자궁 적출술 검체에서 차 인간의 자궁 내막 기질 세포를 구축하는 두 가지 방법

* These authors contributed equally
Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

자궁 적출술 검체에서 기본 자궁 내막 기질 세포 배양 시스템을 구축하는 것은 이전의 연구 목표의 광대 한 배열을 추구하는 귀중한 생물 기술과 중요한 단계입니다. 여기서 우리는 인간의 환자의 수술 적 절제술 자궁 내막 조직에서 기질 문화를 설정하는 데 사용되는 두 가지 방법을 설명합니다.

Cite this Article

Copy Citation | Download Citations

Jividen, K., Movassagh, M. J., Jazaeri, A., Li, H. Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens. J. Vis. Exp. (87), e51513, doi:10.3791/51513 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

많은 노력이 체외 세포 배양 시스템의 구축에 전념하고 있습니다. 이러한 시스템은 생체 내 프로세스의 광대 한 번호를 모델로 설계되어 있습니다. 인간의 자궁 내막 샘플에서 발생하는 세포 배양 시스템도 예외는 아니다. 응용 프로그램은 정상적인 생리주기 프로세스에서 같은 부인과 암, 감염성 질환, 생식 결함으로 자궁 내막 병변의 범위. 여기, 우리는 수술 절제 자궁 적출술 검체에서 기본 자궁 내막 기질 세포를 확립하기위한 두 가지 방법을 제공합니다. 첫 번째 방법은 "스크래핑 방법"이라하고 두 번째 방법은 칭했다 반면 수술 또는 면도날을 사용하여 기계적 스크래핑 통합되는 "트립신 방법."이 후자의 방법은 세포의 분리 및 일차 홍보 트립신 효소 활성을 사용 세포 가지. 우리는 디지털 이미지와 현미경을 통해 단계별 방법을 설명한다. 우리는 또한 제공하기양적 실시간 중합 효소 연쇄 반응 (qPCR에) 및 면역 (IF)를 통해 자궁 내막 기질 세포 라인의 유효성을 검사하는 전자의 예입니다.

Introduction

인간의 자궁 체부는 세 개의 층, perimetrium (또는 장막), 자궁 근층 및 자궁 내막으로 구성되어 있습니다. 이들 층의 각각을 구별하는 것은 내막 세포주를 확립하는 중요한 단계이다. perimetrium은 자궁의 가장 바깥 층과 얇은 장액 세포로 구성. 근육층은 두꺼운 중간 자궁의 층과 평활근 세포로 구성된다. 자궁 내막은 자궁의 내부 층으로 식별하고 상피 및 간질 세포 집단을 포함한다.

자궁 내막은 또한 그 줄기 세포 인구는 약 28 일마다 1 functionalis 층을 다시 채울 가설 basalis 층으로 구분된다. 인간의 자궁 내막의 functionalis 층 호르몬 순환에 대한 응답으로 중요한 생화학 적 및 형태 학적 변화를 겪는다. 이 호르몬은 뇌하수체와 난소에서 파생됩니다.

생식주기의 조정 생산 및 호르몬 결과의 릴리스. 생식주기는 잠재적 인 배아 주입 이벤트에 대한 내막을 준비하도록 설계되었습니다. 인간의 생식주기는 "월경주기"라고하며 다음과 같은 세 가지 단계로 구분 - 증식, 분비, 월경. 분비 단계가 functionalis 성숙에 의해 표시되는 반면 증식 단계는 functionalis 자궁 내막 층의 확산을 포함한다. 특히, 세포 변화, 분비물, 그리고 세포 분화는 잠재적 인 주입 신호. 주입이 분비 단계의 끝 이전에 발생하지 않는 경우, functionalis의 자궁 내막 층은 생리 단계 흘렸다. 생리 및 functionalis 층의 흘리기를 트리거하는 이벤트의 중요성은 여전히​​ 논의되고있다. 인간에서는, 생리 알려진 특정 미드 분비 기 감별 이벤트의 결과라고 제기되었다"자연 탈락"2 등. 이 논문에서는, 양쪽 자궁 내막 세포 분리 방법에 대한 상세한 방법을 제공하며, 이러한 방법의 효능을 입증하기 위하여 면역 형광 및 디지털 이미지의 조합을 사용한다. 또, 일반적으로 적용 자궁 내막 세포 격리을 확인하기 위하여 자발 탈락의 시험 관내 모델에서 사용.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

이 원고에 사용 된 자궁 절제술 표본 IRB-HSR # 14424 번호가 대학 IRB 승인 윤리 프로토콜과 일치에 수집되었다.

임상 자료 1. 샘플 수집

  1. 시작하기 전에 정부와 기관 기반의 윤리 지침 및 승인 문서를 얻습니다.
  2. 무균 조건의 모든 단계를 실시한다.
  3. 샘플이 바로 문화에서 처리 할 수​​없는 경우 4 ° C에서 50 ML 튜브 미디어 (RPMI 또는 DMEM / 높은 포도당)의 환자에서 파생 된 조직을 유지. 샘플은 24 시간의 최대이 상태로 저장 될 수있다.
  4. 1X 멸균 인산 완충 식염수 (PBS)와 조직 샘플을 세 번 씻고 세척 사이의 솔루션을 폐기하십시오.

긁는 방법을 사용하여 차 전지 라인 2. 준비

  1. 성장 배지 (RPMI 또는 10 % 태아 소 혈청과 1 % 페니실린 - streptomy 보충 DMEM / 높은 포도당의 4-10 ML을 추가CIN) 조직에 30 분 동안 Fungizone (0.25 ㎍ / ㎖의 최종 농도)를 추가합니다.
  2. 성장 미디어를 폐기하십시오.
  3. 1X PBS로 두 번 조직을 씻으십시오.
  4. 자궁 근층 및 자궁 내막 층 (그림을 추가로 설명 2A-2C 참조)을 구별하는 6cm 세포 배양 접시에 조직을 놓습니다. 자궁 내막을 분리합니다.
  5. 6cm 세포 배양 접시에 긁 동안 메스 나 면도날을 사용하여 작은 조각으로 조직을 절개. 이러한 상처는 새로운 기본 자궁 내막 세포의 부착을 용이하게합니다. 트립신 방법에 비해 더 많은 조직은 (근사 그림 2D 참조)이 필요합니다.
  6. 살짝 긁힌 요리 (조직 파편이 눈에 보이는 이상적으로 긁는 동작에서 고정됩니다)에 성장 배지 2 ㎖를 추가합니다.
  7. 지정된 세포 배양 인큐베이터에 플레이트 (들)을 이동 (37 ° C와 5 % CO 2). 멀리 OTH에서, 일차 전지 라인을위한 장소를 지정세포 배양 접시 어. 차 문화는 감염과 오염에 더 민감하다.
  8. 매일 가벼운 현미경으로 세포를 검사합니다. 세포의 작은 인구 ​​(그림 (b) 참조) 분리 된 조직 주변에서 하루 두 세에 의해 등장한다.
  9. , 문화를 유지 1X PBS로 가볍게 씻어 3 일에 신선한 성장 미디어 (2 ㎖)을 추가합니다. 증식 속도가 증가는 추가적인 성장 배지 (3-4 ㎖)을 6cm 배양 플레이트 (들)에 첨가 될 수있는 경우.
    참고 : 세척 및 미디어 변경하는 동안, 조직의 조각 가능성이 흡입됩니다. 이 자기편 세포의 성장에 영향을 미치지 않습니다. 새로운 식민지 한 주 후에 나올 가능성이 같은 조직의 조각은 다음 단계 (2.10)에 의해 흡입해야한다.
  10. 0.05 % 트립신을 사용하여 80 %의 합류 (그림 (b) 참조), 통과 - 6cm 판은 약 75 때. 기본 세포는 무한정 계대 배양 할 수 없습니다 - 두 개 또는 세 개의 플레이트 엄마입니다 즉시 세포의 한 판을 아래로 동결intained. 더 많은 통로가 필요한 경우 (참조 3에서 검토) 불멸화 프로토콜을 따릅니다.

트립신 방법을 사용하여 기본 셀 라인 3. 준비

  1. 카나마이신 (0.03 ㎎ / ㎖ 최종 농도)로 보충 0.25 % 트립신 2 ㎖에 자궁 내막 조직의 작은 조각 (근사 그림 2D 참조) 놓습니다.
  2. 30 분 동안 플랫폼을 회전에 37 ° C에서 조직을 품어.
  3. 간단히 조직을 소용돌이.
  4. 2 분 동안 200 ~ 400 XG에서 샘플을 원심 분리기 및 뜨는 폐기하십시오.
  5. 신선한 트립신 및 카나마이신을 추가합니다.
  6. 시간 동안 회전하는 동안 37 ° C에서 조직을 품어.
  7. 5 ~ 10 초 동안 조직을 소용돌이.
  8. 트립신을 비활성화 (10 % 태아 소 혈청과 1 % 페니실린 - 스트렙토 마이신과 보충) 성장 배지 2 ㎖를 추가합니다.
  9. 2 ~ 3 분 동안 200 ~ 400 XG에 원심 분리기 세포.
  10. 뜨는을 취소하고 성장한다 2 ㎖를 추가펠렛 세포에 일 미디어.
  11. 6cm 세포 배양 접시에 접시. 긁는 방법을 사용하여 기본 세포 라인을 준비 단계 2.5로 접시를 긁는 것은 필요 없습니다 만, 차 문화의 첨부 파일 및 파생물을 향상시킵니다.
  12. 매일 광학 현미경으로 세포를 모니터링합니다. 세포 (그림 3C 참조) 48 시간 후 광학 현미경으로 일반적으로 볼 수 있습니다.
  13. 문화를 유지하기 위해 세포를 모니터링하고 단계 2.9에서와 같이 2-3 일마다 미디어를 변경합니다.
  14. 세포 75-80 % 년 컨 플루 (그림 3C 참조)에 도달 할 때 통과하는 세포는 0.05 % 또는 0.25 % 트립신을 사용합니다.

4. 추가 분석을위한 조직 (스냅 냉동 및 포르말린 고정)를 저장

  1. 1X PBS로 두 번 샘플을 씻으십시오.
  2. 가능한 한 많은 액체를 대기음.
  3. 스냅 냉동, (그림 2 층과 2G 참조) 1.7 원심 분리 관에 자궁 내막 조직 샘플을 놓습니다. 1.7에게 배치원심 관 10 초간 액체 질소 나 때까지 조직 아래 냉동되었음을 알 수있다.
    참고 : 샘플을 준비 할 때 직접 액체 질소를 건드리지 않도록주의하십시오. 샘플은 추가 처리 또는 분석 할 때까지 -80 ° C에 저장할 수 있습니다.
  4. 포르말린 고정의 경우, 자궁 내막 조직 (그림 2H 참조)의 작은 조각을 잘라, 그리고 10 % 버퍼 아연 포르말린에 잠수함. 24 시간 후, 포르말린을 취소하고 추가 처리 될 때까지 조직 샘플에 70 % 에탄올을 추가합니다.

5. 면역 형광 (IF)

  1. 셀 고정
    1. 문화 슬라이드 나 접시에 세포를 준비합니다.
    2. 부드럽게, 1X PBS로 세포를 씻어.
    3. 5 분 (1:1의 비율로 혼합) 미리 냉장 (4 ℃) 메탄올 및 아세톤을 추가합니다.
    4. 공기는 진행하기 전에 슬라이드를 건조. 필요한 경우 슬라이드 1 ~ 2 주 동안 4 ° C에 저장할 수 있습니다.
  2. 처리 IF
    1. 10 분 동안 1X PBS로 세포를 재수. FO에 대한llowing는 회전 플랫폼에서 모든 세척 및 배양을 실시, 1-6 단계를 반복합니다.
    2. 1X PBS를 사용하여 블록은 1 % 소 혈청 알부민 (BSA)로 보충하고, 실온 (RT)에서 30 분 동안 1 % 종 특정 혈청 (2 차 항체 원).
    3. (항체 희석에 대한 제조 업체의 권장 사항을 참조하십시오) 차 항체에 품어. 특정 항체에 대한 자료를 참조하십시오. 단계 5.2.2에서와 같이 신선한 블로킹 버퍼에 일차 항체를 희석. 이 배양은 실온에서 또는 밤새 4 ℃에서 최소 2 시간 동안 실시 할 수있다
    4. 5 분마다 1X PBS로 3 회 반복한다.
    5. (항체 희석에 대한 제조 업체의 권장 사항을 참조하십시오) 이차 항체에 품어. 단계 5.2.2에서와 같이 신선한 차단 버퍼에 보조 항체를 희석. 광 표백을 방지하기 위해서는 빛의 부재로이 이후의 단계를 수행하는 것이 중요하다.
    6. 5 분마다 1X PBS로 3 회 반복한다.
    7. Thoroughly는 슬라이드를 건조.
    8. 설치 미디어 및 DAPI의 counterstaining 솔루션을 추가합니다.
    9. 커버 슬립을 적용하고 실란트 (들)을 사용하여 가장자리를 밀봉. 슬라이드는 최대 2 주 동안 어둠 속에서 4 ° C에 저장할 수 있습니다.

6. RNA 추출

  1. 원심 분리하여 1 × 10 7 세포 펠렛. 이 프로토콜의 모든 재료 및 시약은 무료의 RNase해야합니다.
  2. 1 ㎖의 TRIZOL 시약 및 핵 단백질 복합체의 분리를 완료하기 위해 실온에서 10 분 동안 균질화 된 샘플을 배양에서 세포를 Lyse.
  3. TRIZOL 1 ㎖ 당 클로로포름 200 μl를 추가합니다. 15 초 동안 손으로 격렬하게 흔들어 실온에서 2 ~ 3 분 동안 품어.
  4. 4 ℃에서 15 분 동안 최대 속도 (15,000 XG)에서 원심 분리기 세 가지 레이어가 발생합니다.
  5. 새로운 microcentrifuge 관에 상단 수성 단계를 전송합니다. RNA 수율을 높이기 위해 1 μL 글리코겐을 추가; 그러나,이 단계는 필요시 소형RNA의 양이 예상된다.
  6. 수성 층에 이소 프로필 알콜 0.5 ㎖를 추가하고 샘플을 3-5 번 반전. 10 분 동안 RT에서 샘플을 배양한다. 수율을 높이기 위해 샘플을 30 분 -20 ° C 또는 -80 ° C에 배치 할 수 있습니다.
  7. 4 ℃에서 10 분 동안 최대 속도로 원심 분리기
  8. 이 시점에서, RNA의 작은 펠릿을 볼 수 있어야합니다. 상층 액을 버린다.
  9. 75 %의 에탄올 1 ㎖로 RNA를 씻으십시오.
  10. 5 분 동안 최대 속도로 원심 분리하고 상층 액을 버린다. 샘플은 한 번 무기 오염 물질을 제거하는 것이 더 세척 할 수 있지만,이 단계가 필요하지 않습니다.
  11. RNA 펠렛 건조 될 때까지 짧게, (일반적으로 7 ~ 10 분 소요) RNA 펠렛을 건조.
    주 : 하나의 추가 단계는 무기 물질을 줄이고, 건조 시간을 단축 할 수있다. 추가 분 대기음 잔류 액의 최대 속도로 에탄올 세척, 스핀 샘플에서 뜨는을 폐기 한 후. 펠렛을 대기음하지 않도록주의하십시오.
  12. RNA 펠렛의 크기에 따라, RNase가없는 물에 RNA를 용해. 볼륨은 일반적으로 10 ~ 50 ㎕의 범위.
  13. 10 분 동안 55 ° C에서 샘플을 품어 및 RNA의 농도를 측정한다.
  14. 추가 처리 될 때까지 -20 ° C에서 보관 샘플.

7. 전사 역

  1. H 2 O와 9 μL의 볼륨에 샘플 RNA (1-3 μg)을 가지고
  2. 10 분 동안 70 ° C에 열 RNA.
  3. 의 dNTP의 5 μL (50 μM의 작업 농도), N6 DNA 올리고의 5 μL (80 μM의 작업 농도), 배 AMV 버퍼의 5 μL 및 AMV의 1 μL : AMV 마스터 믹스를 생성하려면, 다음과 같은 시약을 결합 . 이 마스터 믹스 솔루션은 하나의 샘플 당 설계되었습니다.
  4. 가열 된 RNA로 마스터 믹스의 16 μl를 추가합니다. 최종 반응 부피가 25 μL 반응 할 것이다.
  5. (1 단계) 90 분 42 ° C에서, (역 : 역전사에 대해 다음과 PCR 조건을 사용하여5 분, 추가 처리 될 때까지 (3 단계) 4 °의 C에 대한 GE의 2) 95 ° C.

8. 리얼 타임 PCR

  1. 표 1에서 발견 프라이머 어닐링 온도, 사이클 수, 및 시약을 사용하여 PCR 반응을 실시한다.
    참고 : (재료에 회사 카탈로그 번호 참조) PCR 시약을 사용하는 경우 제조 업체의 지침에 따라 적합합니다.

9. (참조 4와 5에서 파생) 체외 탈락 프로토콜

  1. 자궁 내막 세포를 접시.
  2. 75-85%의 포화 상태로 성장합니다.
  3. 세포가 합류하게 한 후, 1X PBS로 한번 세척한다.
  4. 신속, (페놀 무료 RPMI 5 % 목탄 스트립 FBS, 1 % 페니실린 - 스트렙토 마이신과 보충) 호르몬이없는 용지를 추가합니다.
  5. 24 시간 후, 1 μM 및 8 bromoadenosine 3의 최종 농도 메드 록시 프로게스테론 아세테이트 (MPA)로 보충 호르몬 가능한 미디어 ', 5'를 추가0.5 ㎜의 최종 농도 환식 모노 포스페이트 (캠프).
  6. 적어도 48 시간 후에 반응을 정지하고 추가 처리를 위해 플레이트 (들)을 저장한다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

프로토콜 섹션에 강조으로, 인간의 조직을 처리하고 준비 할 때 모든 기관 정부에서 방법, 윤리적 지침을 수행해야합니다.

"긁는 방법"의 일반적인 워크 플로의 그림 (그림 1A) 및 기본 자궁 내막 문화를 설정하는 데 사용 "트립신 방법"(그림 1B)은이 원고에 포함되어 있습니다. 이들 방법은 프로토콜 섹션에서 상세히 설명된다 (파트 1 참조 -. 3.). 두 가지 방법은 기본 자궁 내막 문화의 성장에 성공적으로 증명한다. 장점은 "긁기 방법은"준비 시간이 단축되는; 에 비해 4 배 이상 - 그러나, 생존 세포를 관찰하는 데 걸리는 시간은 통상 2 "트립신 방법."

티슈 조달로부터 수신 된 초기 인체 조직의 디지털 이미지가 개시된다. 자궁 층에 의해 구별 될 수있다레이어의 거침, 자궁 근층, 즉 두꺼운 근육과 자궁 내막은 얇고 더 열매를 산출합니다. 우리는 흰색의 두꺼운 평활근 층 (자궁 근층)을 강조하고 두 개의 서로 다른 자궁 적출술 샘플 (그림 2A와 2B)에서 블랙에 대한 관심의 자궁 내막 층을 설명했다. 그림 (c)에, 조직은 자궁 내막이 아래로 위치하는 동안 자궁 근층이 위를 향으로 지향하고 있습니다. 얇은 perimetrial 층은 수술 절제와 이러한 이미지에서 강조되지 않았다. 이들 디지털 2 차원 영상의 내막 층의 크기는 실제 3 차원 층이 자궁 근층에 비해 매우 얇기로 잘못 표시된다는 점에 유의하는 것이 중요하다.

해당 조직의 크기를 절단 "긁는 방법"둘 다 중요하다 "트립신 방법." 그림 차원에서 적절한 크기는 각각의 샘플 위의 각 방법에 대해 지정됩니다. 하나 0.5x0를 사용하여"트립신 방법"[왼쪽] .5 X0.5 센티미터 조각 문화를 확립하기에 충분하다. "긁는 방법"[오른쪽]의 대표 시작 조직은 모든​​ 자궁 층을 포함한다. "스크래핑 방법"의 최종 생성물은도 2E에서 표현되고, 이는 자궁 내막 조직의 적어도 1x1x1의 cm가 가능한 배양을 설정하는 데 사용하는 것을 추천합니다. 이 정도의 조직 샘플에 대한 요구 사항은 단점 "긁는 방법."

남은 조직은 종종 단백질을 포함하고 RNA 분석을 다양한 방법으로 사용됩니다. 티슈 품질의 보존을 보장하기 위해, (4 참조.) 프로토콜 섹션으로 "스냅 동결"방법을 사용하는 것이 중요하다. 이 방법은도 2F 및도 2G에 도시된다. 포르말린 고정에 의해 별도의 조직을 저장하는 것은 또한 병리학 및 연구원의 일반적인 관행입니다. 포르말린 고정을위한 준비 조직은 프로토콜에 설명되어 있습니다 참조)도 하반기에 나와 있습니다.

광학 현미경은 기본 자궁 내막 문화를 모니터링하기위한 필수적입니다. 각각의 자궁 내막 기질 세포는 섬유 아세포의 형태 (그림 3A)를 전시한다. "긁는 방법은"일반적으로 주로 메스에 의한 상처 (그림 3B, 2 일)에 따라, 초기 신흥 세포의 클러스터를 생성합니다. "트립신 방법은"클러스터 및 분산 된 세포의 성장 패턴 (그림 3C, 4 일)을 모두 생성한다. 우리는 각각의 방법 (그림 3B 및 3C)의 제 1 통로에 대한 초기 도금 (0 일)에서 여러 대표 이미지를 포함했다.

유전자와 단백질 발현 실험은 자궁 내막 6-11, EN 실시되었지만 대부분의 조직은 등 면역 줄기 세포, 평활근, CD34에 대한 평활근 액틴 (SMA)와 같은 조직 특이 마커의 발현에 의해 정의된다dometrial 기질 세포 특정 마커는 아직 발견해야합니다. 대신 연구팀은 일반적으로 잠재적 인 세포 오염 물질 마커를 측정하여 자궁 내막 기질의 순도를 평가합니다. 예를 들어, 아세포 마커는 상피 인구를 표시하는 데 사용됩니다. 수립 및 자궁 내막 상피가 어렵고 일반적으로 (참조 12 그림 4A)에 선택되어 유지하기 때문에, 그것은 문제가되지 않는다. 샘플은 임신, HLA-A의 긍정적 인 표현 중에 얻을 수 있다면,-B는-C는 세균, 영양막 세포 (13)를 보여줍니다. 반면에, 다른 중간 엽 섬유 아세포와 같은, 자궁 내막 기질 세포 멘틴 (CDH1)을 표현한다. 우리는 면역, 멘틴의 표현과 우리의 설립 자궁 내막 기질 세포 (그림 4B)에서 아세포와 E의 카드 헤린 (CDH1)의 부재와 함께 보여줍니다.

마지막으로, 우리는 I를 통해 기본 자궁 내막 문화의 기능적인 증거를 제공N 자연 탈락 분석을 체외. 이 방법은 참조 번호 (4, 5)에서 적응 및 메드 록시 프로게스테론 아세테이트 (MPA) 및 (8)의 조합으로 배양 처리를 포함 하였다 - bromoadenosine 3 ', 5'-시 클릭 모노 포스페이트 9에 기재된 (캠프) (체외 탈락 프로토콜모델링. 도 5a에서). MPA 캠프의 존재에서, 자궁 내막 기질 세포 (참조 14에서 검토) 크게 변경 유전자 발현 프로파일을 나타낸다. 자주 게시 된 자연 탈락 마커 프로락틴 (PRL)이며, 단백질 1 (IGFBP1를) 바인딩 인슐린과 같은 성장 인자는 (참조 14에서 검토). MPA 및 캠프에이 두 유전자의 반응은 자연 탈락과 자궁 내막 문화의 성공적인 설립을 모두 강력한 지표입니다. 우리는 그림 (b)에이 문제를 보여줍니다.


그림 1. 두 가지 기본 자궁 내막 분리 방법의 개략도. (A) (B). 조직도에 표시 긁는 방법 2.1-2.10 단계를 조직도에 표시되는 트립신 방법 3.1-3.14 단계를. 더 큰 이미지를 보려면 여기를 클릭하십시오.

그림 2
그림 2. 자궁 조직을 처리. 두 여성 환자 (AC) 임상 자궁 샘플. A & C는 환자 1에서 파생되고 B는 환자 2에서 파생됩니다. 수술로 절제된 자궁 조직 (왼쪽)과 highlighte을D 자궁 층 (오른쪽). (A & B) 자궁 근층이 검은 색에서 흰색과 자궁 내막에서 ​​원하고 있습니다. (C) 자궁 근층는 카메라를 직면하고있다. (D) 모두 분리 방법에 대한 초기 대표 자궁 내막 샘플 크기가 표시됩니다. 긁는 방법은 전체 자궁 표본을 사용 할 수있는 반면 트립신 방법은 트립신을 첨가하기 전에 순수한 자궁 내막이 필요합니다. 긁는 방법의 처리 자궁 내막 샘플 (E) 예. (F & G) 스냅인을 준비 중 남아있는 자궁 조직의 이미지 냉동. 보이는이 방법을 사용 실험실에서 만든 금속 컨테이너입니다. (H) 자궁 내막 샘플의 포르말린 고정. 더 큰 이미지를 보려면 여기를 클릭하십시오.

그림 3 그림 3. 기본 자궁 내막 문화의 광학 현미경 이미지. . (A) 다양한 능력과 포화 상태에 찍은 자궁 내막 기질 세포 배양의 대표 이미지 (B) 긁는 방법 (일 0-16)의 대표 이미지를 10 배에서 전원 같은 배양 접시, 찍은 참고 :. 비주얼 라인에서 흠집을 나타냅니다 수술 블레이드 트립신 방법 (C) 대표 이미지.. (일 0-16) 10 배에 전원이 같은 배양 접시, 찍은 큰 이미지를 보려면 여기를 클릭하십시오.

그림 4
그림 4. 자궁 내막 기질 세포의 면역 형광 이미지. (A) 면역 형광기본 자궁 내막 문화의 긁는 방법을 통해입니다. 이미지는 통로 2 (P2) 및 통로 (5) (P5) 사이 아세포의 손실을 보여줍니다. 골수성 백혈병 단백질 (PML) 핵 단백질과 DAPI 염색은 대조군으로 사용 하였다. (B) 이미지가 중간 엽 마커 멘틴에 대한 긍정적 인 얼룩을 보여줍니다. 이미지는 E 헤린 (CDH1) 및 아세포 부정적인 얼룩을 보여줍니다. DAPI와 전골 수 구성 백혈병 단백질 (PML)에 염색이 컨트롤로 제공된 것은. 더 큰 이미지를 보려면 여기를 클릭하십시오.

그림 5
그림 5. 두 가지 기본 자궁 내막 기질 세포의 자발적인 탈락. 실험 절차 (A) 개요. (B) 프로락틴의 상향 조절 (PRL) 및MPA 및 캠프에 대한 응답으로 단백질 1 (IGFBP1) 유전자 발현을 바인딩 인슐린과 같은 성장 인자. 결과는 RT-qPCR에를 통해 측정하고, 식 GAPDH에 정상화되었다. 의미는 학생의 T - 테스트 (P <0.001 *** 및 P <0.0001 ****)를 사용하여 계산 하였다. 두 세포 라인을 긁는 방법을 사용하여 격리 된 것은. 더 큰 이미지를 보려면 여기를 클릭하십시오.

뇌관 순서 어닐링 온도 (° C) 사이클 시험
프로락틴 (PRL) 앞으로 CATATTGCGATCCTGGAATGAGC (60) (40) Sybrgreen
프로락틴 (PRL) 역 TCCTCAATCTCTACAGCTTTGGA (60) (40) Sybrgreen
인슐린과 같은 성장 인자 결합 단백질 1 (IGFBP1)앞으로 TCCTTTGGGACGCCATCAGTAC (60) (40) Sybrgreen
인슐린과 같은 성장 인자 결합 단백질 1 (IGFBP1) 역 GATGTCTCCTGTGCCTTGGCTA (60) (40) Sybrgreen
GAPDH 지정되지 않은 (시약의 목록 참조) (60) (40) TAQMAN

탈락 마커 표 1. PCR 조건.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

다른 그룹은 콜라게나 4,12,13,15-18를 활용 대부분의 자궁 내막 기질 문화의 제조 방법을 설명하고 적응. 이 논문에서, 우리는 경제적 인 이유와 트립신 및 / 또는 면도날의 편리한 이용 가능 여부 연구실로 활용 둘 중 두 가지 간단한 기본 자궁 내막 배양 방법에 대한 방법론과 증거를 제공했다.

우리의 두 가지 방법을 비교했을 때, 모두가 성공적으로 실행 가능한 차 문화를 생성합니다. 작은 샘플 크기 요구 사항과 높은 수익률은 일반적으로 존재하는 한 우리의 기본 방법은 트립신 방법입니다. 준비 시간이 한정되어있는 경우 트립신 방법을 사용하여 세포를 도금하는 것은 시간 반 이상을 소요하는 반면, 연삭 법은 30 분을 필요로한다.

또한 주목할만한 자궁 내막 생검 반대로 우리가 자궁 적출술의 샘플이 방법을 보여 것입니다. 자궁 내막 바이오psies 상당한 침입하지 않고 찍은 작은 표본을 생산하는 경향이있다. 그래도,이 원고 (특히 트립신 방법)에 설명 된 방법은 자궁 내막 조직 검사에서 배양을 수득한다.

기본 자궁 내막 기질 세포에 대한 많은 응용 프로그램이 있습니다. 다른 포유 동물에 비해 인간의 자궁 내막 기질의 문화를 비교하는 것은 인간이 월경 이유에 대해 수세기 동안 논의 된 문제에 대한 단서를 제공 할 수 있습니다. 체외 배양에 필요한 다른 비경 생리학 연구가있다. 특히 관심 등의 생식주기 19, 20, 21의 기능 이벤트에 후생 유전 학적 분자 이벤트를 연결하고, 심판 11 검토 한 결과 등의 생식주기 이벤트에 대한 통찰력을 제공하는 발견이다.

임상은 자궁 내막의 문화를 공부하고 바이오 마커를 식별 크게 도움이 될생식 장애와 암의 악성 종양의 경우에있어서의. 2006 년과 2010 년 사이, 그것은 740 만 여성과 그들의 파트너는 미국 22 불임 서비스를 사용하는 것이보고되었다. 불임의 중요한 %가 탈락 (23)의 실패에 기인한다. 더욱이, 그러한 불임 증식증 및 자궁 내막증과 같은 자궁 내막 질환 사이의 관계는 단지 최근에 평가되고있다. 고급 자궁 내막 육종은 드문 경우에도, 그것은 치명적일 수 있기 때문에 체외 모델링을 통해 자궁 부인과 암을 연구하는 능력도 매우 중요한 이점입니다. 체외 일차 배양에서 확립함으로써, 우리는 질환과 연관된 분자 사건의 영향을 연구 및 임상 응용 추정을 생성 할 수있다.

결론적으로, 이러한 응용 프로그램의 많은 대표 및 생체 내 모델에서 효과가 발생하는 것은 어렵습니다. 이는 소재의 개발을하게여러 생체 기능이 중요한 연구 기본 자궁 내막 문화를 체외. 이 두 개의 자궁 내막 분리 방법, "긁는 방법"과 "트립신 방법은"자궁 내막 생리와 병리에 대한 우리의 이해를위한 발판을 제공하는 데 도움이됩니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 아무것도 없어.

Acknowledgements

우리는 그들의 이미징 및 현미경 장비의 사용을 위해 박사 타오 댕와 그녀의 실험실의 구성원의 공동 노력을 주셔서 감사합니다. 우리는 또한 자궁 조직으로 우리를 제공하기위한 Biorepository 및 조직 연구 시설 (BTRF) 코어, 제프 하퍼, 버지니아 대학에서 주민 감사합니다. 우리는 도식 개요와 도움 카롤 Szlachta 감사합니다.

Materials

Name Company Catalog Number Comments
0.25 Trypsin or 0.05% Trypsin  Hyclone SH3023602 or SH30004202
1.7 micro Centrifuge Tube   Genesee Scientific 22-272A
1 µl, 20 µl, 200 ml and 1,000 µl Pipette   Genesee Scientific 24-401,24-402, 24-412, 24-430
15 ml Conical Tube  Hyclone 339650
50 ml Conical Tube  Hyclone 339652
6 cm Cell Culture Dish  Thermo scientific 12-556-002
8 well Chambers  Thermo Scientific AB-4162
Acetate  Fisher scientific C4-100
AMV RT Enzyme/Buffer  Bio Labs M077L
Bovine Serum Albumin (BSA)  Fisher Scientific BP-1605-100
Buffered Zinc Formalin  Thermo 59201ZF
Charcoal strip FBS  Fisher NC9019735
Chloroform  Fisher Scientific BP1145-1
Cover slip  Fisher Brand 12-544D
Cyclic AMP (cAMP)  Sigma B7880
DMEM/High Glucose  Hyclone SH30243FS
dNTP  Bioline BIO-39025
Donkey Anti Goat -TRITC  Santa Cruz SC-3855
Donkey Serum  Jackson’s lab 017-000-002
E Cadherin Antibody   Epitomics 1702-1
Ethanol  Fisher Scientific BP2818-1
Fetal Bovine Serum (FBS)  Fisher Scientific 03-600-511
Fungizone Amphotericin B  Gibco 15290-018
GAPDH Probe  Life Technologies HS99999905
Glycogen  5Prime 2301440
Goat Anti Mouse - FITC  Jackson’s Lab 115-096-003
Isopropanol  Fisher Scientific BP2618-1
Kanamycin   Fisher Scientific BP906-5
Medroxyprogesterone acetate (MPA)  Sigma M1629
MeOH (Methanol)  Fisher Scientific A4-08-1
Mounting Media (w/DAPI)  Vector Labratories H-1500
N6 DNA Oligos  Invitrogen
Number 15 Scraper   BD 371615
Pan Cytokeratin  Mouse mAB  Cell Signaling 4545
PBS (phosphate buffered saline)  Fisher Scientific BP-399-4
Penicillin-Streptomycin Glutamine Solution 100X   Hyclone SV30082.01
PML Anti Goat Anti body  Santa Cruz SC-9862
Primer(s)  Eurofins
RPMI  Hyclone SH30027FS
RPMI (Phenol free)  Gibco 11835
Sybr Green   Thermo Scientific AB-4162
Taqman  Thermo AB-4138
Trizol  Life Technologies 15596018
Vimentin Antibody  Epitomics 4211-1

DOWNLOAD MATERIALS LIST

References

  1. Heller, D. in The endometrium: a clinicopathologic approach. Heller, D. 56-75 (1994).
  2. Emera, D., Romero, R., Wagner, G. The evolution of menstruation: a new model for genetic assimilation: explaining molecular origins of maternal responses to fetal invasiveness. Bioessays. 34, 26-35 (2011).
  3. Gudjonsson, T., Villadsen, R., Ronnov-Jessen, L., Petersen, O. W. Immortalization protocols used in cell culture models of human breast morphogenesis. Cell Mol Life Sci. 61, 2523-2534 (2004).
  4. Brosens, J. J., Hayashi, N., White, J. O. Progesterone receptor regulates decidual prolactin expression in differentiating human endometrial stromal cells. Endocrinology. 140, 4809-4820 (1999).
  5. Jones, M. C., et al. Regulation of the SUMO pathway sensitizes differentiating human endometrial stromal cells to progesterone. Proc Natl Acad Sci U S A. 103, 16272-16277 (2006).
  6. Salamonsen, L. A., et al. Proteomics of the human endometrium and uterine fluid: a pathway to biomarker discovery. Fertil Steril. 99, 1086-1092 (2013).
  7. Haouzi, D., Dechaud, H., Assou, S., De Vos, J., Hamamah, S. Insights into human endometrial receptivity from transcriptomic and proteomic data. Reprod Biomed Online. 24, 23-34 (2012).
  8. Chen, J. I., et al. Proteomic characterization of midproliferative and midsecretory human endometrium. J Proteome Res. 8, 2032-2044 (2009).
  9. Talbi, S., et al. Molecular phenotyping of human endometrium distinguishes menstrual cycle phases and underlying biological processes in normo-ovulatory women. Endocrinology. 147, 1097-1121 (2006).
  10. Punyadeera, C., et al. Oestrogen-modulated gene expression in the human endometrium. Cell Mol Life Sci. 62, 239-250 (2005).
  11. Ponnampalam, A. P., Weston, G. C., Susil, B., Rogers, P. A. Molecular profiling of human endometrium during the menstrual cycle. Aust N Z J Obstet Gynaecol. 46, 154-158 (2006).
  12. Zhang, L., Rees, M. C., Bicknell, R. The isolation and long-term culture of normal human endometrial epithelium and stroma. Expression of mRNAs for angiogenic polypeptides basally and on oestrogen and progesterone challenges. J Cell Sci. 108, (1), 323-331 (1995).
  13. Richards, R. G., Brar, A. K., Frank, G. R., Hartman, S. M., Jikihara, H. Fibroblast cells from term human decidua closely resemble endometrial stromal cells: induction of prolactin and insulin-like growth factor binding protein-1 expression). Biol Reprod. 52, 609-615 (1995).
  14. Gellersen, B., Brosens, J. Cyclic AMP and progesterone receptor cross-talk in human endometrium: a decidualizing affair. J Endocrinol. 178, 357-372 (2003).
  15. Marsh, M. M., Hampton, A. L., Riley, S. C., Findlay, J. K., Salamonsen, L. A. Production and characterization of endothelin released by human endometrial epithelial cells in culture. J Clin Endocrinol Metab. 79, 1625-1631 (1994).
  16. Siegfried, J. M., Nelson, K. G., Martin, J. L., Kaufman, D. G. Histochemical identification of cultured cells from human endometrium. In Vitro. 20, 25-32 (1984).
  17. Rawdanowicz, T. J., Hampton, A. L., Nagase, H., Woolley, D. E., Salamonsen, L. A. Matrix metalloproteinase production by cultured human endometrial stromal cells: identification of interstitial collagenase, gelatinase-A, gelatinase-B, and stromelysin-1 and their differential regulation by interleukin-1 alpha and tumor necrosis factor-alpha. J Clin Endocrinol Metab. 79, 530-536 (1994).
  18. Dimitriadis, E., Robb, L., Salamonsen, L. A. Interleukin 11 advances progesterone-induced decidualization of human endometrial stromal cells. Mol Hum Reprod. 8, 636-643 (2002).
  19. Sakai, N., et al. Involvement of histone acetylation in ovarian steroid-induced decidualization of human endometrial stromal cells. J Biol Chem. 278, 16675-16682 (2003).
  20. Logan, P. C., Ponnampalam, A. P., Steiner, M., Mitchell, M. D. Effect of cyclic AMP and estrogen/progesterone on the transcription of DNA methyltransferases during the decidualization of human endometrial stromal cells. Mol Hum Reprod. 19, 302-312 (2013).
  21. Tamura, I., et al. Induction of IGFBP-1 expression by cAMP is associated with histone acetylation status of the promoter region in human endometrial stromal cells. Endocrinology. 153, 5612-5621 (2012).
  22. American Society for Reproductive Medicine: Quick facts about infertility. Available from: http://www.asrm.org/detail.aspx?id=2322 (2013).
  23. Salker, M., et al. Natural selection of human embryos: impaired decidualization of endometrium disables embryo-maternal interactions and causes recurrent pregnancy loss. PLoS One. 5, (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics