A Reporter Assay to Analyze Intronic microRNA Maturation in Mammalian Cells

Summary

We developed an intronic microRNA biogenesis reporter assay to be used in cells in vitro with four plasmids: one with intronic miRNA, one with the target, one to overexpress a regulatory protein, and one for Renilla luciferase. The miRNA was processed and could control luciferase expression by binding to the target sequence.

Abstract

MicroRNAs (miRNAs) are short RNA molecules that are widespread in eukaryotes. Most miRNAs are transcribed from introns, and their maturation involves different RNA-binding proteins in the nucleus. Mature miRNAs frequently mediate gene silencing, and this has become an important tool for comprehending post-transcriptional events. Besides that, it can be explored as a promising methodology for gene therapies. However, there is currently a lack of direct methods for assessing miRNA expression in mammalian cell cultures. Here, we describe an efficient and simple method that aids in determining miRNA biogenesis and maturation through confirmation of its interaction with target sequences. Also, this system allows the separation of exogenous miRNA maturation from its endogenous activity using a doxycycline-inducible promoter capable of controlling primary miRNA (pri-miRNA) transcription with high efficiency and low cost. This tool also allows modulation with RNA-binding proteins in a separate plasmid. In addition to its use with a variety of different miRNAs and their respective targets, it can be adapted to different cell lines, provided these are amenable to transfection.

Introduction

Precursor mRNA splicing is an important process for gene expression regulation in eukaryotes¹. The removal of introns and the union of exons in mature RNA is catalyzed by the spliceosome, a 2 megadalton ribonucleoprotein complex composed of 5 snRNAs (U1, U2, U4, U5, and U6) along with more than 100 proteins^2,3. The splicing reaction occurs co-transcriptionally, and the spliceosome is assembled at each new intron guided by the recognition of conserved splice sites at exon-intron boundaries and within the intron⁴. Different introns might have different splicing rates despite the remarkable conservation of the spliceosome complex and its components. In addition to the differences in splice site conservation, regulatory sequences distributed on introns and exons can guide RNA-binding proteins (RBP) and stimulate or repress splicing^5,6. HuR is a ubiquitously expressed RBP and is an important factor to control mRNA stability⁷. Previous results from our group showed that HuR can bind to introns containing miRNAs, indicating this protein might be an important factor to facilitate miRNA processing and maturation, also leading to the generation of alternative splicing isoforms^6,8,9.

Many microRNAs (miRNAs) are coded from intronic sequences. Whereas some are part of the intron, others are known as "mirtrons" and are formed by the entire intron^10,11. miRNAs are short non-coding RNAs, ranging from 18 to 24 nucleotides in length¹². Their mature sequence shows partial or total complementarity with target sequences in mRNAs, therefore affecting translation and/or mRNA decay rates. The combinations of miRNAs and targets drive the cell to different outcomes. Several miRNAs can drive cells to pro- or anti-tumoral phenotypes¹³. Oncogenic miRNAs usually target mRNAs that trigger a suppressive characteristic, leading to increased cellular proliferation, migration, and invasion¹⁴. On the other hand, tumor-suppressive miRNAs might target oncogenic mRNAs or mRNAs related to increased cell proliferation.

The processing and maturation of miRNAs are also dependent on their origin. Most intronic miRNAs are processed with the participation of the microprocessor, formed by the ribonuclease Drosha and protein co-factors¹². Mirtrons are processed with the activity of the spliceosome independently of Drosha¹⁵. Considering the high frequency of miRNAs found within introns, we hypothesized that RNA-binding proteins involved with splicing could also facilitate the processing and maturation of these miRNAs. Notably, the RBP hnRNP A2/B1 has already been associated with the microprocessor and miRNA biogenesis¹⁶.

We have previously reported that several RNA-binding proteins, such as hnRNPs and HuR, are associated with intronic miRNAs by mass spectrometry¹⁷. HuR's (ELAVL1) association with miRNAs from the miR-17-92 intronic cluster was confirmed using immunoprecipitation and in silico analysis⁹. miR-17-92 is an intronic miRNA cluster composed of six miRNAs with increased expression in different cancers^18,19. This cluster is also known as "oncomiR-1" and is composed of miR-17, miR-18a, miR-19a, miR-20, miR-19b, and miR-92a. miR-19a and miR-19b are among the most oncogenic miRNAs of this cluster¹⁹. The increased expression of HuR stimulates miR-19a and miR-19b synthesis⁹. Since intronic regions flanking this cluster are associated with HuR, we developed a method to investigate if this protein could regulate miR-19a and miR-19b expression and maturation. One important prediction of our hypothesis was that, as a regulatory protein, HuR could facilitate miRNA biogenesis, leading to phenotypic alterations. One possibility was that miRNAs were processed by the stimulation of HuR but would not be mature and functional and, therefore, the effects of the protein would not directly impact the phenotype. Therefore, we developed a splicing reporter assay to investigate whether an RBP such as HuR could affect the biogenesis and maturation of an intronic miRNA. By confirming miRNA processing and maturation, our assay shows the interaction with the target sequence and the generation of a mature and functional miRNA. In our assay, we couple the expression of an intronic miRNA cluster with a luciferase plasmid to check for miRNA target-binding in cultured cells.

Protocol

An overview of the protocol described here is depicted in Figure 1.

1. Plasmid construction

1. pCAGGS-Cre: This plasmid was provided by Dr. E. Makeyev²¹.
2. pRD-miR-17-92:
   1. Amplify pre-miR-17-92 by PCR using 0.5 µM of each specific primer (Table of Materials), 150 ng of cDNA, 1 mM dNTPs, 1x Taq PCR buffer, and 5 U of high-fidelity Taq DNA polymerase. Perform a no-template control PCR reaction (use water instead of cDNA) to check for DNA contamination.
   2. Ligate the PCR product into pRD-RIPE (kindly provided by Dr. E. Makeyev, Nanyang Technological University, Singapore)²¹ inside the intron between the EcoRI and EcoRV restriction sites using DNA ligase, creating pRD-miR-17-92. Confirm sequence integrity by Sanger sequencing.
3. pmiRGLO-RAP-IB
   1. Design forward and reverse primers flanked by XhoI/XbaI restriction sites and with one NotI restriction site inside. Mix equimolar amounts of forward and reverse primers and incubate the mixture at 90 °C for 5 min, then transfer to 37 °C for 15 min. As controls, use primers with scrambled target sequences (Table of Materials).
   2. Cleave the annealed fragments using XhoI/XbaI restriction enzymes and ligate them downstream of the luc2 sequence into pmiR-GLO, generating pmiRGLO-RAP-IB-3ʹ-UTR (Luc-RAP-1B) and pmiRGLO-scrambled-3ʹ-UTR (Luc-scrambled) reporter constructs. Confirm ligation with NotI cleavage.
      ​NOTE: Ensure that the overhangs created after primer annealing are complementary to the vector after cleavage reaction.
4. pFLAG-HuR
   1. To generate a HuR over-expressing plasmid, amplify the HuR sequence with specific primers. Mix 300 ng of cDNA, 0.5 µM of each specific primer, 1 mM dNTPs mix, 1x PCR buffer, and 5 U of high-fidelity Taq DNA polymerase.
   2. Ligate the PCR product into pGEM-T and confirm the DNA sequence integrity by Sanger sequencing. Remove the HuR fragment from pGEM-T and subclone it into pFLAG-CMV-3 mammalian expression vector to generate the pFLAG-HuR vector.

2. Cell culture

NOTE: The HeLa-Cre cell line was a gift from Dr. E. Makeyev²¹, and the papillary thyroid cancer cell (BCPAP) was kindly provided by Dr. Massimo Santoro (University "Federico II", Naples, Italy). HeLa cell, papillary thyroid cancer cell (BCPAP), and HEK-293T were used to overexpress HuR.

1. Maintain the cells in DMEM/high-glucose supplemented with 10% fetal bovine serum, 1 mM sodium pyruvate, 200 mM L-glutamine, and 1x penicillin-streptomycin (100 U/mL penicillin, 100 µg/mL streptomycin) in 100 mm Petri dishes, unless otherwise indicated. Incubate the cells at 37 °C in a humidified, controlled-atmosphere incubator (5% CO₂).
2. Incubate adherent cells with trypsin/EDTA (0.5% solution mixture) at 37 °C for 3-5 min. Let them detach from the plate (incubation period can vary according to the cell type).
3. Perform transfections with a lipid-based transfection reagent following the manufacturer's instructions. Ensure that the cell cultures are approximately 70% confluent. Use similar amounts of DNA for all transfection combinations, as described below, by adding the appropriate DNAs. Perform transfection experiments in replicates.
   1. Mix 200 ng of DNA and 1.25 µL of transfection reagent in 100 µL of the culture medium. Add the transfection mixture to the cells. Incubate the cells with the transfection mixtures for 4 h at 37 °C. Then, replace the medium with medium containing 10% FBS, and incubate for another 24 h before adding the antibiotics for selection.

3. HuR overexpression

1. Transfect pFLAG-HuR and empty pFLAG into HeLa. Select cells by increasing the concentration of geneticin (G418) (1 µg/mL) from 100 µg/mL to 1000 µg/mL, generating stable cell lines.
2. Confirm overexpression with quantitative PCR using specific primers for HuR mRNA, as described in step 7.

4. Total RNA isolation

1. Use freshly collected cells. Trypsinize 70% confluent cell cultures (for this assay, HeLa-Cre cells were used), as described in step 2.2.
2. Collect the cell pellet by centrifugation for 5 min at 500 x g at 4 °C and wash it with 1x PBS (phosphate-buffered saline); repeat the centrifugation.
3. Resuspend the cell pellet in 1 mL of 1x PBS and transfer it to a 1.5 mL microcentrifuge tube.
4. Centrifuge for 5 min at 500 x g at 4 °C.
5. Weigh the dry cell pellet, and adjust the volumes and size of tubes accordingly. 1 mg of cells yields approximately 1 µg of total RNA.
6. In a hood, add 500-1,000 µL of phenol/chloroform to the cell pellet (ideally 750 µL per 0.25 g of cells) and homogenize it by pipetting up and down and mixing with the vortex.
7. Incubate the mixture for 5 min at room temperature (20 °C to 25 °C) to allow the complete dissociation of nucleoprotein complexes.
8. Centrifuge the sample at 500 x g for 5 min at 4 °C.
9. Transfer the supernatant to a new 1.5 mL microcentrifuge tube and add 200 µL of chloroform per 1 mL of phenol:chloroform used. Cap the sample tubes securely.
10. Mix vigorously for 15 s (by hand or briefly vortexing at a lower speed) and incubate at room temperature (20 °C to 25 °C) for 2 min to 3 min.
11. Centrifuge the samples at 12,000 x g for 15 min at 4 °C.
12. Check for the presence of a lower red phenol-chloroform phase, an intermediary phase, and a colorless upper aqueous phase. RNA remains in the upper aqueous phase. In a hood, collect the aqueous phase, avoiding contacting the intermediary phase, and transfer to a fresh tube.
13. Precipitate RNA by mixing the aqueous phase with 400 µL of molecular grade isopropanol (1:1 ratio to phenol/chloroform used) and 2 µL of glycogen in each tube (it will help to visualize the presence of the pellet).
14. Mix vigorously by hand or homogenize with the tip for ~10 s. Incubate for 15 min or overnight at −20 °C.
15. Centrifuge the sample at 12,000 x g for 20 min at 4 °C and discard the supernatant.
16. Wash the RNA pellet by adding 3 volumes of 100% ethanol (approximately 1 mL, diluted using DEPC water) and mix the sample by vortexing until the pellet is released and floats from the bottom.
17. Centrifuge at 7,500 x g for 5 min at 4 °C.
18. Wash the RNA pellet 1x by adding 1 mL of 75% ethanol and mix the sample by vortexing until the pellet is released and floats from the bottom. Repeat the centrifugation as described in step 4.17.
19. Perform an additional 5 s centrifugation spin to collect residual liquid from the side of the tube and remove any residual liquid with a pipette without disturbing the pellet.
20. Briefly air-dry the RNA pellet by opening the cap of the tube at room temperature for 3-5 min and dissolve the RNA pellet in 20-50 µL of RNase-free DEPC-treated water. Incubate the RNA for 10 min at 55-60 °C to facilitate resuspension of the pellet.

5. Determination of total RNA concentration and quality

1. Determine the RNA concentration by measuring the absorbance at 260 nm and 280 nm using a spectrophotometer. Obtain full-spectral data before using the samples in downstream applications.
2. Control the RNA quality by resolving 800-1000 ng on a 1.5% agarose gel using 0.5X TBE buffer (45 mM Tris base, 45 mM boric acid, 1 mM EDTA). Total RNA separates into two bands referring to 28S and 18S rRNAs.
   1. Make all reagents and wash all equipment used for running the gel with DEPC-treated water. DEPC-treated water is prepared in the hood by adding 1 mL of diethylpyrocarbonate to 1000 mL of ultra-pure water. Incubate for ~2 h at room temperature or at 37 °C and autoclave. Store at room temperature for up to 10 months.
      NOTE: Electrophoresis of mammalian total RNAs leads to the separation of 28S and 18S rRNAs at a ratio of approximately 2:1. The bands should be intact and visible as two sharp bands. Degraded RNA will result in blurry bands.

6. Reverse transcription

1. Set the reverse transcription reaction using 1 µg of total RNA.
2. Perform reverse transcription (RT) using reverse transcriptase enzyme (see Table of Materials) and 50 ng/µL random decamer primers.
   1. Mix RNA, random primers, and 1 mM dNTP mix (10 mM) in 10 µL. Incubate at 65 °C for 5 min and on ice for 1 min. Add the following reagents: 1x RT buffer, 5 mM MgCl₂, 10 mM DTT, 40 U of RNase inhibitor, and 200 U of Reverse Transcriptase.
   2. Incubate for 10 min at 25 °C and for 1 h at 50 °C (temperatures may change if different enzymes are used). Terminate the reaction by incubating at 85 °C for 5 min. cDNAs can be stored at −20 °C.

7. Quantitative PCR

1. To assemble the reaction in a final volume of 15 µL, mix 3 µL of cDNA (100 ng/µL), 3.2 pmol of each primer, 6 µL of master mix containing the dNTPs and enzyme, and 2.8 µL of ultrapure water.
   NOTE: Use primers for endogenous constitutive genes as controls (housekeeping genes) to normalize the expression levels of HuR mRNA and miRNAs. β-Actin and snRNA U6 (RNU6B) are available options for the normalization of mRNAs and miRNAs, respectively, but other genes might also be suitable depending on the case.
2. Quantify the expression levels using the delta-delta Ct (2-ΔΔCt) method²⁰.

8. The reporter assay

1. Cells used for the assay
   1. Transfect the plasmids in HeLa-Cre cells as follows. Transfect with pTK-Renilla (40 ng), then pRD-miR-17-92, generating HeLa-Cre-miR-17-92, and selecting with 1 µg/mL puromycin.
   2. Transfect HeLa-Cre-miR-17-92-pTK-Renilla with pmiRGLO-RAP-IB-3ʹ-UTR or pmiRGLO-scrambled-3ʹ-UTR, separately. Select using penicillin (100 U/mL) and streptomycin (100 µg/mL). These transfections generate Luc-RAP-1-B and Luc-scrambled.
   3. Transfect the cells with pFLAG-HuR or empty pFLAG (step 3).
   4. Proceed to cell culture, as detailed in step 2.2., with HeLa-Cre miR-17-92-luc, HeLa-Cre miR-17-92-scrambled, HeLa-Cre miR-17-92-HuR, and HeLa-Cre miR-17-92-HuR-luc until approximately 80% of confluence. Induce with 1 µL of doxycycline (1 µg/mL) for 30 min at 37 °C. Also, keep all the cells without doxycycline as controls, for the same period.
      NOTE: The final concentration of doxycycline depends on the cell line of choice. An excess of doxycycline can be toxic for mammalian cells.
2. Luminescent assay
   1. To quantify and compare different luminescence intensities, use the Dual-luciferase reporter assay kit. Thaw luciferase assay solutions and leave them at room temperature before beginning the assay.
   2. Prepare the mix Stop and Glo (blue cap tubes) by mixing 200 µL of the substrate in 10 mL of Luciferase Assay Buffer II. Prepare the mix LAR II (green cap tubes) by mixing 10 mL of Luciferase Assay Buffer II into the amber vial of Luciferase Assay Substrate II and shake well.
   3. Transfer the solutions to 15 mL centrifuge tubes previously identified and protected from light.
      NOTE: As an alternative, the solutions can be previously prepared in 1-2 mL aliquots and frozen at −80 °C protected from light in aluminum foil.
   4. Perform the luminescence readings using an equipment such as Synergy; measure expressed luciferase as relative light units (RLU).
   5. Export the results to a spreadsheet for further statistical analysis.
   6. Perform normalization of firefly-luciferase activity by the control Renilla (luciferase/Renilla) and plot that as relative light units (RLU) in a graphic. Repeat this for groups with and without doxycycline induction.
   7. Calculate the mean and standard error of the mean (SEM). Perform a Student's t-test or two-way ANOVA followed by Tukey's post-test to allow group comparison. These analyses are available in a package such as GraphPad Prism. Differences at p-values < 0.05 are considered significant.

Representative Results

Our initial hypothesis was that HuR could facilitate intronic miRNA biogenesis by binding to its pre-miRNA sequence. Thus, the connection of HuR expression and miR-17-92 cluster biogenesis could point to a new mechanism governing the maturation of these miRNAs. Overexpression of HuR upon transfection of pFLAG-HuR was confirmed in three different cell lines: HeLa, BCPAP, and HEK-293T (Figure 2). As controls, untransfected cells and cells transfected with empty pFLAG vectors were used. Importantly, we observed that HuR overexpression in these cells stimulates the expression of miR-19a (Supplementary Table 1 results reported in Gatti da Silva et al.⁹).

To confirm that the induced miRNAs were genuinely functional, an in vitro reporter system was designed, as described here. The artificial intron in pRD-RIPE separates two coding regions of eGFP. This cassette is under the control of a tetracycline responsive element (TRE). The expression of eGFP is, thus, controlled by the presence of the antibiotic doxycycline (DOX) in the cell medium (Figure 3).

An in silico search using miRbase and TargetScan revealed possible mRNA targets for miR-19a and miR-19b (components of the miR-17-92 cluster). As a potential target for both miRNAs, the sequence 5' TTTGCACA 3', found on the RAP-IB 3' UTR region, was chosen (Supplementary Table 2). RAP-IB is a GTPase member of the Ras-associated protein family (RAS). The induced miRNAs were correctly processed and functional in our assay as it hybridized to the target sequence cloned next to luciferase (see Figure 3, pmiR-GLO target). Therefore, it blocked luciferase translation, which was reflected in reduced luciferase activity (Figure 3). As a control for this assay, we scrambled the target sequence, replacing it for 5' GGGTAAA 3' in Luc-scrambled plasmid (target and scrambled sequences are underlined in the oligos sequences in the Table of Materials).

In regular conditions and without induction of the pRD-miR-17-92 plasmid, endogenous miR-19a and/ or miR-19b found the target on pmiR-GLO, which led to reduced luciferase activity (data not shown). After DOX supplementation, a slight and not statistically significant reduction in luciferase activity was observed in cells with a scrambled target sequence. This might be due to the presence of target sequences for other miRNAs in this sequence. A strong reduction in luciferase activity was observed with RAP-IB 3'UTR upon increased miR-19a and miR-19b expression from pRD-miR-17-92 in comparison to HeLa-Cre cells (see Figure 4, compare orange and black bars). The transfection of pFLAG-HuR in these cells by itself did not change the luciferase activity (see Figure 4, compare gray and black bars). However, overexpression of HuR coupled with doxycycline supplementation, stimulating expression of the miR-17-92 cluster, further reduced luciferase activity (see Figure 4, compare gray and red bars). This indicates a positive regulation of HuR over miR-19a and miR-19b, coupled with correct processing and maturation of these miRNAs, which were able to successfully find their targets (HeLa-Cre miR-17-92-HuR-luc) (see Figure 4).

The use of this reporter system confirmed that HuR induces expression and proper maturation of miR-19a and miR-19b in HeLa cells.

Figure 1: A conceptual overview of the protocol described here. Plasmids containing the miRNA, target sequence, regulatory protein, and pTK-Renilla were transfected in cultured cells. After antibiotic selection, these cells were used for inducing miRNA expression (with doxycycline), with subsequent quantification of luciferase activity, and for RNA analysis to confirm HuR overexpression. Please click here to view a larger version of this figure.

Figure 2: Confirmation of FLAG-HuR over-expression in (A) HeLa, (B) BCPAP, and (C) HEK293T cells by qPCR. Transfection with empty pFLAG was used as a control (white bars). β-actin was used to normalize Ct values. The y-axis represents the fold change of expression calculated after normalization. The error bars represent standard errors calculated from three independent measurements. **P <0.005, ****P < 0.0005 (figure adapted from Gatti da Silva et al.⁹). Please click here to view a larger version of this figure.

Figure 3: Intronic miRNA reporter system. (A) Schematic representation of the pRD-RIPE plasmid that generated pRD-miR-17-92. pre-miR-17-92 was inserted inside the intron and was under the control of a dox-inducible promoter; on the right, the pmiR-GLO plasmid with RAP-IB 3'UTR target sequence (pmiRGLO-RAP-IB); the control had the scrambled target sequence (pmiRGLO-scrambled). (B) Detail on the sequence of pmiRGLO-RAP-IB, focusing on the target sequence complementary to miR-19a and miR-19b. Luciferase activity is reduced upon the interaction of miRNA and the target (figure adapted from Gatti da Silva et al.⁹). Please click here to view a larger version of this figure.

Figure 4: HeLa-Cre cells were co-transfected with reporter plasmids pTK-Renilla, pmiRGLO-RAP-IB, pmiRGLO-scrambled, pRD-miR-17-92, and pFLAG-HuR. Luciferase activity on untransfected HeLa-Cre cells (black), HeLa-Cre miR-17-92-scrambled (white), HeLa-Cre-HuR (gray), HeLa-Cre miR-17-92-luc (orange), and HeLa-Cre miR-17-92-HuR-luc (red). Luciferase activity was quantified as described in the protocol as the relative activity of firefly luciferase to Renilla luciferase (observed with pTK-Renilla) and normalized after doxycycline addition. It is shown as "relative light units" (RLU) on the y-axis. **P < 0.005; ****P < 0.0005 (figure adapted from Gatti da Silva et al.⁹). Please click here to view a larger version of this figure.

Supplementary Table 1: Raw Ct values observed for qPCR to analyze miR-19 expression. Please click here to download this Table.

Supplementary Table 2: RAP-IB 3'UTR sequence and miR-19 target sequence. Please click here to download this Table.

Discussion

Pre-mRNA splicing is an important process for gene expression regulation, and its control can trigger strong effects on cell phenotypic modifications^22,23. More than 70% of miRNAs are transcribed from introns in humans, and we hypothesized that their processing and maturation could be facilitated by splicing regulatory proteins^24,25. We developed a method to analyze intronic miRNA processing and function in cultured cells. Our assay uses four different plasmids and allows us to test the maturation of endogenous and exogenous or induced miRNAs. The method described here can be performed in 2-3 days and does not require expensive reagents.

Considering HuR is an RNA binding protein important for mRNA stability and is immune-precipitated with miR-18 and miR-19a miRNAs¹⁷, this assay tested if it could drive intronic miRNA biogenesis and maturation. HuR is not found in the core of spliceosomes but interacts with proteins involved with mRNA stabilization²⁶. Consistently, overexpression of HuR has been associated with the development of ovary and bladder cancers^27,28. In papillary thyroid cancer cells, we observed that HuR increases cell proliferation, migration, and invasion⁹. HuR also affects the mRNA stability of cell cycle regulators such as PTEN, cyclin A2, and cyclin D2, increasing cell proliferation and migration and leading to tumorigenic characteristics^29,30. However, a significant part of these mRNAs also have target sequences for miR-19a and miR-19b. Notably, HuR can bind to the intronic region where these miRNAs are transcribed, leading to the notion that it can control the splicing and maturation of these miRNAs and, consequently, enhance tumorigenic features.

In order to test that, this assay was developed with four different plasmids. The first contains the miRNA cluster miR-17-92 inserted inside an intron, and its expression is controlled upon doxycycline addition. The second plasmid is the commercial pmiR-GLO carrying the target sequence next to the 3' of the luc2 gene. Binding of the miRNA to this target sequence affects luc2 expression, which can be measured upon a luminescence assay. The third plasmid is pFLAG-HuR, which induces the overexpression of this regulatory protein. Finally, pTK-Renilla is also used to include the Renilla luciferase fluorescence. Our results indicated that HuR stimulates miR-17-92 expression and increases the association of its components with the target sequences, therefore resulting in mature and functional miRNA molecules. We describe the association of HuR with miRNA in another paper⁹. The target sequences used in this study were specific to miR-19a and miR-19b miRNAs. However, this method can also be adapted to the use of shorter or longer target sequences, including multiple target sites. In this case, unspecific binding of endogenous miRNAs to the target sequence or sequences nearby must be considered in the analysis. The sequences used might have other possible target sites, which might affect luciferase activity. The method described here could also be used to validate different targets of a miRNA or a group of miRNAs transcribed together, enabling functional studies of miRNAs and their specific phenotypic alterations. It should also be noted that it allows the results to be compared among different cell lines and genetic backgrounds.

The most critical steps for the broader use of this protocol in mammalian cells are the efficiency of the transfection and induction steps. Since different plasmids are transfected into the cells, adequate controls are also critical. These parameters change with the size of the plasmids and are affected by the extensive time in cell culture. Therefore, an important point to be considered before beginning the assay is the ease of transfection of the chosen cells. Additionally, the extensive use of different antibiotics to select for the different plasmids (gentamicin, puromycin, and doxycycline) and activate the expression can be harmful to cells and reduce the efficiency of the following experiments. It is important that this assay is first optimized with cells with known transfection efficiency.

The reporter successfully showed that increased HuR expression could induce miRNA biogenesis and confirmed its functional maturation. Importantly, overexpression of HuR did not affect the amount of intron produced since we did not observe reduced luciferase activity in this condition (Figure 4). Further experiments can be performed to characterize RBPs and miRNAs using this reporter system. For example, it would be important to create single mutations in miRNA sequences or in their flanking regions and analyze the impact of regulatory proteins in miRNA biogenesis. This would allow the specific characterization of the biogenesis of individual miRNAs and could also improve the knowledge on conserved sequences for miRNA processing and maturation.

We consider this is an important methodological contribution toward the study of miRNA biogenesis and maturation and the role of splicing regulatory proteins in these processes. It could also be applied to studies on the regulation and control of mRNAs and miRNAs in different types of cells.

Materials

Name	Company	Catalog Number	Comments
Recombinant DNA
pCAGGS-Cre (Cre- encoding plasmid)			A kind gift from E. Makeyev from Khandelia et al., 2011
pFLAG-HuR			Generated during this work
pmiRGLO-RAP-IB			Generated during this work
pmiRGLO-scrambled			Generated during this work
pRD-miR-17-92			Generated during this work
pRD-RIPE-donor			A kind gift from E. Makeyev from Khandelia et al., 2011
pTK-Renilla	Promega	E2241
Antibodies
anti-B-actin	Sigma Aldrich	A5316
anti-HuR	Cell Signaling	mAb 12582
IRDye 680CW Goat anti-mouse IgG	Li-Cor Biosciences	926-68070
IRDye 800CW Goat anti-rabbit IgG	Li-Cor Biosciences	929-70020
Experimental Models: Cell Lines
HeLa-Cre			A kind gift from E. Makeyev from Khandelia et al., 2011
HeLa-Cre miR17-92			Generated during this work
HeLa-Cre miR17-92-HuR			Generated during this work
HeLa-Cre miR17-92-HuR-luc			Generated during this work
HeLa-Cre miR17-92-luc			Generated during this work
HeLa-Cre miR17-92-scrambled			Generated during this work
Chemicals and Peptides
DMEM/high-glucose	Thermo Fisher Scientific	12800-017
Doxycycline	BioBasic	MB719150
Dual-Glo Luciferase Assay System	Promega	E2940
EcoRI	Thermo Fisher Scientific	ER0271
EcoRV	Thermo Fisher Scientific	ER0301
Geneticin	Thermo Fisher Scientific	E859-EG
L-glutamine	Life Technologies
Opti-MEM I	Life Technologies	31985-070
pFLAG-CMV™-3 Expression Vector	Sigma Aldrich	E6783
pGEM-T	Promega	A3600
Platinum Taq DNA polymerase	Thermo Fisher Scientific	10966-030
pmiR-GLO	Promega	E1330
Puromycin	Sigma Aldrich	P8833
RNAse OUT	Thermo Fisher Scientific	752899
SuperScript IV kit	Thermo Fisher Scientific	18091050
Trizol-LS reagent	Thermo Fisher	10296-028
trypsin/EDTA 10X	Life Technologies	15400-054
XbaI	Thermo Fisher Scientific	10131035
XhoI	Promega	R616A
Oligonucleotides
forward RAP-1B pmiRGLO	Exxtend	TCGAGTAGCGGCCGCTAGTAAG CTACTATATCAGTTTGCACAT
reverse RAP-1B pmiRGLO	Exxtend	CTAGATGTGCAAACTGATATAGT AGCTTACTAGCGGCCGCTAC
forward scrambled pmiRGLO	Exxtend	TCGAGTAGCGGCCGCTAGTAA GCTACTATATCAGGGGTAAAAT
reverse scrambled pmiRGLO	Exxtend	CTAGATTTTACCCCTGATATAGT AGCTTACTAGCGGCCGCTAC
forward HuR pFLAG	Exxtend	GCCGCGAATTCAATGTCTAAT GGTTATGAAGAC
reverse HuR pFLAG	Exxtend	GCGCTGATATCGTTATTTGTG GGACTTGTTGG
forward pre-miR-1792 pRD-RIPE	Exxtend	ATCCTCGAGAATTCCCATTAG GGATTATGCTGAG
reverse pre-miR-1792 pRD-RIPE	Exxtend	ACTAAGCTTGATATCATCTTG TACATTTAACAGTG
forward snRNA U6 (RNU6B)	Exxtend	CTCGCTTCGGCAGCACATATAC
reverse snRNA U6 (RNU6B)	Exxtend	GGAACGCTTCACGAATTTGCGTG
forward B-Actin qPCR	Exxtend	ACCTTCTACAATGAGCTGCG
reverse B-Actin qPCR	Exxtend	CCTGGATAGCAACGTACATGG
forward HuR qPCR	Exxtend	ATCCTCTGGCAGATGTTTGG
reverse HuR qPCR	Exxtend	CATCGCGGCTTCTTCATAGT
forward pre-miR-1792 qPCR	Exxtend	GTGCTCGAGACGAATTCGTCA GAATAATGTCAAAGTG
reverse pre-miR-1792 qPCR	Exxtend	TCCAAGCTTAAGATATCCCAAAC TCAACAGGCCG
Software and Algorithms
Prism 8 for Mac OS X	Graphpad	https://www.graphpad.com
ImageJ	National Institutes of Health	http://imagej.nih.gov/ij