Histerektomi Örneklerden İlköğretim İnsan endometrial stroma hücrelerinde Kurulması İçin İki Yöntem

* These authors contributed equally
Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Histerektomi örneklerden primer endometrial stromal hücre kültürü sistemlerinin kurulması, önceki araştırma amaçlayan geniş bir dizi takip için değerli bir biyolojik teknik ve çok önemli bir adımdır. Burada, insan hasta cerrahi olarak kesilmiş dokuları endometriyal stromal kültürleri oluşturmak için kullanılan iki yöntem tarif eder.

Cite this Article

Copy Citation | Download Citations

Jividen, K., Movassagh, M. J., Jazaeri, A., Li, H. Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens. J. Vis. Exp. (87), e51513, doi:10.3791/51513 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Pek çok çabalar vitro hücre kültür sistemleri kurmak için tahsis edilmiştir. Bu sistemler, in vivo işlemler geniş bir model numarası tasarlanmıştır. İnsan endometriyal örnekleri kaynaklanan hücre kültürü sistemleri bir istisna vardır. Uygulamalar normal siklik fizyolojik süreçler böyle jinekolojik kanserler, bulaşıcı hastalıklar ve üreme eksiklikleri gibi endometrial patolojilerin değişir. Burada, biz, cerrahi rezeksiyon, endometrial histerektomi örneklerden birincil endometrial stromal hücreler kurmak için iki yöntem sağlar. İlk yöntem, "kazıma yöntemi" olarak adlandırılır ve ikinci yöntem adlandırılır ise, cerrahi ya da tıraş bıçakları kullanılarak, mekanik kazıma içeren bir "tripsin yöntemi." Bu ikinci yöntem, hücrelerin ayrılmasını teşvik etmek için birincil ve tripsin enzimatik aktivitesini kullanır hücre akıbet. Biz dijital görüntü ve mikroskobu ile adım-adım yöntemi açıklamak. Ayrıca providkantitatif gerçek zamanlı polimeraz zincir reaksiyonları (qPCR) ve immünfloresansta (IF) üzerinden endometrial stromal hücre hatları doğrulamak için e örnekleri.

Introduction

Insan uterus gövdesi üç tabakadan, perimetrium (ya da salgılı zarı), myometrium ve endometrium oluşur. Bu tabakaların her biri ayırt endometrial hücre serilerini kurmak için önemli bir adımdır. Perimetrium rahim en dış tabaka ve ince, seröz hücrelerden oluşur. Myometrium kalın, orta rahim tabakası ve yumuşak kas hücrelerinin oluşur. Endometrium rahim iç tabaka olarak tanımlanmıştır ve epitel ve stromal hücre popülasyonları içerir.

Endometrium ayrıca olan kök hücre popülasyonunun yaklaşık olarak her 28 günde bir 1 functionalis tabaka yeniden doldurmak için hipotezi basalis tabaka halinde bölünmüştür. İnsan endometrium tabakası functionalis hormonları dolaşan yanıt önemli biyokimyasal ve morfolojik değişikliklere uğrar. Bu hormonlar hipofiz bezi ve yumurtalıklar türetilir.

bir üreme döngüsü koordine üretim ve hormonlar sonuçların serbest. Üreme döngüsü potansiyel embriyo implantasyon olaylar için endometrium hazırlamak için tasarlanmıştır. İnsanlarda, üreme döngüsü "adet döngüsü" olarak bilinen ve üç evreye ayrılır - çoğalma, salgı ve adet. Salgı faz functionalis olgunlaşması ile işaretlenmiş ise çoğalma fazı functionalis endometrial tabakanın proliferasyonunu içerir. Spesifik olarak, hücre dışı değişiklikler, salgılar ve hücresel farklılaşma potansiyel implantasyonu işaret etmektedir. Implantasyon salgı aşamasının bitiminden önce oluşmazsa, functionalis endometrium tabakası adet aşamasında dökülüyor. Âdet ve functionalis tabakasının dökülmesini tetikleyen olayların önemi hala tartışılmaktadır. İnsanlarda, bu adet bilinen özel bir orta salgı faz farklılaşması olayın sonucu olduğunu ortaya edilmiştir"spontane sidualizasyonu" 2 olarak. Bu yazıda, iki endometrial stromal hücre izolasyon yöntemleri için detaylı metodoloji sağlamak ve bu yaklaşımların etkinliğini göstermek için immünofloresans ve dijital görüntülerin bir arada kullanın. Ayrıca, yaygın olarak uygulanır endometriyal stromal hücre izolasyonu teyit etmek için kendiliğinden desidualizasyon in vitro modelde kullanılan a.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Bu yazıda kullanılan histerektomi örnekleri IRB-HSR # 14424 sayılı Üniversite IRB-onaylı etik protokolü ile uyum içinde toplanmıştır.

Klinik Kaynak 1. Örnek Edinme

  1. Başlamadan önce hükümeti ve kurum-temelli etik kuralları ve onay belgeleri edinmek.
  2. Steril şartlarda tüm adımları Davranış.
  3. Numune hemen kültüründe işlenemez 4 ° C de, 50 ml bir tüp içinde ortam (RPMI ya da DMEM / yüksek glukozlu) hasta türetilen dokuları korur. Numuneler, 24 saat bir süre için bu halde saklanabilir.
  4. 1X steril fosfat tamponlu tuzlu su (PBS) ile bir doku örneği, üç kez yıkanır ve yıkamalar arasında solüsyonu atın.

Kazıma Yöntemi kullanılarak Primer Hücre Hatları 2. Hazırlanması

  1. Büyüme ortamı (RPMI veya% 10 Fetal Sığır Serumu ve% 1 Penisilin-streptomy ile takviye edilmiş DMEM / Yüksek Glikoz 4-10 ml ekleyincin) dokuya ve 30 dakika boyunca fungizon (0.25 ug / ml nihai konsantrasyon) ekleyin.
  2. Büyüme ortamı atın.
  3. 1X PBS ile iki kez doku yıkayın.
  4. Miyometriyum ve endometriyum katmanları (Şekil daha fazla bilgi için bakınız Şekil 2A-2C) ayırt etmek için 6 cm hücre kültür plakası üzerine doku yerleştirin. Endometrium ayırın.
  5. 6 cm hücre kültürü çanak üzerine çizilmemesi ise bir neşter veya jilet kullanarak, küçük parçalar halinde doku transect. Bu çizikler çıkan birincil endometrial hücrelerin bağlanmasını kolaylaştırır. Tripsin yöntem ile karşılaştırıldığında, daha fazla doku (bir yaklaşım Şekil 2D bakınız) gereklidir.
  6. Yavaşça, çizik tabak (doku parçaları görünür ve ideal tırmalama hareketinden hareketsiz olacak) büyüme ortamı 2 ml ekleyin.
  7. Belirli bir hücre kültürü inkübatöründe için plaka (lar) aktarın (37 ° C ve% 5 CO2). Uzak oth, primer hücre hatları için bir yer tayinHücre kültür tabakları er. Primer kültürler enfeksiyon ve kontaminasyon daha duyarlıdır.
  8. Günlük ışık mikroskobu altında hücreleri inceleyin. Küçük hücre popülasyonları (Şekil 3B) dilimlenmiş dokuların etrafında güne iki veya üç tarafından ortaya olmalıdır.
  9. , Kültürleri korumak 1X PBS ile hafifçe yıkayın ve her üç günde bir, taze büyüme ortamı (2 ml) ekleyin. Proliferasyon hızı artar, daha fazla büyüme ortamı (3-4 mi) 6 cm kültür plakasına (lar) ilave edilebilir olduğunda.
    Not: yıkama ve ortam değişiklikleri sırasında, doku parçaları büyük olasılıkla aspire edilecektir. Bu yapışık hücre büyümesini etkilemez. Yeni koloniler bir hafta sonra ortaya vermemektedirler gibi doku parçaları bir sonraki aşamada (2.10) tarafından aspire edilmelidir.
  10. % 0.05 tripsin kullanılarak% 80 birleşmiş (Şekil 3B), pasaj - 6 cm plaka yaklaşık 75 olduğunda. Birincil hücreler süresiz pasajlandığında edilemez - iki ya da üç tabak ma kısa sürede hücrelerin bir tabak aşağı dondurmakintained. Daha fazla geçit gerekiyorsa, (Ref 3 gözden) bir ölümsüzleşme protokolünü uygulayın.

Tripsin Yöntemi kullanılarak Primer Hücre Hatları 3. Hazırlanması

  1. Kanamisin (0.03 mg / ml son konsantrasyon) ile takviye edilmiş% 0.25 tripsin ve 2 ml endometrial doku küçük bir parça (bir yaklaşım Şekil 2D bakınız) yerleştirin.
  2. 30 dakika süreyle dönen bir platform 37 ° C'de doku inkübe edin.
  3. Kısaca doku girdap.
  4. 2 dakika boyunca 200-400 xg'de örnek santrifüj ve süpernatant atın.
  5. Taze tripsin ve Kanamisini ekleyin.
  6. Bir saat boyunca dönerken 37 ° C'de doku inkübe edin.
  7. 5-10 saniye için doku vorteksleyin.
  8. Tripsin devre dışı bırakmak için (% 10 Fetal Sığır Serumu ve% 1 penisilin-streptomisin ile takviye edilmiş) 2 ml büyüme ortamı ekleyin.
  9. 2-3 dakika boyunca 200-400 xg'de Santrifüj hücreleri.
  10. Süpernatantı atın ve büyümeye 2 ml ekleyintopak hücrelere th ortam.
  11. 6 cm hücre kültürü çanak üzerine Plate. Kazıma Yöntemi kullanılarak primer hücre hatları hazırlanması Aşama 2.5 ile plaka kazınması gerekli değildir, ancak primer kültürlerin eki ve büyümesini artırır.
  12. Günlük ışık mikroskobunda hücreyi izleyin. Hücreler (Şekil 3C), 24-48 saat sonra, bir ışık mikroskobu altında genellikle görebilir.
  13. Kültürleri korumak için, hücreleri izlemek ve Aşama 2.9 'da olduğu gibi her 2-3 günde bir ortam değiştirin.
  14. Hücreler% 75-80 konfluense (Şekil 3C) ulaştıklarında geçişi için hücreler,% 0.05 ya da% 0.25 tripsin kullanın.

4. Ekstra Analiz Doku (Yapış Dondurma ve Formalin Fixation) Tasarruf

  1. 1X PBS ile iki kez numune yıkayın.
  2. Mümkün olduğu kadar sıvı aspire.
  3. Yapış Donma için, (Şekil 2F ve 2G bakınız) 1.7 santrifüj tüpüne endometriyal doku örneği yerleştirin. 1,7 yerleştirinSantrifüj tüpü 10 saniye boyunca sıvı azot ya da kadar donmuş doku aşağı olduğu görülmektedir.
    Not: örnekleri hazırlarken doğrudan sıvı azot dokunmamaya özen gösterin. Numuneler, daha ileri işleme veya analiz edilinceye kadar -80 ° C'de muhafaza edilebilir.
  4. Formalin fiksasyonu için, endometriyal doku (Şekil 2H bakınız) küçük bir parça kesip, ve% 10 tamponlu formalin çinko daldırın. 24 saat sonra, formalin atmak ve tekrar işlenene kadar doku numunelerini,% 70 etanol ekleme.

5. İmmünofloresan (IF)

  1. Hücre sabitleme
    1. Bir kültür slayt veya tabakta hücreleri hazırlayın.
    2. Yavaşça, 1X PBS ile hücreleri yıkayın.
    3. 5 dakika boyunca (bir 1:1 oranında karıştırılmış) önceden soğutulmuş (4 ° C) bir metanol ve aseton ekleyin.
    4. Hava geçmeden önce slayt kurulayın. Gerekirse Slide 1-2 hafta boyunca 4 ° C'de saklanabilir.
  2. İşlem IF
    1. 10 dakika boyunca 1X PBS ile hücreler rehidrate. FO içinllowing dönen bir platform üzerinde tüm yıkar ve inkubasyon yapmak, 1-6 adımları.
    2. 1X PBS kullanılarak blok,% 1 Sığır Serum Albümini (BSA) ile takviye edilmiş ve oda sıcaklığında (RT) 30 dakika boyunca% 1 türe özel serum (2. antikor kaynağı).
    3. (Antikor dilüsyonları için üreticilerin tavsiyelerine bakın) primer antikor inkübe. Özel antikorlar için malzemeler bakınız. Aşama 5.2.2 'de olduğu gibi, taze bloke edici tampon birincil antikor seyreltin. Bu inkübasyon, oda sıcaklığında ya da gece boyunca 4 ° C'de en az 2 saat boyunca yapılabilir
    4. 5 dakika her biri için 1X PBS ile 3 kez yıka.
    5. (Antikor dilüsyonları için üreticilerin tavsiyelerine bakın) ikincil antikor inkübe edin. Adım 5.2.2 gibi taze engelleme tamponda ikincil antikor sulandırmak. Foto-ağartma önlemek için, ışık yokluğunda bu ve daha sonraki adımlar yapmak için önemlidir.
    6. 5 dakika her biri için 1X PBS ile 3 kez yıka.
    7. Thoroughly slaytlar kurulayın.
    8. Montaj ortamı ve DAPI karşı boyama solüsyonu ekleyin.
    9. Lamel uygulayın ve yapıştırıcı (ler) kullanarak kenarları mühür. Slaytlar kadar 2 hafta boyunca karanlıkta 4 ° C'de saklanabilir.

6.. RNA Ekstraksiyon

  1. Santrifüj ile x 1 10 7 hücrelerinin Pelet. Bu protokol tüm malzemeler ve reaktifler ücretsiz RNAz edilmelidir.
  2. 1 ml Trizol reaktifi ve nükleoprotein kompleksleri ayrılmasını tamamlamak için oda sıcaklığında 10 dakika boyunca homojenize örnekleri inkübe olarak Hücreleri,.
  3. Trizol 1 ml kloroform başına 200 ul ekle. 15 saniye boyunca elle kuvvetli bir şekilde çalkalanır ve oda sıcaklığında 2-3 dakika inkübe edilir.
  4. 4 ° C'de 15 dakika süreyle maksimum hızda (15,000 xg) santrifüje Üç katmanları neden olacaktır.
  5. Yeni bir mikrosantrifüj tüpü içine üst sulu faz transfer. RNA verimi artırmak için 1 ul glikojen ekleyin; Ancak bu adım sadece gerekli olduğunda, küçük birRNA miktarı tahmin edilmektedir.
  6. Sulu tabakaya, izopropil alkol, 0.5 ml ilave edilir, ve örnekler 3-5 kez ters çevirin. 10 dakika boyunca oda sıcaklığında inkübe edin. Verimini artırmak için, numuneler, 30 dakika boyunca -20 ° C veya -80 ° C de yerleştirilebilir.
  7. 4 ° C'de 10 dakika maksimum hızda santrifüje
  8. Bu noktada, RNA küçük topak görünür olmalıdır. Süpernatant atın.
  9. % 75 etanol içinde 1 ml RNA yıkayın.
  10. 5 dakika boyunca maksimum hızda santrifüj ve süpernatant atın. Numuneler, bir kez inorganik kirletici maddeleri kurtulmak için daha yıkanabilir, fakat bu adım gerekli değildir.
  11. RNA pelet kuru kadar kısa bir süre (genellikle 7-10 dakika sürer) RNA pelet kurulayın.
    Not: Bir ek adım inorganik maddeler azalır ve kurutma süresini azaltmak için kullanılabilir. Ek bir dakika ve aspirat kalıntı sıvı için maksimum hızda etanol yıkaması, spin örneklerinden süpernatant atılmasından sonra. Pelet aspire etmemeye dikkat edin.
  12. RNA pelet boyutuna bağlı olarak, RNase-içermeyen su içinde RNA çözülür. Hacimleri 10-50 ul arasında değişir.
  13. 10 dakika boyunca 55 ° C'de inkübe edin ve RNA konsantrasyonları ölçülür.
  14. Daha sonra işlenene kadar -20 ° C'de saklayın örnekleri.

7. Ters Transkripsiyon

  1. H2O ile 9 ul bir hacme örnek RNA (1-3 ug) getirin
  2. 10 dakika boyunca 70 ° C'ye kadar ısı RNA.
  3. DNTP 5 ul (50 uM çalışma konsantrasyonu), N6 DNA oligo 5 ul (80 uM çalışma konsantrasyonu), 5X AMV tampon çözeltiden 5 ul ve AMV 1 ul: Bir AMV ana karışımı oluşturmak için, aşağıdaki reaktifler kombine . Bu ana karışımı çözelti bir numune başına tasarlanmıştır.
  4. Isıtmalı RNA'ya ana karışımı 16 ul ekleyin. Nihai reaksiyon hacmi 25 ul reaksiyon olacaktır.
  5. (Aşama 1), 90 dakika boyunca 42 ° C, (Sta: ters transkripsiyon için, aşağıdaki koşulları kullanarak PCR5 dakika ve daha sonra işlenene kadar (Aşama 3), 4 ° C ge 2) 95 ° C.

8. Real Time PCR

  1. Tablo 1 'de bulunan primerler, tavlama sıcaklıkları, devir sayıları ve reaktif maddeler kullanılarak PCR reaksiyonları yürütmek için.
    Not: (Malzeme şirket ve katalog numaraları bakınız) PCR bileşenlerini kullanırken üretici talimatları takip etmek için idealdir.

9. (Ref. 4 ve 5'te elde edilir) In vitro desidualizasyon Protokol

  1. Endometrial hücreler Plate.
  2. % 75-85 bir konfluansa kadar büyür.
  3. Hücreler konfluent hale sonra, 1X bir kez PBS ile yıkayın.
  4. Çabuk, (Fenol RPMI% 5 kömür şerit FBS ve% 1 penisilin-streptomisin ile takviye edilmiş) hormonsuz ortam ekleyin.
  5. 24 saat sonra, 1 uM 8-3 Bromoadenosine bir son konsantrasyonda medroksiprogesteron asetat (MPA) ile desteklenmiş Hormonsuz ortam ', 5' ekleme0.5 mM'lik bir son konsantrasyonda-siklik monofosfat (cAMP).
  6. En az 48 saat sonra, reaksiyonu durdurmak ve daha ileri işleme için plaka (lar) kaydedin.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Protokol bölümünde vurgulandığı gibi, insan doku kullanımı ve hazırlarken tüm kurumsal hükümet altında yöntemleri ve etik kurallara yapmak için emin olun.

"Kazıma yöntemi" genel iş akışı bir örnek (Şekil 1A) ve primer endometrial kültürleri kurmak için kullanılan "tripsin metodu" (Şekil 1B) bu yazının da dahildir. Bu yöntemler Protokol bölümünde ayrıntılı olarak tarif edilmiştir (parça 1 e bakınız -. 3..). Her iki yöntem de, birincil endometrial kültürlerin büyümesinin başarılı kanıtlamaktadır. Avantaj "kazıma yöntemi" kısaltılmış hazırlık zamanı için; göre 4 kat daha uzun - ancak, bu canlı hücreleri gözlemlemek için gereken zamanı 2 genellikle "tripsin yöntemi."

Doku tedarik alınan ilk insan dokusunda dijital görüntüler sağladı. Rahim tabakaları ile ayırt edilebilirTabakanın irilik, myometrium yani kalın ve kas ve endometrium ince ve daha verimli olduğunu. Biz beyaz kalın, düz kas tabakası (myometrium) vurgulanmış ve iki farklı histerektomi numuneler (Şekil 2A ve 2B) siyah ilgi endometrium tabakası hatlarıyla. Şekil 2C, dokular endometrium aşağı konumlandırılmış iken miyometriyum yukarı bakacak şekilde yönlendirilmiştir. İnce, perimetrial tabaka cerrahi rezeksiyon ve bu görüntüleri vurgulanan değildi. Bu dijital 2 boyutlu görüntüler endometrial tabakanın boyutu gerçek 3 boyutlu tabaka myometrium kıyasla çok ince olduğu gibi yanlış olduğuna dikkat etmek de önemlidir.

Uygun doku boyutunu Kesme "kazıma yöntemi" ve her ikisi için önemli olan "tripsin yöntemi." Şekil 2B, uygun boyutlarda ayrı ayrı numunenin üstüne, her yöntem için belirlenir. Bir 0.5x0 kullanma"Tripsin yöntemi" [left] .5 x0.5 cm parça kültürünün yerleşmesi için yeterlidir. "Kazıma yöntemi" [sağ] için temsili başlangıç ​​dokusu tüm rahim katmanları içerir. "Kazıma yöntemi" için nihai ürün, Şekil 2E'de temsil edilir, ve endometriyal dokunun en az 1x1x1 cm uygun bir kültürleri oluşturmak için kullanılması önerilir. Bu çok doku numunesi için gereksinim bir dezavantaj "kazıma yöntemi."

Kalan doku çoğunlukla proteini içeren ve RNA analizleri çeşitli şekillerde kullanılmaktadır. Doku kalitesinin korunmasını sağlamak için, (4'e bakın.) Protokol bölümünde olduğu gibi bir "ani dondurularak" yöntemini kullanmak önemlidir. Bu yöntem aynı zamanda Şekil 2F ve 2G Şekil 'de gösterilmiştir. Formalin fiksasyonu ekstra doku tasarrufu da patologlar ve araştırmacıların yaygın bir uygulamadır. Formalin fiksasyonu için hazırlanıyor doku Protokolü anlatılan Şekil 2H'de resimli.

Işık mikroskopisi birincil endometrial kültürleri izlenmesi için gereklidir. Bağımsız endometriyal stromal fibroblast hücrelerin morfolojisi (Şekil 3A) göstermelidir. "Kazıma yöntemi", tipik olarak esas olarak bisturi kaynaklı çizik (Şekil 3B, Gün 2) boyunca, erken ortaya çıkan hücre kümeleri oluşturur. "Tripsin yöntemi" küme ve dağınık hücre büyüme modelleri (Şekil 3C, Gün 4) hem de üretir. Her yöntemiyle (Şekil 3B ve 3C) ilk geçişi için ilk kaplama (gün 0) itibaren bir kaç temsili görüntü dahil ettik.

Geni ve protein ekspresyon deneyleri endometriyum 6-11, en-için yapılmıştır da birçok dokular vs bağışıklık kök hücreleri, düz kas, CD34 için düz kas aktin (SMA), gibi dokuya özel belirteçler onların ifadesi ile tanımlanmaktadırdometrial stromal hücre özel markör henüz tespit edilmesi gerekir. Bunun yerine, araştırmacılar genellikle potansiyel hücre kirliliklerden belirteçleri ölçülerek endometrial stroma saflığı değerlendirmek. Örneğin, sitokeratin belirteçler epitel popülasyonları göstermek için kullanılır. Kurulması ve endometrial epitelyum zor ve genelde (Ref 12 ve Şekil 4A), karşı seçilir muhafaza Ancak, bu, bir endişe daha azdır. Numuneler hamilelik, HLA-A pozitif ekspresyonu sırasında elde edilecek olursa,-B,-C germ, trofoblast hücrelerin 13 göstermektedir. Öte yandan, diğer mezenşimal fibroblastlar gibi, endometriyal stromal hücreleri vimentin (CDH1) ifade eder. Biz immünofloresans, vimentin ifadesi ve bizim kurulan endometrial stromal hücreleri (Şekil 4B) sitokeratin ve E kadherin (CDH1) yokluğu ile göstermek.

Son olarak, bir i ile birincil endometrial kültür fonksiyonel kanıtn spontan sidualizasyonu deneyi vitro. Bu yöntem, Referans 4 ve 5 uyarlanmıştır ve medroksiprogesteron asetat (MPA) ve 8 bir kombinasyonu ile kültürlerin muamele edilmesini içerir edilmiş - Bromoadenosine 3 ', 5'-siklik monofosfat 9'da tarif edildiği gibi (cAMP) (In vitro desidualizasyon protokol ve model. Şekil 5A). MPA ve cAMP varlığında, endometriyal stromal hücreler (Ref 14 gözden) önemli ölçüde değiştirilmiş gen ekspresyon profillerini gösterir. Sık sık yayınlanan spontan sidualizasyonu belirteçleri prolaktin (PRL) ve Protein 1 (IGFBP1) Cilt İnsülin benzeri Büyüme Faktörü (Ref 14 gözden). MPA ve cAMP için bu iki genin yanıt kendiliğinden desidualizasyon ve endometriyal stromal kültürünün başarılı kurulması hem de güçlü bir göstergesidir. Biz, Şekil 5B'de bu göstermektedir.


Şekil 1. İki birincil endometrial izolasyon yöntemleri şematik. (A) (B). Bir organizasyon şemasında gösterilen kazıma yöntemi 2,1-2,10 adımları bir organizasyon şemasında gösterilen tripsin yöntemi 3,1-3,14 adımları. resmi büyütmek için buraya tıklayın.

Şekil 2,
Şekil 2.. Rahim dokusu işleniyor. Iki kadın hastaların (AC) Clinical rahim örnekleri. Hasta A & C 1 'den türetilen ve oda Hasta 2 elde edilir. Cerrahi olarak kesilmiş rahim dokusu (sol) ve highlighted rahim katmanları (sağda). (A & B) miyometriyum siyah beyaz ve endometrium daire içinde. (C) miyometriyum kamera karşı karşıya. (D) hem de izolasyon yöntemleri için ilk temsili endometrial örnek boyutları gösterilir. Kazıma yöntemi, tüm rahim örnekleri de kullanır ise tripsin yöntem olup, tripsin ilave edilmeden önce saf endometrium gerektirir. Kazıma yöntemin işleme endometrial numunesinin (E) Örnek. (F ve G) Snap hazırlanan kalan rahim dokusu görüntü Dondurucu. Gösterilen bu yöntem için kullanılan bir laboratuvar yapımı metal kaptır. (H) endometriyal numune formalin fiksasyonu. resmi büyütmek için buraya tıklayın.

Şekil 3, Şekil 3.. Primer endometrial kültürlerin Işık mikroskobu görüntüleri. . (A) çeşitli güçlerde ve confluency alınan endometrial stromal hücre kültürlerinin Temsilcisi görüntüleri (B) kazıma yöntemi (Gün 0 - 16) Temsilcisi görüntüleri 10x güç aynı kültür çanak, alınan Not:. Görsel çizgiler çizikleri gösteriyor cerrahi bıçak tripsin yöntemi (C) Temsilcisi görüntüler.. (Gün 0 - 16) 10x güç aynı kültür çanak, alınan büyük resmi görebilmek için buraya tıklayın.

Şekil 4,
Şekil 4. Endometriyal stromal hücrelerin İmmünofloresan görüntüler. (A) İmmünofloresanbirincil endometrial kültürlerin kazıma yöntemi ile izole edilmiştir. Görüntü kanalı 2 (P2) ve geçiş 5 (P5) arasında sitokeratin kaybını göstermektedir. Promiyelositik lösemi protein (PML), nükleer protein ve DAPI boyama kontrol olarak kullanılmıştır. (B) Görüntüler, mezenkimal işaretleyici Vimentin için pozitif lekeleme göstermiştir. Görüntüler ayrıca E kadherin (CDH1) ve Sitokeratin için negatif boyanma gösterir. DAPI ve Promiyelositik lösemi protein (PML) için boyama kontrol olarak verilmiştir. resmi büyütmek için buraya tıklayın.

Şekil 5,
Şekil 5. Başlıca iki endometrial stromal hücrelerin spontan sidualizasyonu. Deneysel işlemin (A) hatlarıdır. (B) Prolaktin upregülasyonu (PRL) veMPA ve cAMP tepki olarak protein 1 (IGFBP1) gen ekspresyon Bağlama İnsülin benzeri büyüme faktörü. Sonuçlar RT-QPCR ile ölçüldü, ve ifade GAPDH normalize edildi. Önemi öğrenciler t-testi (p <0.001 *** ve P <0.0001 ****) kullanılarak hesaplanmıştır. Her iki hücre çizgileri kazıma yöntemi kullanılarak izole edilmiştir. resmi büyütmek için buraya tıklayın.

Astar boya Sekans Tavlama Sıcaklığı (° C) Döngüleri Tahlil
Prolaktin (PRL) Forward CATATTGCGATCCTGGAATGAGC 60 40 SYBR @ Green
Prolaktin (PRL) Ters TCCTCAATCTCTACAGCTTTGGA 60 40 SYBR @ Green
İnsülin benzeri büyüme faktörü bağlayıcı protein 1 (IGFBP1)Ileri TCCTTTGGGACGCCATCAGTAC 60 40 SYBR @ Green
İnsülin benzeri büyüme faktörü bağlayıcı protein 1 (IGFBP1) Ters GATGTCTCCTGTGCCTTGGCTA 60 40 SYBR @ Green
GAPDH Tanımlanmamış (reaktif listesine bakınız) 60 40 Taqman

Sidualizasyonu belirteçleri Tablo 1. PCR koşulları.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Diğer gruplar kolajenaz 4,12,13,15-18 kullanan çoğu endometriyal stromal kültürleri, hazırlanması için bir yöntem tarif adapte edilmiştir. Bu yazıda, ekonomik nedenler ve tripsin ve / veya jilet uygun kullanılabilirliği için bizim laboratuvarda tarafından kullanılan her ikisi de iki basitleştirilmiş temel endometrial stromal kültür yöntemleri için metodoloji ve kanıt sağladı.

Bizim iki yöntem kıyaslarken, hem başarıyla uygulanabilir birincil kültürleri üretmek. Daha küçük bir numune boyutu şartı ile, tipik olarak yüksek bir verim saptandığı gibi tercih edilen bir yöntem olup, tripsin yöntemdir. Hazırlık süresi sınırlı ise tripsin yöntemini kullanarak hücreleri kaplama bir saat bir buçuk daha alır oysa Ancak, kazıma yöntemi 30 dakika gerektirir.

Dikkat çekici endometrial biyopsi karşıt olarak biz histerektomi örnekler bu yöntemleri göstermek olmasıdır. Endometrial biopsies önemli saldırı olmadan alınan ve daha küçük örnekleri üretmek için eğilimindedir. Yine de, bu yazının (özellikle tripsin yöntemi) 'de tarif edilen yöntemler, endometrial biyopsi ikinci kültürleri verim gerekir.

Birincil endometrial stromal hücreler için çok sayıda uygulama vardır. Diğer memeliler karşı insan endometriyal stromal kültürlerini karşılaştıran insanlar regl neden hakkında yüzyıllardır tartışılan edilmiştir sorulara ipuçları sağlayabilir. In vitro kültür gerektiren diğer keşfedilmemiş fizyolojisi çalışmalar vardır. Özel ilgi gibi üreme döngüsü 19,20, 21 fonksiyonel olaylara epigenetik moleküler olayları bağlantılı ve Ref 11 inceledik bulguları olarak üreme döngüsü olaylar içgörü sağlamak keşifler.

Klinisyenler endometrial stromal kültür, eğitim ve biyogöstergesini belirlenmesi büyük ölçüde yararlanacaküreme bozuklukları ve kanser malignitelerin durumlarda s. 2006 ve 2010 yılları arasında, bu 7,4 milyon kadın ve eşleri Amerika Birleşik Devletleri'nde 22 kısırlık hizmetlerini kullandıkları bildirildi. Kısırlığın önemli bir yüzde desidualizasyon 23 yetmezliği kaynaklanmaktadır. Ayrıca, bu tür kısırlığa hiperplazi ve endometrioz gibi endometrial hastalıklar arasındaki ilişki yakın zamanda değerlendirilmektedir. Gelişmiş endometrial sarkom nadir bile olsa, bu ölümcül olabilir çünkü in vitro modelleme yoluyla rahim jinekolojik kanserlerin çalışma kapasitesi de ölçülemez. Vitro primer kültürlerinde kurarak, biz hastalıkları ile ilişkili moleküler olayların etkisini incelemek ve farazi klinik uygulamaları oluşturabilirsiniz.

Sonuç olarak, bu uygulamaların çoğu için temsili ve in vivo modellerde etkili üretilmesi zordur. Bu, içinde geliştirme yaparçeşitli in vivo işlevler kritik incelemek için birincil endometrial kültürleri vitro. Bu iki endometrial izolasyon yöntemleri, "kazıma yöntemi" ve "tripsin yöntemi," endometrial fizyolojisi ve patolojisi anlayışımız için dayanak sağlamaya yardımcı olacaktır.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa hiçbir şey yok.

Acknowledgements

Biz onların görüntüleme ve mikroskop ekipman kullanımı için Dr Thao'nun Dang ve onun laboratuar üyelerinin ortak çabaları teşekkür ederim. Biz de rahim dokusu ile bize sağlamak için Biorepository ve Doku Araştırma Tesisi (BTRF) çekirdek, Jeff Harper ve Virginia Üniversitesi sakinlerine teşekkür ederim. Biz Şematik Bakış ile yardım için Karol szlachta teşekkür ederim.

Materials

Name Company Catalog Number Comments
0.25 Trypsin or 0.05% Trypsin  Hyclone SH3023602 or SH30004202
1.7 micro Centrifuge Tube   Genesee Scientific 22-272A
1 µl, 20 µl, 200 ml and 1,000 µl Pipette   Genesee Scientific 24-401,24-402, 24-412, 24-430
15 ml Conical Tube  Hyclone 339650
50 ml Conical Tube  Hyclone 339652
6 cm Cell Culture Dish  Thermo scientific 12-556-002
8 well Chambers  Thermo Scientific AB-4162
Acetate  Fisher scientific C4-100
AMV RT Enzyme/Buffer  Bio Labs M077L
Bovine Serum Albumin (BSA)  Fisher Scientific BP-1605-100
Buffered Zinc Formalin  Thermo 59201ZF
Charcoal strip FBS  Fisher NC9019735
Chloroform  Fisher Scientific BP1145-1
Cover slip  Fisher Brand 12-544D
Cyclic AMP (cAMP)  Sigma B7880
DMEM/High Glucose  Hyclone SH30243FS
dNTP  Bioline BIO-39025
Donkey Anti Goat -TRITC  Santa Cruz SC-3855
Donkey Serum  Jackson’s lab 017-000-002
E Cadherin Antibody   Epitomics 1702-1
Ethanol  Fisher Scientific BP2818-1
Fetal Bovine Serum (FBS)  Fisher Scientific 03-600-511
Fungizone Amphotericin B  Gibco 15290-018
GAPDH Probe  Life Technologies HS99999905
Glycogen  5Prime 2301440
Goat Anti Mouse - FITC  Jackson’s Lab 115-096-003
Isopropanol  Fisher Scientific BP2618-1
Kanamycin   Fisher Scientific BP906-5
Medroxyprogesterone acetate (MPA)  Sigma M1629
MeOH (Methanol)  Fisher Scientific A4-08-1
Mounting Media (w/DAPI)  Vector Labratories H-1500
N6 DNA Oligos  Invitrogen
Number 15 Scraper   BD 371615
Pan Cytokeratin  Mouse mAB  Cell Signaling 4545
PBS (phosphate buffered saline)  Fisher Scientific BP-399-4
Penicillin-Streptomycin Glutamine Solution 100X   Hyclone SV30082.01
PML Anti Goat Anti body  Santa Cruz SC-9862
Primer(s)  Eurofins
RPMI  Hyclone SH30027FS
RPMI (Phenol free)  Gibco 11835
Sybr Green   Thermo Scientific AB-4162
Taqman  Thermo AB-4138
Trizol  Life Technologies 15596018
Vimentin Antibody  Epitomics 4211-1

DOWNLOAD MATERIALS LIST

References

  1. Heller, D. in The endometrium: a clinicopathologic approach. Heller, D. 56-75 (1994).
  2. Emera, D., Romero, R., Wagner, G. The evolution of menstruation: a new model for genetic assimilation: explaining molecular origins of maternal responses to fetal invasiveness. Bioessays. 34, 26-35 (2011).
  3. Gudjonsson, T., Villadsen, R., Ronnov-Jessen, L., Petersen, O. W. Immortalization protocols used in cell culture models of human breast morphogenesis. Cell Mol Life Sci. 61, 2523-2534 (2004).
  4. Brosens, J. J., Hayashi, N., White, J. O. Progesterone receptor regulates decidual prolactin expression in differentiating human endometrial stromal cells. Endocrinology. 140, 4809-4820 (1999).
  5. Jones, M. C., et al. Regulation of the SUMO pathway sensitizes differentiating human endometrial stromal cells to progesterone. Proc Natl Acad Sci U S A. 103, 16272-16277 (2006).
  6. Salamonsen, L. A., et al. Proteomics of the human endometrium and uterine fluid: a pathway to biomarker discovery. Fertil Steril. 99, 1086-1092 (2013).
  7. Haouzi, D., Dechaud, H., Assou, S., De Vos, J., Hamamah, S. Insights into human endometrial receptivity from transcriptomic and proteomic data. Reprod Biomed Online. 24, 23-34 (2012).
  8. Chen, J. I., et al. Proteomic characterization of midproliferative and midsecretory human endometrium. J Proteome Res. 8, 2032-2044 (2009).
  9. Talbi, S., et al. Molecular phenotyping of human endometrium distinguishes menstrual cycle phases and underlying biological processes in normo-ovulatory women. Endocrinology. 147, 1097-1121 (2006).
  10. Punyadeera, C., et al. Oestrogen-modulated gene expression in the human endometrium. Cell Mol Life Sci. 62, 239-250 (2005).
  11. Ponnampalam, A. P., Weston, G. C., Susil, B., Rogers, P. A. Molecular profiling of human endometrium during the menstrual cycle. Aust N Z J Obstet Gynaecol. 46, 154-158 (2006).
  12. Zhang, L., Rees, M. C., Bicknell, R. The isolation and long-term culture of normal human endometrial epithelium and stroma. Expression of mRNAs for angiogenic polypeptides basally and on oestrogen and progesterone challenges. J Cell Sci. 108, (1), 323-331 (1995).
  13. Richards, R. G., Brar, A. K., Frank, G. R., Hartman, S. M., Jikihara, H. Fibroblast cells from term human decidua closely resemble endometrial stromal cells: induction of prolactin and insulin-like growth factor binding protein-1 expression). Biol Reprod. 52, 609-615 (1995).
  14. Gellersen, B., Brosens, J. Cyclic AMP and progesterone receptor cross-talk in human endometrium: a decidualizing affair. J Endocrinol. 178, 357-372 (2003).
  15. Marsh, M. M., Hampton, A. L., Riley, S. C., Findlay, J. K., Salamonsen, L. A. Production and characterization of endothelin released by human endometrial epithelial cells in culture. J Clin Endocrinol Metab. 79, 1625-1631 (1994).
  16. Siegfried, J. M., Nelson, K. G., Martin, J. L., Kaufman, D. G. Histochemical identification of cultured cells from human endometrium. In Vitro. 20, 25-32 (1984).
  17. Rawdanowicz, T. J., Hampton, A. L., Nagase, H., Woolley, D. E., Salamonsen, L. A. Matrix metalloproteinase production by cultured human endometrial stromal cells: identification of interstitial collagenase, gelatinase-A, gelatinase-B, and stromelysin-1 and their differential regulation by interleukin-1 alpha and tumor necrosis factor-alpha. J Clin Endocrinol Metab. 79, 530-536 (1994).
  18. Dimitriadis, E., Robb, L., Salamonsen, L. A. Interleukin 11 advances progesterone-induced decidualization of human endometrial stromal cells. Mol Hum Reprod. 8, 636-643 (2002).
  19. Sakai, N., et al. Involvement of histone acetylation in ovarian steroid-induced decidualization of human endometrial stromal cells. J Biol Chem. 278, 16675-16682 (2003).
  20. Logan, P. C., Ponnampalam, A. P., Steiner, M., Mitchell, M. D. Effect of cyclic AMP and estrogen/progesterone on the transcription of DNA methyltransferases during the decidualization of human endometrial stromal cells. Mol Hum Reprod. 19, 302-312 (2013).
  21. Tamura, I., et al. Induction of IGFBP-1 expression by cAMP is associated with histone acetylation status of the promoter region in human endometrial stromal cells. Endocrinology. 153, 5612-5621 (2012).
  22. American Society for Reproductive Medicine: Quick facts about infertility. Available from: http://www.asrm.org/detail.aspx?id=2322 (2013).
  23. Salker, M., et al. Natural selection of human embryos: impaired decidualization of endometrium disables embryo-maternal interactions and causes recurrent pregnancy loss. PLoS One. 5, (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics