Dos métodos para fijar las células humanas primarias endometrial estromales de la histerectomía especímenes

* These authors contributed equally
Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

El establecimiento de los sistemas primarios de células endometriales estromales de cultivo a partir de especímenes de histerectomía es una técnica biológica valiosa y un paso crucial antes de continuar con una amplia gama de objetivos de investigación. Aquí se describen dos métodos utilizados para establecer cultivos de estroma de los tejidos del endometrio resecado quirúrgicamente de pacientes humanos.

Cite this Article

Copy Citation | Download Citations

Jividen, K., Movassagh, M. J., Jazaeri, A., Li, H. Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens. J. Vis. Exp. (87), e51513, doi:10.3791/51513 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Muchos esfuerzos se han dedicado a establecer en sistemas de cultivo celular in vitro. Estos sistemas están diseñados para modelar un gran número de procesos in vivo. Sistemas de cultivos celulares derivados de muestras endometriales humanas no son una excepción. Las aplicaciones varían desde procesos fisiológicos normales cíclicos a patologías endometriales, tales como los cánceres ginecológicos, enfermedades infecciosas, y fallos del aparato reproductor. Aquí, le ofrecemos dos métodos para establecer células estromales endometriales primarios a partir de especímenes de histerectomía endometrio resecado quirúrgicamente. El primer método se conoce como "el método de raspado" e incorpora raspado mecánico utilizando cuchillas quirúrgicas o de afeitar mientras que el segundo método se denomina "el método de tripsina." Este último método utiliza la actividad enzimática de tripsina para promover la separación de células y primaria excrecencia celular. Nos ilustran la metodología paso a paso a través de imágenes digitales y la microscopía. También provide ejemplos de validación de líneas celulares del estroma endometrial por medio de reacciones cuantitativas en tiempo real de la cadena de la polimerasa (qPCR) e inmunofluorescencia (IF).

Introduction

El corpus útero humano se compone de tres capas, la perimetrio (o serosa), el miometrio, y el endometrio. Distinguir cada una de estas capas es un paso importante para establecer líneas celulares del endometrio. El perimetrio es la capa más externa del útero y compone de células delgadas y serosas. El miometrio es la capa gruesa, medio del útero y compuesta de células del músculo liso. El endometrio se identifica como la capa interior del útero e incluye células epiteliales y estromales poblaciones.

El endometrio se subdivide a su vez en la capa basal cuyo tallo población celular es la hipótesis de la repoblación de la capa functionalis aproximadamente cada 28 días 1. La capa functionalis del endometrio humano sufre cambios bioquímicos y morfológicos significativas en la respuesta a las hormonas circulantes. Estas hormonas se derivan de la glándula pituitaria y los ovarios.

Lacoordinó la producción y liberación de hormonas resulta en un ciclo reproductivo. El ciclo reproductivo está diseñado para preparar el endometrio para eventos potenciales de implantación del embrión. En los humanos, el ciclo reproductivo se conoce como "ciclo menstrual" y se divide en tres fases - proliferativa, secretora y menstrual. La fase proliferativa implica la proliferación de la capa de endometrio functionalis mientras que la fase secretora se caracteriza por functionalis maduración. En concreto, las alteraciones extracelulares, secreciones y la diferenciación celular señalan un potencial de implantación. Si la implantación no se produce antes de que el final de la fase secretora, la capa de endometrio functionalis se desprende durante la fase menstrual. La importancia de la menstruación y los acontecimientos que desencadenan el desprendimiento de la capa functionalis todavía se está debatiendo. En los seres humanos, se ha planteado que la menstruación es el resultado de un evento específico mediados de secretora diferenciación fase conocidacomo "decidualization espontánea" 2. En este manuscrito, proporcionamos metodología detallada para ambos métodos de aislamiento de células estromales endometriales, y utilizamos una combinación de inmunofluorescencia e imágenes digitales para demostrar la eficacia de estos enfoques. Además, se aplica una de uso común en modelo in vitro de decidualización espontánea para confirmar el aislamiento de células del estroma endometrial.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Especímenes de histerectomía utilizados en este manuscrito se recogieron en concordancia con un protocolo de ética aprobado por la IRB Universidad numerada IRB-HSR # 14424.

1. Adquisición de la muestra de la Fuente Clínica

  1. Obtener el gobierno y las normas éticas basadas en instituciones y la documentación de aprobación antes de comenzar.
  2. Llevar a cabo todos los pasos en condiciones estériles.
  3. Preservar el tejido derivado del paciente en los medios de comunicación (RPMI o DMEM / de alta glucosa) en un tubo de 50 ml a 4 ° C si la muestra no se puede procesar en la cultura de inmediato. Las muestras pueden conservarse en este estado durante un máximo de 24 horas.
  4. Lavar muestra de tejido tres veces con 1X solución salina tamponada con fosfato estéril (PBS) y desechar la solución entre los lavados.

2. Preparación de líneas celulares primaria mediante el método de raspado

  1. Añadir 4-10 ml de medio de crecimiento (medio RPMI o DMEM / de alta glucosa suplementado con 10% de suero fetal bovino y 1% de penicilina-streptomyCIN) al tejido y añadir Fungizone (/ ml de concentración final 0,25 g) durante 30 min.
  2. Descartar el medio de crecimiento.
  3. Lavar el tejido dos veces con 1X PBS.
  4. Coloque el tejido en una placa de cultivo de 6 cm de células para distinguir entre miometrio y endometrio capas (refiérase a las Figuras 2A-2C para una descripción adicional). Separe el endometrio.
  5. Uso de una hoja de bisturí o la maquinilla de afeitar, seccionar el tejido en trozos pequeños, mientras que rascarse en la placa de cultivo de 6 cm de células. Estos arañazos facilitar la fijación de las células endometriales primarios emergentes. En comparación con el método de tripsina, se necesita más tejido (véase la Figura 2D para una aproximación).
  6. Suavemente, añadir 2 ml de medio de cultivo para el plato rayado (fragmentos de tejido serán visibles e idealmente inmovilizado a partir del movimiento de rasguño).
  7. Transferencia de la placa (s) a una incubadora de cultivo celular designada (37 ° C y 5% de CO 2). Designe un lugar para que las líneas de células primarias, lejos de other placas de cultivo celular. Los cultivos primarios son más sensibles a la infección y la contaminación.
  8. Examine las células bajo un microscopio de luz diaria. Pequeñas poblaciones de células deberían surgir por dos o tres días a partir de alrededor de los tejidos en rodajas (ver Figura 3B).
  9. Para mantener los cultivos, lavar suavemente con 1X PBS y añadir medio de cultivo fresco (2 ml) cada tres días. Cuando aumenta la tasa de proliferación, el medio de crecimiento adicional (3-4 ml) se pueden añadir a la placa de cultivo de 6 cm (s).
    Nota: Durante el lavado y los medios de comunicación los cambios, es probable que se aspiraron piezas de tejido. Esto no va a afectar el crecimiento de células adherentes. Las muestras de tejido deben ser aspirados por el paso subsiguiente (2,10), como es probable que surjan después de una semana de nuevas colonias.
  10. Cuando la placa de 6 cm es aproximadamente el 75 - 80% confluentes (véase la Figura 3B), el paso usando 0,05% de tripsina. Las células primarias no pueden ser pasados ​​por tiempo indefinido - congelar por una placa de células tan pronto como dos o tres placas son maintained. Si se requieren más pasos, siga un protocolo de inmortalización (revisado en Ref. 3).

3. Preparación de líneas celulares primaria mediante el método de tripsina

  1. Coloque un pedazo pequeño de tejido endometrial (ver Figura 2D para una aproximación) en 2 ml de tripsina al 0,25% suplementado con kanamicina (0,03 mg / ml de concentración final).
  2. Incubar el tejido a 37 ° C en la plataforma giratoria durante 30 min.
  3. Brevemente agite el tejido.
  4. Centrifugar la muestra a 200-400 xg durante 2 min y descartar el sobrenadante.
  5. Añadir tripsina fresca y kanamicina.
  6. Incubar el tejido a 37 ° C mientras se hace girar por una hora.
  7. Agite el tejido durante 5-10 segundos.
  8. Añadir 2 ml de medio de crecimiento (suplementado con 10% de suero fetal bovino y 1% de penicilina-estreptomicina) para desactivar la tripsina.
  9. Centrifugar las células a 200-400 xg durante 2-3 min.
  10. Desechar el sobrenadante y añadir 2 ml de cultivoª medios a las células sedimentadas.
  11. Placa sobre una placa de cultivo de 6 cm de células. Raspar la placa como en el Paso 2.5 Preparación de líneas celulares primaria mediante el método de raspado no es necesario, pero facilita la unión y el crecimiento de los cultivos primarios.
  12. Monitorear las células bajo un microscopio de luz diaria. Las células son generalmente visibles con un microscopio óptico después de 24 a 48 horas (ver Figura 3 C).
  13. Para mantener los cultivos, monitorear las células y cambiar el medio cada 2-3 días como en el paso 2.9.
  14. Para el paso de las células, utilizan 0,05% o 0,25% de tripsina cuando las células alcanzan 75-80% de confluencia (véase la Figura 3C).

4. Ahorro de tejido extra for Analysis (Snap Congelación y Fijación de formalina)

  1. Lavar la muestra dos veces con 1X PBS.
  2. Aspirar la mayor cantidad de líquido posible.
  3. Para Snap congelación, coloque la muestra de tejido endometrial en un tubo de centrífuga de 1,7 (ver Figuras 2F y 2G). Coloque el 1,7tubo de centrífuga en nitrógeno líquido durante 10 segundos o hasta que se puede ver que el tejido ha congelado hacia abajo.
    Nota: Tenga cuidado de no tocar directamente el nitrógeno líquido en la preparación de muestras. Las muestras se pueden almacenar a -80 ° C hasta su posterior procesamiento o análisis.
  4. Para la fijación en formol, cortar un pequeño trozo de tejido endometrial (ver Figura 2 H) y sumergirlo en el 10% formalina tamponada zinc. Después de 24 horas, deseche formalina y añadir etanol al 70% para muestras de tejido hasta su posterior procesamiento.

5. Inmunofluorescencia (IF)

  1. La fijación de la célula
    1. Preparar las células en un portaobjetos de la cultura o de la placa.
    2. Suavemente, lavar las células con PBS 1X.
    3. Añadir pre-enfriada (4 º C) metanol y acetona (mezclado en una proporción de 1:1) durante 5 min.
    4. Seque el portaobjetos antes de proceder. Slide se puede almacenar a 4 ° C durante 1-2 semanas si es necesario.
  2. Procesamiento SI
    1. Rehidrate células con 1X PBS durante 10 min. Para la following los pasos 1-6, llevar a cabo todos los lavados e incubaciones en una plataforma giratoria.
    2. Bloquear usando 1X PBS suplementado con 1% albúmina de suero bovino (BSA) y 1% de especies de suero específico (fuente de anticuerpo 2 º) durante 30 min a temperatura ambiente (RT).
    3. Incubar en anticuerpo primario (ver las recomendaciones del fabricante para las diluciones de anticuerpos). Ver Sustancias de anticuerpos específicos. Diluir el anticuerpo primario en tampón de bloqueo fresco como en el Paso 5.2.2. Esta incubación puede llevarse a cabo durante al menos 2 horas a RT o durante la noche a 4 ° C.
    4. Lavar 3 veces con 1X PBS durante 5 min cada uno.
    5. Incubar en anticuerpo secundario (ver las recomendaciones del fabricante para las diluciones de anticuerpos). Diluir el anticuerpo secundario en tampón de bloqueo fresco como en el Paso 5.2.2. Para evitar la foto-blanqueo, es importante llevar a cabo esto y los pasos subsiguientes en la ausencia de luz.
    6. Lavar 3 veces con 1X PBS durante 5 min cada uno.
    7. Thoroughly secar las diapositivas.
    8. Añadir un medio de montaje y solución de contratinción DAPI.
    9. Aplicar cubreobjetos y sellar los bordes usando sellante (s). Los portaobjetos se pueden almacenar a 4 ° C en la oscuridad durante un máximo de 2 semanas.

6. Extracción de ARN

  1. Pellet 1 x 10 7 células por centrifugación. Todos los materiales y reactivos de este protocolo deben RNasa libre.
  2. Lisar células en 1 ml de reactivo de TRIZOL, e incubar las muestras se homogeneizaron durante 10 min a temperatura ambiente para completar la disociación de los complejos de nucleoproteínas.
  3. Añadir 200 l de cloroformo por 1 ml de TRIZOL. Agitar enérgicamente a mano durante 15 segundos y se incuba durante 2-3 minutos a temperatura ambiente.
  4. Se centrifuga a la velocidad máxima (15.000 xg) durante 15 min a 4 ° C. Darán como resultado tres capas.
  5. Pasar la fase acuosa superior a un tubo de microcentrífuga nuevo. Añadir 1 l de glucógeno para aumentar el rendimiento de ARN; Sin embargo, este paso sólo es necesario cuando un pequeñoSe prevé cantidad de ARN.
  6. Añadir 0,5 ml de alcohol isopropílico a la capa acuosa, y invertir las muestras 3-5 veces. Incubar las muestras a temperatura ambiente durante 10 min. Para aumentar el rendimiento, las muestras se pueden colocar en -20 ° C o -80 ° C durante 30 min.
  7. Centrifugar a máxima velocidad durante 10 min a 4 ° C.
  8. En este punto, un pequeño sedimento de ARN debe ser visible. Eliminar el sobrenadante.
  9. Lavar el ARN con 1 ml de etanol al 75%.
  10. Centrifugar a máxima velocidad durante 5 min y descartar el sobrenadante. Las muestras se pueden lavar una vez más para eliminar contaminantes inorgánicos, pero este paso no es necesario.
  11. En pocas palabras, se seca el precipitado de ARN hasta el ARN de pellets está seca (por lo general toma 7-10 min).
    Nota: Un paso adicional puede ser utilizado para disminuir la materia inorgánica y disminuir el tiempo de secado. Después de desechar el sobrenadante del lavado con etanol, las muestras de centrifugado a la velocidad máxima durante un minuto adicional y aspirar líquido residual. Tenga cuidado de no aspirar pellet.
  12. Disolver ARN en agua libre de RNasa, dependiendo del tamaño del sedimento de ARN. Los volúmenes varían típicamente desde 10 hasta 50 l.
  13. Incubar las muestras a 55 ° C durante 10 min, y medir la concentración de ARN.
  14. Almacene las muestras a -20 ° C hasta su posterior procesamiento.

7. Transcripción inversa

  1. Llevar el ARN de la muestra (1-3 mg) hasta un volumen de 9 l con H 2 O.
  2. ARN de calor a 70 ° C durante 10 min.
  3. Para generar una mezcla maestra de AMV, combinar los siguientes reactivos: 5 l de dNTP (concentración de trabajo de 50 mM), 5 l de oligos de ADN N6 (concentración de trabajo de 80 mM), 5 l de tampón 5X de AMV, y 1 l de AMV . Esta solución de mezcla maestra está diseñado por una muestra.
  4. Añadir 16 l de la mezcla maestra a la ARN climatizada. El volumen final de reacción será de 25 l de reacción.
  5. Utilice las siguientes condiciones de PCR para la transcripción inversa: (Etapa 1) 42 ° C durante 90 min, (StaGE 2) 95 ° C durante 5 min, y (Etapa 3) 4 ° C hasta su posterior procesamiento.

8. Tiempo real PCR

  1. Llevar a cabo las reacciones de PCR usando los cebadores, temperaturas de recocido, los números de ciclo, y los reactivos se encuentran en la Tabla 1.
    Nota: Es ideal para seguir las instrucciones del fabricante al usar reactivos de PCR (consulte los números de la empresa y catálogo de Materiales).

9. In vitro Protocolo decidualization (Derivado de Ref. 4 y 5)

  1. Placa células endometriales.
  2. Haga crecer hasta una confluencia del 75-85%.
  3. Después las células se vuelven confluentes, lavar una vez con PBS 1X.
  4. Rápidamente, agregar elementos multimedia sin hormonas (fenol libre de RPMI suplementado con 5% de carbón tira de FBS y 1% de penicilina-estreptomicina).
  5. Después de 24 horas, agregue los medios libres de hormonas complementadas con acetato de medroxiprogesterona (MPA) a una concentración final de 1 mM y 8-bromoadenosine 3 ', 5'Monofosfato cíclico (AMPc) a una concentración final de 0,5 mM.
  6. Después de al menos 48 horas, detener la reacción y salvar a la placa (s) para su posterior procesamiento.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Como se destaca en la sección Protocolo, asegúrese de llevar a cabo todos los métodos en el gobierno, institucionales y directrices éticas al manipular y preparar los tejidos humanos.

Se incluyen en este manuscrito es una ilustración del flujo de trabajo general de "el método de raspado" (Figura 1A) y "el método de tripsina" (Figura 1B) se utiliza para establecer cultivos endometriales primarios. Estos métodos se describen en detalle en la sección de Protocolo (ver partes 1 -. 3.). Ambos métodos tienen éxito en el crecimiento de cultivos endometriales primarios. La ventaja de "el método de raspado" es el tiempo de preparación más corta; Sin embargo, el tiempo que toma para observar células viables es generalmente 2 - 4 veces más larga en comparación con "el método de tripsina."

Se proporcionan las imágenes digitales del tejido humano inicial recibida de la obtención de tejidos. Las capas uterinas se pueden distinguir por latosquedad de la capa, es decir, el miometrio es gruesa y muscular y el endometrio es delgado y más rendimiento. Hemos puesto de relieve la capa gruesa, músculo liso (miometrio) en blanco y se indica la capa endometrial del interés en negro a partir de dos muestras de histerectomía diferentes (Figuras 2A y 2B). En la Figura 2C, los tejidos están orientados con el miometrio hacia arriba mientras que el endometrio se coloca hacia abajo. La capa delgada, perimetrial fue resecado quirúrgicamente y no destaca en estas imágenes. También es importante tener en cuenta que el tamaño de la capa endometrial en estas imágenes digitales de 2 dimensiones está falsificado como la capa 3-dimensional real es muy delgada en comparación con el miometrio.

Disminuir la cantidad de tejido adecuado es importante tanto para "el método de raspado" y "el método de la tripsina." En la Figura 2D, tamaños apropiados se designan para cada método por encima de la muestra respectiva. Utilizando uno 0.5x00.5 x0.5 cm pedazo de "el método de tripsina" [left] es suficiente para establecer una cultura. El tejido de partida representativo para "el método de raspado" [right] incluye todas las capas uterinas. El producto final para "el método de raspado" se representa en la figura 2E, y se recomienda que al menos 1x1x1 cm de tejido endometrial se utiliza para establecer cultivos viables. El requisito para esta muestra de tejido tanto es una desventaja de "el método de raspado."

Tejido restante se utiliza a menudo en numerosas maneras, incluyendo la proteína y análisis de ARN. Para garantizar la preservación de la calidad del tejido, es importante utilizar un método de "instantánea congelación" como en la sección de Protocolo (véase 4.). Este método también se ilustra en la figura 2F y la figura 2G. Ahorrar tejido extra por la fijación en formol es también una práctica común de los patólogos e investigadores. Tejido Preparación para la fijación en formol se describe en el Protocolo Figura 2H.

La microscopía óptica es esencial para el control de los cultivos endometriales primarios. Individuales células del estroma endometrial deben exhibir la morfología de fibroblastos (Figura 3A). "El método de raspado" suele generar grupos de células emergentes tempranos, principalmente a lo largo de los arañazos inducida bisturí (Figura 3B, Día 2). "El método de tripsina" genera tanto clúster y los patrones de crecimiento de células dispersas (Figura 3C, día 4). Hemos incluido varias imágenes representativas de la placa inicial (día 0) a la primera paso de cada método (Figura 3B y 3C).

Muchos tejidos se definen por su expresión de marcadores específicos de tejido tales como actina de músculo liso (SMA) para el músculo liso, células CD34 para las células madre inmunes, etc Mientras que los experimentos de genes y la expresión de la proteína se han llevado a cabo para el endometrio 6-11, un cuartomarcador específico de células del estroma endometrial aún no se ha descubierto. En lugar de ello, los investigadores comúnmente evaluar la pureza estroma de endometrio mediante la medición de marcadores de potenciales contaminantes de la célula. Por ejemplo, se utilizan marcadores de citoqueratina para mostrar poblaciones epiteliales. Sin embargo, es menos de una preocupación, porque el establecimiento y el mantenimiento de los epitelios endometriales son difíciles y por lo general seleccionada contra (Ref. 12 y la Figura 4A). Si las muestras debían ser obtenida durante el embarazo, la expresión positiva de HLA-A,-B,-C demuestra germinales, células trofoblásticas 13. Por otro lado, al igual que otros fibroblastos mesenquimales, células del estroma endometrial expresan vimentina (CDH1). Demostramos con inmunofluorescencia, la expresión de vimentina y la ausencia de citoqueratinas y E cadherina (CDH1) en nuestras células del estroma endometrial establecidos (Figura 4B).

Por último, nos proporcionan la prueba funcional de la cultura endometrial primaria a través de un in vitro de ensayo decidualization espontánea. Este método fue adaptado de Ref. 4 y 5, y consiste en el tratamiento de los cultivos con una combinación de acetato de medroxiprogesterona (MPA) y 8 - bromoadenosine 3 ', 5'-monofosfato cíclico (AMPc) (descrito en 9 in vitro Protocolo decidualization y modelado. en la Figura 5A). En la presencia de AMP y AMPc, las células estromales endometriales muestran los perfiles de expresión de genes alterados significativamente (revisado en Ref. 14). Los marcadores decidualización espontáneas publicados con frecuencia son la prolactina (PRL) y del factor de crecimiento similar a la insulina Binding Protein 1 (IGFBP1) (revisado en Ref. 14). La respuesta de estos dos genes para MPA y cAMP son fuertes indicadores de ambos decidualization espontánea y establecimiento exitoso de una cultura del estroma endometrial. Se demuestra esto en la Figura 5B.


Figura 1. Esquema de los dos métodos principales de aislamiento endometriales. (A) 02.01 a 02.10 Los pasos del método de raspado que se muestra en un organigrama. (B) Pasos 3.1 a 3.14 del método de tripsina que se muestra en un organigrama. Haga clic aquí para ver la imagen más grande.

Figura 2
Figura 2. Procesamiento de tejido uterino. (AC) muestras uterinas clínicas de dos pacientes de sexo femenino. A & C se derivan de paciente 1 y B se deriva del paciente 2. tejido resecado quirúrgicamente uterina (izquierda) y highlightecapas d uterinas (derecha). (A y B) El miometrio es un círculo en blanco y el endometrio en negro. (C) El miometrio se enfrenta a la cámara. (D) tamaños endometriales representativas iniciales de muestra para ambos métodos de aislamiento se indican. El método de tripsina requiere endometrio puro antes de la adición de la tripsina, mientras que el método de raspado puede utiliza la totalidad de los especímenes uterinos. (E) Ejemplo de la muestra de endometrio procesado del método de raspado. (F y G) de imagen de tejido uterino restante está preparado para Snap Congelación. Se muestra un recipiente de metal fabricada en el laboratorio utilizado para este método. (H) La fijación en formalina de la muestra de endometrio. Haga clic aquí para ver la imagen más grande.

Figura 3 Figura 3. Imágenes de microscopía de luz de las culturas endometriales primarios. . (A) Imágenes representativas de los cultivos de células del estroma endometrial tomadas en diversas facultades y confluencia (B) Imágenes representativas del método de raspado (días 0-16) tomado de la misma placa de cultivo, impulsado a 10x Nota:. Líneas visuales indican arañazos de cuchilla quirúrgica (C) Imágenes representativas del método tripsina.. (días 0-16) tomado de la misma placa de cultivo, impulsado a 10x Haga clic aquí para ver la imagen más grande.

Figura 4
Figura 4. Imágenes de inmunofluorescencia de células del estroma endometrial. (A) La inmunofluorescenciade culturas endometriales primarios aislados mediante el método de raspado. Imágenes demuestran la pérdida de citoqueratina entre el paso 2 (P2) y el paso 5 (P5). Proteína de la leucemia promielocítica (PML) de proteínas nucleares y tinción DAPI se utilizaron como controles. (B) Imágenes demuestran la tinción positiva para el marcador mesenquimal vimentina. Las imágenes también muestran tinción negativa para E cadherina (CDH1) y citoqueratina. La tinción de DAPI y la proteína de la leucemia promielocítica (PML) fueron proporcionados como controles. Haga clic aquí para ver la imagen más grande.

La figura 5
Figura 5. Decidualización espontánea de dos células estromales endometriales primarios. (A) Esquema de procedimiento experimental. (B) La regulación por incremento de la prolactina (PRL) yFactor de crecimiento tipo insulina proteína de unión 1 (IGFBP1) la expresión génica en respuesta a AMP y cAMP. Los resultados se midieron a través de RT-qPCR, y la expresión se normalizaron a GAPDH. La significación se calcula utilizando los estudiantes t-test (p <0,001 *** y P <0,0001 ****). Ambas líneas celulares fueron aislados por el método de raspado. Haga clic aquí para ver la imagen más grande.

Cartilla Secuencia El recocido de temperatura (° C) Ciclos Ensayo
La prolactina (PRL) Forward CATATTGCGATCCTGGAATGAGC 60 40 SybrGreen
La prolactina (PRL) Reverse TCCTCAATCTCTACAGCTTTGGA 60 40 SybrGreen
Proteína de unión del factor de crecimiento similar a la insulina 1 (IGFBP1)Adelante TCCTTTGGGACGCCATCAGTAC 60 40 SybrGreen
Proteína de unión del factor de crecimiento similar a la insulina 1 (IGFBP1) Reverse GATGTCTCCTGTGCCTTGGCTA 60 40 SybrGreen
GAPDH Sin especificar (ver lista de reactivos) 60 40 Taqman

Tabla 1. Condiciones de PCR para los marcadores decidualization.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Otros grupos han descrito y adaptado metodología para la preparación de cultivos estromales endometriales, la mayoría de los cuales utilizan colagenasa 4,12,13,15-18. En este manuscrito, hemos proporcionado la metodología y la evidencia de dos métodos de cultivo estromal simplificados primarias endometrial, los cuales son utilizados por nuestro laboratorio por razones económicas y de la disponibilidad adecuada de tripsina y / o una hoja de afeitar.

Al comparar nuestros dos métodos, ambos generan con éxito cultivos primarios viables. Nuestro método preferido es el método de la tripsina, ya que es típicamente un mayor rendimiento con un requisito de tamaño de la muestra más pequeña. Sin embargo, si el tiempo de preparación se limita, el método de raspado requiere 30 minutos, mientras que células en placas utilizando el método de la tripsina tarda más de una hora y media.

También cabe destacar que demostramos estos métodos con muestras de histerectomía en comparación con biopsias endometriales. Bio endometrialpsies se toman sin la intrusión significativa y tienden a producir especímenes más pequeños. Sin embargo, los métodos descritos en este manuscrito (especialmente el método de tripsina) deben producir cultivos de biopsias endometriales.

Existen numerosas aplicaciones para las células estromales endometriales primarios. La comparación de las culturas del estroma endometrial de humano frente a otros mamíferos puede proporcionar pistas sobre las cuestiones que se han debatido durante siglos acerca de por qué los seres humanos menstrúan. Existen otros estudios de fisiología inexploradas que requieren el cultivo in vitro. De particular interés son los descubrimientos que proporcionan conocimientos sobre los eventos del ciclo reproductivo, como los hallazgos que han vinculado eventos moleculares epigenéticos a los eventos funcionales del ciclo reproductivo 19,20, 21, y revisados ​​en la Ref. 11.

Los médicos se beneficiarían mucho de estudiar la cultura del estroma endometrial y la identificación de biomarcadoress en los casos de trastornos de la reproducción y de enfermedades malignas de cáncer. Entre 2006 y 2010, se informó de que 7,4 millones de mujeres y sus parejas utilizan los servicios de infertilidad en los Estados Unidos 22. Un porcentaje importante de la infertilidad se debe al fracaso de decidualization 23. Por otra parte, sólo recientemente se está evaluando la relación entre las enfermedades tales como hiperplasia de endometrio y endometriosis a la infertilidad. La capacidad para estudiar los cánceres ginecológicos uterinos a través de modelos in vitro también es muy valiosa porque a pesar de sarcoma endometrial avanzado es poco frecuente, puede ser mortal. Mediante el establecimiento de cultivos primarios in vitro, se estudia el impacto de los eventos moleculares asociados con las enfermedades y podemos generar aplicaciones clínicas putativos.

En conclusión, es difícil generar representativo y eficaz en modelos in vivo para muchas de estas aplicaciones. Esto hace que el desarrollo de encultivos in vitro endometriales primarios para estudiar varias funciones in vivo crítico. Estos dos métodos de aislamiento de endometrio, "el método de raspado" y "el método de la tripsina," ayudarán a proporcionar el punto de apoyo para nuestra comprensión de la fisiología y patología endometrial.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que la divulgación.

Acknowledgements

Damos las gracias a los esfuerzos de colaboración de Dr. Thao Dang y los miembros de su laboratorio para el uso de su equipo de imagen y el microscopio. También agradecemos al biorepositorio y Tejidos del centro de investigación (BTRF) núcleo, Jeff Harper, y los residentes de la Universidad de Virginia para que nos proporciona el tejido uterino. Damos las gracias a Karol Szlachta por la ayuda con Esquema general.

Materials

Name Company Catalog Number Comments
0.25 Trypsin or 0.05% Trypsin  Hyclone SH3023602 or SH30004202
1.7 micro Centrifuge Tube   Genesee Scientific 22-272A
1 µl, 20 µl, 200 ml and 1,000 µl Pipette   Genesee Scientific 24-401,24-402, 24-412, 24-430
15 ml Conical Tube  Hyclone 339650
50 ml Conical Tube  Hyclone 339652
6 cm Cell Culture Dish  Thermo scientific 12-556-002
8 well Chambers  Thermo Scientific AB-4162
Acetate  Fisher scientific C4-100
AMV RT Enzyme/Buffer  Bio Labs M077L
Bovine Serum Albumin (BSA)  Fisher Scientific BP-1605-100
Buffered Zinc Formalin  Thermo 59201ZF
Charcoal strip FBS  Fisher NC9019735
Chloroform  Fisher Scientific BP1145-1
Cover slip  Fisher Brand 12-544D
Cyclic AMP (cAMP)  Sigma B7880
DMEM/High Glucose  Hyclone SH30243FS
dNTP  Bioline BIO-39025
Donkey Anti Goat -TRITC  Santa Cruz SC-3855
Donkey Serum  Jackson’s lab 017-000-002
E Cadherin Antibody   Epitomics 1702-1
Ethanol  Fisher Scientific BP2818-1
Fetal Bovine Serum (FBS)  Fisher Scientific 03-600-511
Fungizone Amphotericin B  Gibco 15290-018
GAPDH Probe  Life Technologies HS99999905
Glycogen  5Prime 2301440
Goat Anti Mouse - FITC  Jackson’s Lab 115-096-003
Isopropanol  Fisher Scientific BP2618-1
Kanamycin   Fisher Scientific BP906-5
Medroxyprogesterone acetate (MPA)  Sigma M1629
MeOH (Methanol)  Fisher Scientific A4-08-1
Mounting Media (w/DAPI)  Vector Labratories H-1500
N6 DNA Oligos  Invitrogen
Number 15 Scraper   BD 371615
Pan Cytokeratin  Mouse mAB  Cell Signaling 4545
PBS (phosphate buffered saline)  Fisher Scientific BP-399-4
Penicillin-Streptomycin Glutamine Solution 100X   Hyclone SV30082.01
PML Anti Goat Anti body  Santa Cruz SC-9862
Primer(s)  Eurofins
RPMI  Hyclone SH30027FS
RPMI (Phenol free)  Gibco 11835
Sybr Green   Thermo Scientific AB-4162
Taqman  Thermo AB-4138
Trizol  Life Technologies 15596018
Vimentin Antibody  Epitomics 4211-1

DOWNLOAD MATERIALS LIST

References

  1. Heller, D. in The endometrium: a clinicopathologic approach. Heller, D. 56-75 (1994).
  2. Emera, D., Romero, R., Wagner, G. The evolution of menstruation: a new model for genetic assimilation: explaining molecular origins of maternal responses to fetal invasiveness. Bioessays. 34, 26-35 (2011).
  3. Gudjonsson, T., Villadsen, R., Ronnov-Jessen, L., Petersen, O. W. Immortalization protocols used in cell culture models of human breast morphogenesis. Cell Mol Life Sci. 61, 2523-2534 (2004).
  4. Brosens, J. J., Hayashi, N., White, J. O. Progesterone receptor regulates decidual prolactin expression in differentiating human endometrial stromal cells. Endocrinology. 140, 4809-4820 (1999).
  5. Jones, M. C., et al. Regulation of the SUMO pathway sensitizes differentiating human endometrial stromal cells to progesterone. Proc Natl Acad Sci U S A. 103, 16272-16277 (2006).
  6. Salamonsen, L. A., et al. Proteomics of the human endometrium and uterine fluid: a pathway to biomarker discovery. Fertil Steril. 99, 1086-1092 (2013).
  7. Haouzi, D., Dechaud, H., Assou, S., De Vos, J., Hamamah, S. Insights into human endometrial receptivity from transcriptomic and proteomic data. Reprod Biomed Online. 24, 23-34 (2012).
  8. Chen, J. I., et al. Proteomic characterization of midproliferative and midsecretory human endometrium. J Proteome Res. 8, 2032-2044 (2009).
  9. Talbi, S., et al. Molecular phenotyping of human endometrium distinguishes menstrual cycle phases and underlying biological processes in normo-ovulatory women. Endocrinology. 147, 1097-1121 (2006).
  10. Punyadeera, C., et al. Oestrogen-modulated gene expression in the human endometrium. Cell Mol Life Sci. 62, 239-250 (2005).
  11. Ponnampalam, A. P., Weston, G. C., Susil, B., Rogers, P. A. Molecular profiling of human endometrium during the menstrual cycle. Aust N Z J Obstet Gynaecol. 46, 154-158 (2006).
  12. Zhang, L., Rees, M. C., Bicknell, R. The isolation and long-term culture of normal human endometrial epithelium and stroma. Expression of mRNAs for angiogenic polypeptides basally and on oestrogen and progesterone challenges. J Cell Sci. 108, (1), 323-331 (1995).
  13. Richards, R. G., Brar, A. K., Frank, G. R., Hartman, S. M., Jikihara, H. Fibroblast cells from term human decidua closely resemble endometrial stromal cells: induction of prolactin and insulin-like growth factor binding protein-1 expression). Biol Reprod. 52, 609-615 (1995).
  14. Gellersen, B., Brosens, J. Cyclic AMP and progesterone receptor cross-talk in human endometrium: a decidualizing affair. J Endocrinol. 178, 357-372 (2003).
  15. Marsh, M. M., Hampton, A. L., Riley, S. C., Findlay, J. K., Salamonsen, L. A. Production and characterization of endothelin released by human endometrial epithelial cells in culture. J Clin Endocrinol Metab. 79, 1625-1631 (1994).
  16. Siegfried, J. M., Nelson, K. G., Martin, J. L., Kaufman, D. G. Histochemical identification of cultured cells from human endometrium. In Vitro. 20, 25-32 (1984).
  17. Rawdanowicz, T. J., Hampton, A. L., Nagase, H., Woolley, D. E., Salamonsen, L. A. Matrix metalloproteinase production by cultured human endometrial stromal cells: identification of interstitial collagenase, gelatinase-A, gelatinase-B, and stromelysin-1 and their differential regulation by interleukin-1 alpha and tumor necrosis factor-alpha. J Clin Endocrinol Metab. 79, 530-536 (1994).
  18. Dimitriadis, E., Robb, L., Salamonsen, L. A. Interleukin 11 advances progesterone-induced decidualization of human endometrial stromal cells. Mol Hum Reprod. 8, 636-643 (2002).
  19. Sakai, N., et al. Involvement of histone acetylation in ovarian steroid-induced decidualization of human endometrial stromal cells. J Biol Chem. 278, 16675-16682 (2003).
  20. Logan, P. C., Ponnampalam, A. P., Steiner, M., Mitchell, M. D. Effect of cyclic AMP and estrogen/progesterone on the transcription of DNA methyltransferases during the decidualization of human endometrial stromal cells. Mol Hum Reprod. 19, 302-312 (2013).
  21. Tamura, I., et al. Induction of IGFBP-1 expression by cAMP is associated with histone acetylation status of the promoter region in human endometrial stromal cells. Endocrinology. 153, 5612-5621 (2012).
  22. American Society for Reproductive Medicine: Quick facts about infertility. Available from: http://www.asrm.org/detail.aspx?id=2322 (2013).
  23. Salker, M., et al. Natural selection of human embryos: impaired decidualization of endometrium disables embryo-maternal interactions and causes recurrent pregnancy loss. PLoS One. 5, (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics