 70% Ethanol | Synthesis of gRNA (70 mL of ethanol + 30 mL of nuclease free water) | ||
| Borosil 1.0 mm OD x 0.5 mm ID | FHC INC | 27-30-1 | for Microinjection |
| Bulk Pharma Sodium Bicarbonate 35 pounds | Bulk Reef Supply | 255 | Fish supplies |
| CaCl2 | MiliporeSigma | C7902 | |
| Cas9 Protein with NLS | PNABio | CP01 | |
| ChopChop | https://chopchop.cbu.uib.no/ | ||
| Constant oligonucleotide | Integrated DNA Technologies (IDT) | AAAAGCACCGACTCGGTGCCAC TTTTTCAAGTTGATAACGGACTA GCCTTATTTTAACTTGCTATTTC TAGCTCTAAAAC |
|
| Depression Glass Plate | Thermo Fischer Scientific | 13-748B | For IVF |
| Dissecting Forceps | Dumont | SS | For IVF |
| Dissecting Scissors | Fine Science Tools | 14091-09 | For IVF |
| Dissecting Steroscope( with transmitted light source) | Any Maker | For IVF | |
| DNA Clean & Concentrator -5 | Zymo Research | D4014 | Synthesis of gRNA |
| DNA Gel Loading Dye (6x) | Any Maker | For gel electrophoresis | |
| EconoTaq DNA Polymerase | Lucigen | 30032-1 | For PCR mix |
| Electropheresis Power Supply | Any Maker | For gel electrophoresis | |
| Ensemble | https://useast.ensembl.org/index.html | ||
| Eppendorf Femtotips Microloader Tips for Femtojet Microinjector | Thermo Fischer Scientific | E5242956003 | for Microinjection |
| Ethanol (200 proof, nuclease-free) | Any Maker | ||
| FemtoJet 4i | Eppendorf | 5252000021 | for Microinjection |
| Fish Net | Any Maker | Fish supplies | |
| Frozen Brine Shrimp | Brine Shrimp Direct | Fish supplies | |
| General All Purpose Agarose | Any Maker | For gel electrophoresis | |
| Gene-Specific oligonucleotide | Integrated DNA Technologies (IDT) | TAATACGACTCACTATA- N20 -GTTTTAGAGCTAGAAATAGCAAG | |
| Gloves | Any Maker | ||
| Ice Bucket | Any Maker | ||
| Instant Ocean salt | Any Maker | Fish supplies | |
| Invitrogen UltraPure Ethidium Bromide, 10 mg/mL | Thermo Fischer Scientific | 15-585-011 | |
| KCl | MiliporeSigma | P5405 | |
| KH2PO4 | MiliporeSigma | 7778-77-0 | |
| Kimwipes | Thermo Fischer Scientific | 06-666 | |
| Male & Female zebrafish | |||
| MEGAshortscript T7 Transcription Kit | Thermo Fischer Scientific | AM1354 | Synthesis of gRNA |
| Methylene Blue | Thermo Fischer Scientific | AC414240250 | For E3 |
| MgCl2 | MiliporeSigma | 7791-18-6 | For PCR mix |
| MgSO2·7H2O | MiliporeSigma | M2773 | |
| Microinjection plastic mold | World Precision Instruments | Z-Molds | for Microinjection |
| Micromanipulator | Any Maker | for Microinjection | |
| Micropipeters | Any Maker | ||
| Micropipette Puller | Sutter | P-87 | for Microinjection |
| Micropipetter tips with filters (all sizes) | Any Maker | ||
| Micropippetter tips without filters ( all sizes) | Any Maker | ||
| Microwave | Any Maker | ||
| Mineral Oil | MiliporeSigma | m5904-5ml | for Microinjection |
| MS-222 ( Tricaine-D) | Any Maker | FDA approved | |
| Na2HPO4 | MiliporeSigma | S3264 | |
| NaCl | MiliporeSigma | S5886 | |
| NaHC03 | MiliporeSigma | S5761 | |
| Nanodrop | Any Maker | ||
| NaOH | MiliporeSigma | 567530 | |
| Nonstick, RNase-free Microfuge Tubes, 1.5 mL | Ambion | AM12450 | Synthesis of gRNA |
| nuclease-free water | Any Maker | ||
| Paper Towel | Any Maker | ||
| Pastro Pipettes | Any Maker | ||
| PCR Strip Tubes | Any Maker | ||
| Petri Plates 100 mm diameter | Any Maker | ||
| Phenol Red solution | MiliporeSigma | P0290 | for Microinjection |
| Plastic Pestals | VWR | 47747-358 | For IVF |
| Plastic Spoon | Any Maker | For IVF | |
| Premium Grade Brine Shrimp Eggs | Brine Shrimp Direct | Fine Mesh | |
| RNA Gel Loading Dye | found in MEGAshortscript T7 Transcription Kit | For gel electrophoresis | |
| RNAse AWAY | Thermo Fischer Scientific | 21-402-178 | |
| Scale | Any Maker | ||
| Sharpie | Any Maker | ||
| Spatula | Any Maker | ||
| Sterile H2O | Any Maker | For PCR mix | |
| T4 DNA Polymerase | NEB | M0203 | Synthesis of gRNA |
| Tape | Any Maker | ||
| TBE (Tris-Borate-EDTA) 10x | Any Maker | For gel electrophoresis | |
| Tea Stainer | Amazon | IMU-71133W | Fish supplies |
| Thermo Scientific Owl 12-Tooth Comb, 1.0/1.5 mm Thick, Double Sided for B2 | Thermo Fischer Scientific | B2-12 | For gel electrophoresis |
| Thermo Scientific Owl EasyCast B2 Mini Gel Electrophoresis Systems | Thermo Fischer Scientific | 09-528-110B | For gel electrophoresis |
| Thermocycler | Any Maker | ||
| Thermocycler | Any Maker | ||
| Transilluminator | Any Maker | ||
| UV lamp | UVP | Model XX-15 (Cat NO. UVP18006201) | For IVF |
| UV safety glasses | Any Maker | For IVF | |
| Wash Bottle | Thermo Fischer Scientific | S39015 | Fish supplies |
| Zebrafish mating boxes | Aqua Schwarz | SpawningBox1 | Fish supplies |
| 1.5ml Eppendorf Tubes | Fisher Scientific | 05-402-11 | |
| 10 Molar dNTPs | Thermo Fischer Scientific | 18427013 | |
| 100 BP ladder | Thermo Fischer Scientific | 15628019 | |
| 100% RNAse free ethanol | any maker | ||
| 5m Ammonium Accetate | Thermo Fischer Scientific | ||
| 70% Ethanol | 70ml ethanol and 30 ml of nuclease free water | ||
| Accessories for Horizontal Gel Box | Fisher Scientific | 0.625 mm | |
| Agarose | any maker | ||
| CaCl2 | Sigma | 10043-52-4 | |
| CaCl2, dihydrate | Sigma | 10035-04-8 | E3 Medium |
| Capillary Tubing | Cole-Parmer | UX-03010-68 | for injection needles |
| Cas9 Protein | Thermo Fischer Scientific | A36496 | |
| ChopChop | https://chopchop.cbu.uib.no/ | ||
| Computer | any maker | ||
| Dissecting Forcepts | any maker | ||
| Dissecting Microscope | any maker | ||
| Dissecting Scissors | any maker | ||
| DNA Clean & Concentrator -5 | Zymo Research | D4014 | |
| DNA Gel Loading Dye (6X) | Thermo Fischer Scientific | R0611 | |
| EconoTaq DNA Polymerase | Lucigen | 30032-1 | |
| Ensemble | https://useast.ensembl.org/index.html | ||
| Eppendorf Microloader PipetteTips | Fischer Scientific | 10289651 | 20 microliters |
| Ethanol (200 proof, nuclease-free) | any maker | ||
| Ethidium Bromide | Thermo Fischer Scientific | 15585011 | |
| Fish Net | any maker | fine mesh | |
| Frozen Brine Shrimp | LiveAquaria | CD-12018 | fish food |
| Gel Comb (0.625mm) | any maker | ||
| Gel Electropheresis System | any maker | ||
| Gene-Specific oligonucleotide | Integrated DNA Technologies (IDT) | ||
| Glass Capilary Needle | Grainger | 21TZ99 | https://www.grainger.com/product/21TZ99?ef_id=Cj0KCQjw8Ia GBhCHARIsAGIRRYpqsyA3-LUXbpZVq7thnRbroBqQTbrZ_a88 VVcI964LtOC6SFLz4ZYaAhZzEAL w_wcB:G:s&s_kwcid=AL!2966!3! 264955916096!!!g!438976 780705!&gucid=N:N:PS:Paid :GGL:CSM-2295:4P7A1P:20501 231&gclid=Cj0KCQjw8IaGBh CHARIsAGIRRYpqsyA3-LUXbp ZVq7thnRbroBqQTbrZ_a88VVcI 964LtOC6SFLz4ZYaAhZzEALw _wcB&gclsrc=aw.ds |
| Glass Dishes | any maker | ||
| Gloves | any maker | ||
| Hank's Final Working Solution | Combine 9.9 ml of Hank's Premix with 0.1 ml HS Stock #6 | ||
| Hank's Premix | combine the following in order: (1) 10.0 ml HS #1, (2) 1.0 ml HS#2, (3) 1.0 ml HS#4, (4) 86 ml ddH2O, (5) 1.0 ml HS#5. Store all HS Solotions at 4C | ||
| Hanks Solution | |||
| Hank's Solution | https://www.jove.com/pdf-materials/51708/jove-materials-51708-production-of-haploid-zebrafish-embryos-by-in-vitro-fertilization | ||
| Hank's Stock Solution #1 | 8.0 g NaCl, 0.4 g KCl in 100 ml ddH2O | ||
| Hank's Stock Solution #2 | 0.358 g Na2HPO4 anhydrous; 0.60 g K2H2PO4 in 100 ml ddH2O | ||
| Hank's Stock Solution #4 | 0.72 g CaCl2 in 50 ml ddH2O | ||
| Hank's Stock Solution #5 | 1.23 g MgSO47H2O in 50 ml ddH20 | ||
| Hank's Stock Solution #6 | 0.35g NaHCO3 in 10.0 ml ddH20; make fresh day of use | ||
| HCl | Sigma | 7647-01-0 | |
| Ice Bucket | any maker | ||
| Instant Ocean salt | any maker | for fish water | |
| In-Vitro Transcription Kit Mega Short Script | Thermo Fischer Scientific | AM1354 | |
| Invitrogen™ UltraPure™ DNase/RNase-Free Distilled Water | Fisher Scientific | 10-977-023 | |
| KCl | Sigma | 7447-40-7 | E3 Medium |
| KH2PO4 | Sigma | 7778-77-0 | |
| Kimwipes | Fisher Scientific | 06-666 | |
| Male and Female zebrafish | |||
| Mega Short Script T7 Transciption Kit | Thermo Fischer Scientific | AM1354 | |
| methylene blue | Fisher Scientific | AC414240250 | E3 Medium |
| MgSO2-7H2O | Sigma | M2773 | |
| Microimicromanipulator | |||
| Microinjection plastic mold | World Precision Instruments | Z-Molds | |
| Microinjector | |||
| Microneedle Slide | |||
| Micropipeter (1-10) with tips | any maker | need filtered p10 tips | |
| Micropipetter (20-200) with tips | any maker | ||
| Micropippetter (100-1000) with tips | any maker | ||
| Microplastic slide | |||
| Microwave | any maker | ||
| MiliQ Water | any maker | ||
| mineral oil | sigma-aldrich | m5904-5ml | |
| Na2HPO4 | Sigma | ||
| NaCl | Sigma | S9888 | |
| NaHC02 | Sigma | 223441 | |
| Nanodrop | |||
| NaOH | Sigma | 567530 | |
| Narrow Spatula | any maker | ||
| Needle Puller | Sutter | P-97 | |
| Paper Towel | any maker | ||
| Pastro Pipettes | Fisher Scientific | 13-678-20A | |
| PCR primer flanking guide site | Integrated DNA Technologies (IDT) | ||
| PCR primers flanking guide RNA cut site | Integrated DNA Technologies (IDT) | Standard desalted | |
| PCR Strip Tubes | Thermo Fischer Scientific | AB0771W | |
| Petri Dishes | Fisher Scientific | FB0875714 | 10 cm diameter 100mm x 15mm |
| Phenol Red | Fisher Science | S25464 | https://www.fishersci.com/shop/products/phenol-red-indicator-solution-0-02-w-v-2/S25464 |
| Pipette Tips | any maker | 10ul, 200ul and 1000ul tips | |
| Plastic Pestals | Fisher Scientific | 12-141-364 | |
| Plastic Spoon | any maker | ||
| Primer Guide Site | Integrated DNA Technologies (IDT) | ||
| Razor Blade | Uline | H-595B | |
| RNA gel Loading Dye | in megashort script kit(in vitro transciption kit) | ||
| RNAse away | Fisher | 21-402-178 | |
| RNAse free polypropylene microcentrifuge tubes | Thermo Fischer Scientific | AM12400 | https://www.thermofisher.com/order/catalog/product/AM12400#/AM12400 |
| RNAse free water | Fisher Scientific | 10-977-023 | |
| Scale | any maker | ||
| Sharpie | any maker | ||
| Sodium bicarbonate (cell culture tested) | Sigma | S5761 | fish water |
| Sodium Bromide Solotion | Sigma | E1510 | |
| Software for sanger sequencing Analysis | |||
| Spectrophotometer | |||
| Sterlie H2O | any brand | ||
| T4 DNA Polymerase | NEB | M0203S | https://www.neb.com/products/m0203-t4-dna-polymerase#Product%20Information |
| Tape | any brand | ||
| TBE (Tris-Borate-EDTA) 10X | Thermo Fischer Scientific | B52 | https://www.thermofisher.com/order/catalog/product/B52#/B52 |
| Tea Stainer | amazon | IMU-71133W | avaible in most kitchen stores |
| Thermocycler | |||
| Transfer Pipette | Uline | S-24320 | |
| Transilluminator | |||
| Tricaine | fisher scientific | NC0872873 | |
| Tris HCl 7.5 | Thermo Fischer Scientific | 15567027 | |
| Universal Primer | Integrated DNA Technologies (IDT) | AAAAGCACCGACTCGGTGCCAC TTTTTCAAGTTGATAACGGACTAG CCTTATTTTAACTTGCTATTTCTA GCTCTAAAAC |
|
| UV lamp | UVP | ||
| UV safety glasses | any maker | ||
| Wash Bottle | fisher scientific | S39015 | |
| Zebrafish mating boxes | any maker | ||
| PCR Buffer Recipe | Add 171.12mL sterile H20; 0.393 mL 1M MgCl2; 2.616mL 1M MgCl2; 2.618 mL 1M Tris-HCl (pH 8.4) 13.092mL 1M KCl; 0.262 mL 1% Gelatin. Autoclave for 20 minutes then chill the solotion on ice. Next add 3.468 mL 100mg/mL BSA; 0.262 mL dATP (100mM), 0.262mL dCTP (100mM); 0.262 mL dGTP (100mM); 0.262 mL dTTP (100mL). Alliquote into sterile eppendorf tubes |
References
- Pelegri, F. Maternal factors in zebrafish development. Developmental Dynamics. 228 (3), 535-554 (2003).
- Campbell, P. D., Heim, A. E., Smith, M. Z., Marlow, F. L. Kinesin-1 interacts with Bucky ball to form germ cells and is required to pattern the zebrafish body axis. Development. 142 (17), 2996-3008 (2015).
- Eno, C., Solanki, B., Pelegri, F. aura (mid1ip1l) regulates the cytoskeleton at the zebrafish egg-to-embryo transition. Development. 143 (9), 1585-1599 (2016).
- He, W. -. X., et al. Oocyte-specific maternal Slbp2 is required for replication-dependent histone storage and early nuclear cleavage in zebrafish oogenesis and embryogenesis. RNA. 24 (12), 1738-1748 (2018).
- Burger, A., et al. Maximizing mutagenesis with solubilized CRISPR-Cas9 ribonucleoprotein complexes. Development. 143 (11), 2025-2037 (2016).
- Jao, L. -. E., Wente, S. R., Chen, W. Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proceedings of the National Academy of Sciences of the United States of America. 110 (34), 13904-13909 (2013).
- Shah, A. N., Davey, C. F., Whitebirch, A. C., Miller, A. C., Moens, C. B. Rapid reverse genetic screening using CRISPR in zebrafish. Nature Methods. 12 (6), 535-540 (2015).
- Shankaran, S. S., Dahlem, T. J., Bisgrove, B. W., Yost, H. J., Tristani-Firouzi, M. CRISPR/Cas9-directed gene editing for the generation of loss-of-function mutants in high-throughput zebrafish F0 screens. Current Protocols in Molecular Biology. 119 (1), 1-22 (2017).
- Trubiroha, A., et al. A Rapid CRISPR/Cas-based mutagenesis assay in zebrafish for identification of genes involved in thyroid morphogenesis and function. Scientific Reports. 8 (1), 5647 (2018).
- Wu, R. S., Lam, I. I., Clay, H., Duong, D. N., Deo, R. C., Coughlin, S. R. A Rapid method for directed gene knockout for screening in G0 zebrafish. Developmental Cell. 46 (1), 112-125 (2018).
- Moravec, C. E., Voit, G. C., Otterlee, J., Pelegri, F. Identification of maternal-effect genes in zebrafish using maternal crispants. Development. 148 (19), 199536 (2021).
- Braat, A. K., Zandbergen, T., van de Water, S., Goos, H. J., Zivkovic, D. Characterization of zebrafish primordial germ cells: morphology and early distribution of vasa RNA. Developmental Dynamics: An Official Publication of the American Association of Anatomists. 216 (2), 153-167 (1999).
- Eno, C., Hansen, C. L., Pelegri, F. Aggregation, segregation, and dispersal of homotypic germ plasm RNPs in the early zebrafish embryo. Developmental Dynamics. 248 (4), 306-318 (2019).
- Knaut, H., Steinbeisser, H., Schwarz, H., Nüsslein-Volhard, C. An evolutionary conserved region in the vasa 3’UTR targets RNA translation to the germ cells in the zebrafish. Current biology: CB. 12 (6), 454-466 (2002).
- Yoon, C., Kawakami, K., Hopkins, N. Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells. Development. 124 (16), 3157-3165 (1997).
- Gagnon, J. A., et al. Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-scale assessment of single-guide RNAs. PLoS ONE. 9 (5), 98186 (2014).
- Labun, K., Montague, T. G., Gagnon, J. A., Thyme, S. B., Valen, E. CHOPCHOP v2: a web tool for the next generation of CRISPR genome engineering. Nucleic Acids Research. 44, 272-276 (2016).
- Labun, K., Montague, T. G., Krause, M., Torres Cleuren, Y. N., Tjeldnes, H., Valen, E. CHOPCHOP v3: expanding the CRISPR web toolbox beyond genome editing. Nucleic Acids Research. 47, 171-174 (2019).
- Montague, T. G., Cruz, J. M., Gagnon, J. A., Church, G. M., Valen, E. CHOPCHOP: a CRISPR/Cas9 and TALEN web tool for genome editing. Nucleic Acids Research. 42, 401-407 (2014).
- Moravec, C. E., Pelegri, F. J. An accessible protocol for the generation of CRISPR-Cas9 knockouts using INDELs in zebrafish. Methods in Molecular Biology. 1920, 377-392 (2019).
- White, R. J., et al. A high-resolution mRNA expression time course of embryonic development in zebrafish. eLife. 6, 30860 (2017).
- Aanes, H., et al. Zebrafish mRNA sequencing deciphers novelties in transcriptome dynamics during maternal to zygotic transition. Genome Research. 21 (8), 1328-1338 (2011).
- Aken, B. L., et al. The Ensembl gene annotation system. Database: The Journal of Biological Databases and Curation. 2016, (2016).
- Sorlien, E. L., Witucki, M. A., Ogas, J. Efficient production and identification of CRISPR/Cas9-generated gene knockouts in the model system Danio rerio. Journal of Visualized Experiments: JoVE. (138), e56969 (2018).
- Kotani, H., Taimatsu, K., Ohga, R., Ota, S., Kawahara, A. efficient multiple genome modifications induced by the crRNAs, tracrRNA and Cas9 protein complex in zebrafish. PloS One. 10 (5), 0128319 (2015).
- Rosen, J. N., Sweeney, M. F., Mably, J. D. Microinjection of zebrafish embryos to analyze gene function. Journal of Visualized Experiments: JoVE. (25), e1115 (2009).
- Xu, Q. Microinjection into zebrafish embryos. Methods in Molecular Biology. 127, 125-132 (1999).
- Biology Mouse, ., Zebrafish, , Chick, Biology: Mouse, Zebrafish, and Chick. Zebrafish Microinjection Techniques. JoVE Science Education Database. , (2021).
- Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., Schilling, T. F. Stages of embryonic development of the zebrafish. Developmental Dynamics: An Official Publication of the American Association of Anatomists. 203 (3), 253-310 (1995).
- D’Agostino, Y., et al. A rapid and cheap methodology for CRISPR/Cas9 zebrafish mutant screening. Molecular Biotechnology. 58 (1), 73-78 (2016).
- Baars, D. L., Takle, K. A., Heier, J., Pelegri, F. Ploidy manipulation of zebrafish embryos with Heat Shock 2 treatment. Journal of Visualized Experiments: JoVE. (118), e54492 (2016).
- Nair, S., Lindeman, R. E., Pelegri, F. In vitro oocyte culture-based manipulation of zebrafish maternal genes. Developmental Dynamics: An Official Publication of the American Association of Anatomists. 242 (1), 44-52 (2013).
- Kushawah, G., et al. CRISPR-Cas13d induces efficient mRNA knockdown in animal embryos. Developmental Cell. 54 (6), 805-817 (2020).
- Kroeger, P. T., Poureetezadi, S. J., McKee, R., Jou, J., Miceli, R., Wingert, R. A. Production of haploid zebrafish embryos by in vitro fertilization. Journal of Visualized Experiments: JoVE. (89), e51708 (2014).
- Xiao, T., Roeser, T., Staub, W., Baier, H. A GFP-based genetic screen reveals mutations that disrupt the architecture of the zebrafish retinotectal projection. Development. 132 (13), 2955-2967 (2005).
- Riemer, S., Bontems, F., Krishnakumar, P., Gömann, J., Dosch, R. A functional Bucky ball-GFP transgene visualizes germ plasm in living zebrafish. Gene Expression Patterns: GEP. 18 (1-2), 44-52 (2015).
- Moreno-Mateos, M. A., et al. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nature Methods. 12 (10), 982-988 (2015).
