To metoder for å etablere primær Menneskelig Livmor stromale celler fra Hysterektomi Prøver

* These authors contributed equally
Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Etablering av primær endometrial stromal cellekultursystemer fra hysterektomi prøver er et verdifullt biologisk teknikk og et avgjørende skritt før forfølge en lang rekke forsknings mål. Her beskriver vi to metoder som brukes for å etablere stromal kulturer fra kirurgisk resekterte endometrial vev av menneskelige pasienter.

Cite this Article

Copy Citation | Download Citations

Jividen, K., Movassagh, M. J., Jazaeri, A., Li, H. Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens. J. Vis. Exp. (87), e51513, doi:10.3791/51513 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Mange forsøk har vært viet til å etablere in vitro cellekultursystemer. Disse systemene er designet for å modellere et stort antall in vivo prosesser. Cellekultursystemer som følge av menneskelige endometrial prøvene er ikke noe unntak. Applikasjoner varierer fra normale cykliske fysiologiske prosesser i endometriale patologier slik som gynekologisk kreft, infeksjonssykdommer, og forplantnings mangler. Her gir vi to metoder for å etablere primær endometrial stromale celler fra kirurgisk resekterte endometrial hysterektomi prøver. Den første metode er referert til som "skrape-metoden", og innbefatter mekanisk skraping ved bruk av kirurgisk eller barberblader, mens den andre metoden er betegnet "den trypsin-metoden". Denne sistnevnte metode anvender den enzymatiske aktiviteten av trypsin for å fremme separasjon av celler og primære celleutvekst. Vi illustrere trinn-for-trinn metode gjennom digitale bilder og mikroskopi. Vi også kundenee eksempler for å validere endometrial stromal cellelinjer via kvantitative sanntid polymerase kjedereaksjoner (qPCR) og immunfluorescens (IF).

Introduction

Den menneskelige uterus korpus består av tre lag, det perimetrium (eller serosa), myometrium, og endometrium. Skille hver av disse lagene er et viktig skritt for å etablere endometrial cellelinjer. Den perimetrium er det ytterste lag av uterus og består av tynne, serøse celler. Den myometrium er tykk, midtre lag av uterus og består av glatte muskelceller. Endometrium er identifisert som det indre laget av livmoren og omfatter epiteliale og stromal cellepopulasjoner.

Endometriet er videre delt inn i basalis lag som stamcelle befolkningen er en hypotese å befolke functionalis lag ca hver 28 dager en. Den functionalis lag av human endometrium gjennomgår betydelige biokjemiske og morfologiske endringer i respons til sirkulerende hormoner. Disse hormonene er avledet fra hypofysen og eggstokkene.

Denkoordinert produksjon og frigjøring av hormoner resultater i en reproduksjonssyklusen. Den reproduktive syklus er designet for å forberede endometriet for potensielle embryo implantasjon hendelser. Hos mennesker er den reproduktive syklus kjent som "menstruasjonssyklus", og deles inn i tre faser - proliferativ, sekretoriske, og menstruasjons. Proliferasjonsfasen innebærer spredning av functionalis livmor lag mens sekretoriske fasen er preget av functionalis modning. Spesielt ekstracellulære forandringer, sekreter, og cellulær differensiering signalisere en potensiell implantasjon. Ved implantasjonen ikke finner sted før slutten av den sekretoriske fase, er functionalis endometrial sjikt felle i løpet av menstruasjons fase. Betydningen av menstruasjon og de hendelser som utløser den utstøtingen av functionalis lag er fortsatt blir debattert. I mennesker er det blitt stilt at menstruasjonen er resultatet av en bestemt mid-sekretoriske fase differensiering hendelse kjentsom "spontan decidualization" to. I dette manuskriptet, gir vi detaljert metodikk for både endometrial stromal celle isolasjon metoder, og bruker en kombinasjon av immunfluorescens og digitale bilder for å demonstrere effekten av disse tilnærmingene. I tillegg har vi anvende en vanlig brukt in vitro modell av spontan decidualization å bekrefte endometrial stromal celleisolasjon.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Hysterektomi prøver som brukes i dette manuskriptet ble samlet i samstemmighet med et universitet IRB-godkjent etikk protokoll nummerert IRB-HSR # 14424.

En. Sample Oppkjøp fra Clinical Source

  1. Skaff regjeringen og institusjonsbaserte etiske retningslinjer og dokumentasjon godkjenning før du begynner.
  2. Gjennomføre alle trinn i sterile forhold.
  3. Bevar pasient-avledet vev i mediet (RPMI-eller DMEM / High Glucose) i et 50 ml rør ved 4 ° C dersom prøven ikke kan bli behandlet i kultur med en gang. Prøvene kan lagres i denne tilstanden for maksimalt 24 timer.
  4. Vask vevsprøve tre ganger med 1X steril fosfatbufret saltløsning (PBS) og kast oppløsningen mellom hver vask.

2.. Fremstilling av primære cellelinjer ved hjelp av sikling Method

  1. Til 4-10 ml vekstmedium (RPMI-eller DMEM / High Glucose supplert med 10% kalvefosterserum og 1% penicillin-streptomycin) i vev og tilsett Fungizone (0,25 ug / ml endelig konsentrasjon) i 30 min.
  2. Kast vekstmedier.
  3. Vask vev to ganger med 1X PBS.
  4. Plasser vevet på en 6 cm cellekulturplate for å skille mellom myometrium og endometrium lag (se figurene 2A-2C for videre beskrivelse). Separer endometrium.
  5. Ved hjelp av en skalpell eller barberblad, skjære over vevet i små biter mens skrape på 6 cm cellekultur parabolen. Disse riper lette monteringen av nye primære endometrial celler. Sammenlignet med trypsin fremgangsmåten blir mer vev nødvendig (se figur 2D for en tilnærming).
  6. Forsiktig, tilsett 2 ml av vekstmedier til ripete fatet (vev fragmenter vil være synlig og ideelt immobilisert fra skrape bevegelse).
  7. Overfør platen (e) til et angitt cellekulturinkubator (37 ° C og 5% CO2). Utpeke et sted for primære cellelinjer, vekk fra otheh cellekultur retter. Primære kulturer er mer følsomme for infeksjon og forurensning.
  8. Undersøk cellene under et lysmikroskop daglig. Små bestander av cellene skal dukke opp av dag to eller tre fra rundt skiver vev (se Figur 3B).
  9. For å opprettholde kulturer, vask forsiktig med 1X PBS og legge friske vekstmedier (2 ml) hver tredje dag. Når spredning renteøkninger, kan ytterligere vekstmedier (3-4 ml) legges til 6 cm kultur plate (r).
    Merk: Under vasking og medieendringer, vil biter av vev sannsynlig bli aspirert. Dette vil ikke påvirke veksten av adherente celler. Stykker av vev skal innåndes av det etterfølgende trinn (2,10) som nye kolonier er lite sannsynlig å oppstå etter en uke.
  10. Når 6 cm plate er omtrent 75 - 80% sammenflytende (se figur 3B), passasjen ved hjelp av 0,05% trypsin. Primære celler kan ikke passaged ubestemt tid - fryse ned en plate av cellene så snart som to eller tre plater er maintained. Hvis flere passasjer er nødvendig, følger en immortalization protokollen (anmeldt i Ref 3).

3.. Fremstilling av primære cellelinjer ved hjelp av Trypsin Method

  1. Plasser en liten del av endometrialt vev (se figur 2D for en tilnærming) i 2 ml av 0,25% trypsin supplert med Kanamycin (0,03 mg / ml sluttkonsentrasjon).
  2. Inkuber vev ved 37 ° C på roterende plattform i 30 min.
  3. Kort vortex vev.
  4. Sentrifuger prøven ved 200-400 xg i 2 min og kast supernatanten.
  5. Legg frisk trypsin og kanamycin.
  6. Inkuber i vevet ved 37 ° C ved å rotere om en time.
  7. Vortex vev for 5-10 sek.
  8. Til 2 ml vekstmedium (supplert med 10% kalvefosterserum og 1% penicillin-streptomycin) for å deaktivere trypsin.
  9. Sentrifuger cellene ved 200-400 x g i 2-3 min.
  10. Kast supernatanten og tilsett 2 ml vokseth media til de pelleterte cellene.
  11. Plate på en 6 cm cellekultur parabolen. Skraping platen som i trinn 2.5 i Klar Primære cellelinjer ved hjelp av Skraping metoden er ikke nødvendig, men forbedrer feste og utvekst av primærkulturer.
  12. Overvåk-celler under et lysmikroskop daglig. Cellene er vanligvis synlige under et lysmikroskop etter 24-48 timer (se figur 3C).
  13. For å opprettholde kulturer, overvåke cellene og endre media hver 2-3 dager som i trinn 2.9.
  14. Til passasje cellene, bruk 0,05% eller 0,25% Trypsin når cellene når 75-80% konfluens (se figur 3C).

4. Lagre ekstra vev for analyse (Snap Frysing og Formalin Fixation)

  1. Vask prøven to ganger med 1X PBS.
  2. Sug så mye væske som mulig.
  3. For Snap Frysing, plasserer endometrial vevsprøve i en 1,7 sentrifugerør (se figur 2F og 2G). Plasser 1.7sentrifugerør i flytende nitrogen i 10 sekunder eller inntil det kan sees at vevet er frosset ned.
    Merk: Pass på å ikke direkte berøre flytende nitrogen ved preparering av prøvene. Prøver kan bli lagret ved -80 ° C inntil videre behandling eller analyse.
  4. For formalinfiksering, skjære et lite stykke av endometrialt vev (se figur 2 H), og senk i 10% buffret formalin sink. Etter 24 timer, forkaste formalin og tilsett 70% etanol til vevsprøver inntil videre behandling.

5. Immunfluorescens (IF)

  1. Cell fiksering
    1. Forbered celler på en kultur lysbilde eller plate.
    2. Forsiktig, vaske cellene med 1X PBS.
    3. Legg pre-avkjølt (4 ° C) metanol og aceton (blandet i forholdet 1:1) i 5 min.
    4. Air tørke lysbildet før du fortsetter. Slide kan lagres ved 4 ° C i 1-2 uker dersom det er nødvendig.
  2. Processing IF
    1. Rehydrere celler med 1X PBS i 10 min. For den following trinn 1-6, gjennomføre alle vasker og inkubasjoner på en roterende plattform.
    2. Blokk hjelp 1X PBS supplert med 1% bovint serumalbumin (BSA) og 1% artsspesifikt serum (kilde 2. antistoff) i 30 minutter ved romtemperatur (RT).
    3. Inkuber i primær antistoff (se produsentens anbefalinger for antistoff fortynninger). Referere til materialer for spesifikke antistoffer. Fortynne primære antistoff i frisk blokkering buffer som i trinn 5.2.2. Denne inkubasjon kan bli utført i minst to timer ved romtemperatur eller over natten ved 4 ° C.
    4. Vask tre ganger med 1X PBS i 5 minutter hver.
    5. Inkuber i sekundært antistoff (se produsentens anbefalinger for antistoff fortynninger). Spe den sekundære antistoff i frisk blokkering buffer som i trinn 5.2.2. For å hindre at foto-bleking, er det viktig å gjennomføre dette og etterfølgende trinn i fravær av lys.
    6. Vask tre ganger med 1X PBS i 5 minutter hver.
    7. Thoroughly tørke lysbildene.
    8. Legg monterings media og DAPI kontra løsning.
    9. Påfør dekkglass og forsegle kantene ved hjelp av fugemasse (s). Lysbilder kan lagres ved 4 ° C i mørke i opptil to uker.

6. RNA Extraction

  1. Pellet 1 x 10 7 celler ved sentrifugering. Alle materialer og reagenser i denne protokollen skal RNase gratis.
  2. Lyse-celler i 1 ml TRIZOL-reagens, og inkuber homogeniserte prøvene i 10 minutter ved romtemperatur for å fullføre dissosiasjon av nukleoprotein komplekser.
  3. Tilsett 200 ul kloroform per 1 ml TRIZOL. Rist kraftig for hånd i 15 sekunder og inkuberes i 2 til 3 minutter ved RT.
  4. Sentrifuger ved maksimal hastighet (15.000 x g) i 15 min ved 4 ° C. Tre lag vil medføre.
  5. Overfør den øvre vannfase i en frisk mikrosentrifugerør. Tilsett 1 ul glykogen til å øke RNA utbytte; er imidlertid bare nødvendig dette trinnet når en litenMengden av RNA er forventet.
  6. Tilsett 0,5 ml av isopropylalkohol til det vandige lag, og invertere prøvene 3-5 ganger. Inkuber prøvene ved RT i 10 min. For å øke utbyttet kan prøvene plasseres i -20 ° C eller -80 ° C i 30 min.
  7. Sentrifuger ved maksimal hastighet i 10 min ved 4 ° C.
  8. På dette punktet, bør en liten pellet av RNA være synlig. Kast supernatanten.
  9. Vask RNA med 1 ml 75% etanol.
  10. Sentrifuger ved maksimal hastighet i 5 min og kast supernatanten. Prøver kan bli vasket en gang til for å fjerne uorganiske forurensninger, men dette trinn er ikke nødvendig.
  11. Kort, tørk RNA pelleten til RNA pelleten er tørr (tar vanligvis 7-10 minutter).
    Merk: Et ytterligere trinn kan anvendes til å redusere uorganisk materiale og redusere tørketiden. Etter kassering av supernatanten fra etanolvask, ringprøver ved maksimal hastighet i ett minutt og aspirat gjenværende væske. Pass på å ikke suge pellet.
  12. Oppløs RNA i RNase-fritt vann, avhengig av størrelsen på RNA-pelleten. Volumene vanligvis strekker seg 10-50 mL.
  13. Inkuber prøvene ved 55 ° C i 10 min, og måle konsentrasjonen av RNA.
  14. Oppbevar prøver ved -20 ° C inntil videre behandling.

7. Revers transkripsjon

  1. Før prøven RNA (1-3 mg) til et volum på 9 pl med H2O
  2. Varme RNA til 70 ° C i 10 min.
  3. For å generere en AMV konsentrat-blanding, kombinere de følgende reagenser: 5 ul dNTP (arbeidskonsentrasjon på 50 uM), 5 pl av N6 DNA oligoer (arbeidskonsentrasjon på 80 uM), 5 pl 5X buffer AMV, og 1 pl AMV . Denne mester mix løsning er utformet per én prøve.
  4. Legg 16 mL av konsentrat-blanding til det oppvarmede RNA. Det endelige reaksjonsvolum vil være 25 ul reaksjon.
  5. Bruk følgende PCR betingelser for revers transkripsjon: (stadium 1) 42 ° C i 90 min, (STAge 2) 95 ° C i 5 min, og (Steg 3) 4 ° C inntil videre behandling.

8. Real Time PCR

  1. Gjennomføre PCR reaksjoner ved hjelp av primere, annealing temperaturer, sykkel tall og reagenser som finnes i tabell 1.
    Merk: Det er ideelt å følge produsentens anvisninger ved bruk PCR reagenser (se firma-og katalognumre i Materials).

9. In vitro Decidualization Protocol (Avledet fra Ref 4 og 5)

  1. Plate endometrial celler.
  2. Vokse til en konfluens på 75-85%.
  3. Etter celler blir sammenflytende, vaske en gang med 1X PBS.
  4. Raskt, legge hormon-frie medier (Fenol gratis RPMI supplert med 5% kull stripe FBS og 1% Penicillin-streptomycin).
  5. Etter 24 timer, tilsett hormonfrie medier supplert med medroksyprogesteronacetat (MPA) med en endelig konsentrasjon på 1 mM og 8-bromoadenosine 3 ', 5'-Cyklisk monofosfat (cAMP) ved en sluttkonsentrasjon på 0,5 mM.
  6. Etter minst 48 timer, stopp reaksjonen og lagre platen (e) for videre prosessering.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Som understreket i protokollen delen, pass på å utføre alle metoder under offentlig, institusjonelle og etiske retningslinjer ved håndtering og tilberedning menneskelig vev.

Inkludert i dette manuskriptet er en illustrasjon av den generelle arbeidsflyten av "skrapemetode" (figur 1A), og "den trypsin-metoden" (figur 1B) som brukes til å etablere primær endometrial kulturer. Disse metoder er beskrevet i detalj i protokollen seksjon (se deler 1 -. Tre.). Begge metodene bevise vellykket i veksten av primær endometrial kulturer. Fordelen til "skraping metoden" er den forkortede forberedelse tid; Imidlertid, er den tiden det tar å observere levedyktige celler vanligvis 2-4 ganger lenger enn for «den trypsin-metoden".

Forutsatt er digitale bilder av den innledende humant vev som mottas fra vevet anskaffelse. Livmor lagene kan være preget avruheten av laget, dvs. myometrium er tykk og muskulær og endometrium er tynn og mer ettergivende. Vi har fremhevet tykk, glatt muskellaget (myometrium) i hvit og skissert endometrial interessant lag i svart fra to forskjellige hysterektomi eksempler (figurene 2A og 2B). I figur 2C, er vev orientert med myometrium vender opp, mens den endometrium er plassert ned. Den tynne, perimetrial lag ble kirurgisk reseksjon og ikke fremhevet i disse bildene. Det er også viktig å merke seg at størrelsen av endometrial laget i disse digitale to-dimensjonale bilder er fordreid som selve tre-dimensjonale sjikt er meget tynn sammenlignet med myometrium.

Skjære passende vev størrelse er viktig for både "skrapemetode" og "den trypsin-metoden". I figur 2D, blir hensiktsmessige størrelser angitt for hver metode ovenfor den respektive prøve. Ved hjelp av en 0.5x00,5 x0.5 cm stykke for "trypsin metoden" [venstre] er tilstrekkelig for å etablere en kultur. Representanten start vev for "skraping metoden" [right] omfatter alle livmor lag. Sluttproduktet for "skrapemetode" er representert i figur 2E, og det anbefales at minst 1X1X1 cm av endometrialt vev blir benyttet for å etablere levedyktige kulturer. Kravet for dette mye vevsprøve er en ulempe med "skrapemetode».

Resterende vev er ofte brukt i en rekke måter, inkludert protein og RNA analyser. For å sikre bevaring av vevet kvalitet, er det viktig å bruke et "snap frysing"-metoden som i den protokoll delen (se 4.). Denne metoden er også illustrert i figur 2F og figur 2G. Saving ekstra vev av formalin fiksering er også en vanlig praksis av patologer og forskere. Forbereder vev for formalin fiksering er beskrevet i protokollen figur 2H.

Lysmikroskopi er avgjørende for overvåking primære endometrial kulturer. Individuelle endometrial stromale celler skal fremvise fibroblast morfologi (figur 3A). "Den skraping metoden" typisk genererer klynger av tidlige fremvoksende celler, hovedsakelig langs skalpell-indusert riper (Figur 3B, Dag 2). "The trypsin metoden" genererer både klyngen og spredte celle vekst mønstre (Figur 3C, Dag 4). Vi har tatt flere representative bilder fra den første platekledning (dag 0) til den første passasje av hver metode (fig. 3B og 3C).

Mange vev er definert av deres ekspresjon av vevs-spesifikke markører slik som glattmuskel-aktin (SMA) for glatt muskulatur, CD34 for immun stamceller, etc. Mens gen-og protein expression eksperimenter er blitt utført for endometrium 6-11, en ​​endometrial stromal celle spesifikk markør har ennå ikke oppdaget. I stedet, forskere ofte vurdere endometrial stroma renhet ved å måle markører fra potensielle celle forurensninger. For eksempel er cytokeratin markører brukt til å vise epiteliale populasjoner. Det er imidlertid mindre betydning, fordi etablering og opprettholdelse av endometriale epitel er vanskelige og vanligvis velges mot (Ref 12 og figur 4A). Dersom prøvene skulle oppnås i løpet av svangerskapet, positive uttrykk for HLA-A,-B,-C demonstrerer bakterie, trophoblast celler 13. På den annen side, i likhet med andre mesenchymale fibroblaster, endometrial stromale celler uttrykker vimentin (CDH1). Vi demonstrerer med immunfluorescens, ekspresjonen av vimentin og fravær av cytokeratin og E cadherin (CDH1) i etablerte endometrial stromale celler (figur 4B).

Til slutt gir vi funksjonelle bevis for primær livmor kultur via en in vitro spontan decidualization analysen. Denne fremgangsmåten ble tilpasset fra Ref 4 og 5, og omfatter behandling av kulturene med en kombinasjon av Medroksyprogesteronacetat (MPA) og 8 - bromoadenosine 3 ', 5'-cyklisk monofosfat (cAMP) (beskrevet i ni In vitro Decidualization protokoll og modellert.figur 5A). I nærvær av MPA og cAMP, endometrial stromale celler utviser signifikant forandret genekspresjon profiler (gjennomgått i Ref 14). De ofte publiserte spontane decidualization markører er Prolaktin (PRL) og Insulin-like Growth Factor Binding Protein 1 (IGFBP1) (anmeldt i Ref 14). Responsen på disse to genene til MPA og cAMP er sterke indikatorer på både spontan decidualization og vellykket etablering av en endometrial stromal kultur. Vi viser dette i figur 5B.


Figur 1. Skjematisk av de to primære endometrial isolasjonsmetoder. (A) trinn 02.01 til 02.10 på skraping metoden som vises i et organisasjonskart. (B) Steps 03.01 til 03.14 av trypsin metoden som vises i et organisasjonskart. Klikk her for å se større bilde.

Fig. 2
Figur 2. Behandler livmor vev. (AC) Kliniske livmor prøver fra to kvinnelige pasienter. A & C er utledet fra Pasient 1 og B er avledet fra Pasient to. Kirurgisk reseksjon livmor vev (til venstre) og highlighted livmor lag (til høyre). (A & B) Det myometrium er innringet i hvitt og endometrium i svart. (C) Den myometrium er vendt mot kameraet. (D) Initial representative endometrial utvalgsstørrelser for både isoleringsmetoder angitt. Det trypsin-metoden krever ren endometrium før tilsetning av trypsin, mens skrapemetode kan brukes hele livmor prøver. (E) Eksempel på den bearbeidede endometrial prøven av skrapemetode. (F og G) Bilde av gjenværende uterus vev forberedes for Snap Frysing. Vist er en lab-laget metallbeholder benyttes for denne metoden. (H) Formalin fiksering for livmorprøve. Klikk her for å se større bilde.

Figur 3 Figur 3. Lysmikroskopi bilder av primære endometrial kulturer. . (A) Representative bilder av endometrial stromal cellekulturer tatt ved ulike krefter og konfluens (B) Representative bilder av skraping metoden (dag 0 - 16) Note tatt av den samme kulturen fatet, drevet på 10x:. Visual linjene indikerer riper fra kirurgisk blad (C) Representative bilder av trypsin metoden.. (Days 0-16) tatt av den samme kulturen fatet, drevet på 10x Klikk her for å se større bilde.

Figur 4
Figur 4 immunofluorescence bilder av endometrial stromale celler.. (A) Immunfluorescensav primære endometrial kulturer isolert via skraping metoden. Bilder viser tap av cytokeratin mellom passasjen 2 (P2), og passasjen 5 (P5). Promyelocytic leukemi protein (PML) atom protein og DAPI flekker ble brukt som kontroller. (B) viser positiv farging for den mesenchymale markør vimentin. Bildene viser også negativ farging for E cadherin (CDH1) og Cytokeratin. Beising for DAPI og Promyelocytic leukemi protein (PML) ble gitt som kontroller. Klikk her for å se større bilde.

Figur 5
Figur 5. Spontan decidualization av to primære endometrial stromale celler. (A) Oversikt over eksperimentelle prosedyre. (B) oppregulering av prolaktin (PRL) ogInsulin-like Growth Factor Binding Protein 1 (IGFBP1) genuttrykk i respons til MPA og cAMP. Resultatene ble målt via RT-qPCR, og uttrykket ble normalisert til GAPDH. Signifikans ble beregnet ved hjelp av studenter t-test (P <0,001 *** og P <0,0001 ****). Begge cellelinjer ble isolert ved hjelp av skraping metoden. Klikk her for å se større bilde.

Primer Sequence Annealing Temperatur (° C) Cycles Assay
Prolaktin (PRL) Forward CATATTGCGATCCTGGAATGAGC 60 40 Sybrgreen
Prolaktin (PRL) Reverse TCCTCAATCTCTACAGCTTTGGA 60 40 Sybrgreen
Insulin-like growth factor binding protein 1 (IGFBP1)Forward TCCTTTGGGACGCCATCAGTAC 60 40 Sybrgreen
Insulin-like growth factor binding protein 1 (IGFBP1) Revers GATGTCTCCTGTGCCTTGGCTA 60 40 Sybrgreen
GAPDH Uspesifisert (se reagenslisten) 60 40 TaqMan

Tabell 1. PCR betingelser for decidualization markører.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Andre grupper har beskrevet og tilpasset metodikk for utarbeidelse av endometrial stromal kulturer, de fleste som benytter collagenase 4,12,13,15-18. I dette manuskriptet, har vi gitt metodikk og dokumentasjon for to forenklede primære endometrial stromal kultur metoder, som begge benyttes av vår lab for økonomiske årsaker og den praktiske tilgjengeligheten av trypsin og / eller et barberblad.

Når man sammenligner våre to metoder, både med hell generere levedyktige primærkulturer. Våre foretrukne metode er den trypsin-metoden som det er typisk en høyere utbytte med et mindre prøvestørrelse kravet. Imidlertid, hvis forberedelsestiden er begrenset, krever skrapemetode 30 minutter mens plette cellene ved hjelp av trypsin-metoden tar mer enn en og en halv time.

Også verdt å merke seg er at vi viser disse metodene med hysterektomi prøver i motsetning til Endometriebiopsier. Livmor biopsies tas uten vesentlig inntrenging og har en tendens til å produsere små prøver. Likevel bør metodene beskrevet i dette manuskriptet (spesielt trypsin-metoden) ga kulturer fra endometriale biopsier.

Det finnes mange programmer for primær endometrial stromale celler. Sammenligning endometrial stromal kulturer fra menneskelig versus andre pattedyr kan gi ledetråder til de spørsmålene som har blitt debattert i århundrer om hvorfor mennesker menstruere. Det er andre uutforskede fysiologi studier som krever in vitro kultur. Av spesiell interesse er funn som gir innsikt i reproduktive syklus hendelser som for eksempel funnene som har knyttet epigenetiske molekylære hendelser til de funksjonelle hendelsene i den reproduktive syklus 19,20, 21, og anmeldt i Ref 11.

Klinikere ville ha stor nytte av å studere endometrial stromal kultur og identifisere biomarkørers i de tilfeller av kjønnssykdommer og kreft malignitet. Mellom 2006 og 2010 ble det rapportert at 7,4 millioner kvinner og deres partnere brukt infertilitet tjenester i USA 22. En betydelig prosent av infertilitet skyldes svikt i decidualization 23. Dessuten er forholdet mellom endometriale sykdommer som hyperplasi og endometriose til infertilitet bare nylig blitt vurdert. Kapasiteten til å studere livmor gynekologisk kreft gjennom in vitro modellering er også uvurderlig fordi selv om avansert livmor sarkom er sjelden, kan det være dødelig. Ved å etablere in vitro primærkulturer, vi studere virkningen av de molekylære hendelser assosiert med sykdommer og kan generere antatte kliniske applikasjoner.

I konklusjonen, genererer representative og effektive in vivo modeller for mange av disse programmene er vanskelig. Dette gjør utviklingen av invitro primære endometrial kulturer å studere flere in vivo funksjoner kritisk. Disse to endometrial isolasjonsmetoder, "skraping metoden" og "trypsin metoden," vil bidra til å gi fotfeste for vår forståelse for livmor fysiologi og patologi.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ikke noe til utlevering.

Acknowledgements

Vi takker de felles anstrengelser av Dr. Thao Dang og medlemmer av hennes lab for bruk av deres bildebehandling og mikroskop utstyr. Vi takker også Biorepository og Tissue Research Facility (BTRF) kjerne, Jeff Harper, og beboerne ved Universitetet i Virginia for å gi oss med livmor vev. Vi takker Karol Szlachta for hjelp med Skjematisk oversikt.

Materials

Name Company Catalog Number Comments
0.25 Trypsin or 0.05% Trypsin  Hyclone SH3023602 or SH30004202
1.7 micro Centrifuge Tube   Genesee Scientific 22-272A
1 µl, 20 µl, 200 ml and 1,000 µl Pipette   Genesee Scientific 24-401,24-402, 24-412, 24-430
15 ml Conical Tube  Hyclone 339650
50 ml Conical Tube  Hyclone 339652
6 cm Cell Culture Dish  Thermo scientific 12-556-002
8 well Chambers  Thermo Scientific AB-4162
Acetate  Fisher scientific C4-100
AMV RT Enzyme/Buffer  Bio Labs M077L
Bovine Serum Albumin (BSA)  Fisher Scientific BP-1605-100
Buffered Zinc Formalin  Thermo 59201ZF
Charcoal strip FBS  Fisher NC9019735
Chloroform  Fisher Scientific BP1145-1
Cover slip  Fisher Brand 12-544D
Cyclic AMP (cAMP)  Sigma B7880
DMEM/High Glucose  Hyclone SH30243FS
dNTP  Bioline BIO-39025
Donkey Anti Goat -TRITC  Santa Cruz SC-3855
Donkey Serum  Jackson’s lab 017-000-002
E Cadherin Antibody   Epitomics 1702-1
Ethanol  Fisher Scientific BP2818-1
Fetal Bovine Serum (FBS)  Fisher Scientific 03-600-511
Fungizone Amphotericin B  Gibco 15290-018
GAPDH Probe  Life Technologies HS99999905
Glycogen  5Prime 2301440
Goat Anti Mouse - FITC  Jackson’s Lab 115-096-003
Isopropanol  Fisher Scientific BP2618-1
Kanamycin   Fisher Scientific BP906-5
Medroxyprogesterone acetate (MPA)  Sigma M1629
MeOH (Methanol)  Fisher Scientific A4-08-1
Mounting Media (w/DAPI)  Vector Labratories H-1500
N6 DNA Oligos  Invitrogen
Number 15 Scraper   BD 371615
Pan Cytokeratin  Mouse mAB  Cell Signaling 4545
PBS (phosphate buffered saline)  Fisher Scientific BP-399-4
Penicillin-Streptomycin Glutamine Solution 100X   Hyclone SV30082.01
PML Anti Goat Anti body  Santa Cruz SC-9862
Primer(s)  Eurofins
RPMI  Hyclone SH30027FS
RPMI (Phenol free)  Gibco 11835
Sybr Green   Thermo Scientific AB-4162
Taqman  Thermo AB-4138
Trizol  Life Technologies 15596018
Vimentin Antibody  Epitomics 4211-1

DOWNLOAD MATERIALS LIST

References

  1. Heller, D. in The endometrium: a clinicopathologic approach. Heller, D. 56-75 (1994).
  2. Emera, D., Romero, R., Wagner, G. The evolution of menstruation: a new model for genetic assimilation: explaining molecular origins of maternal responses to fetal invasiveness. Bioessays. 34, 26-35 (2011).
  3. Gudjonsson, T., Villadsen, R., Ronnov-Jessen, L., Petersen, O. W. Immortalization protocols used in cell culture models of human breast morphogenesis. Cell Mol Life Sci. 61, 2523-2534 (2004).
  4. Brosens, J. J., Hayashi, N., White, J. O. Progesterone receptor regulates decidual prolactin expression in differentiating human endometrial stromal cells. Endocrinology. 140, 4809-4820 (1999).
  5. Jones, M. C., et al. Regulation of the SUMO pathway sensitizes differentiating human endometrial stromal cells to progesterone. Proc Natl Acad Sci U S A. 103, 16272-16277 (2006).
  6. Salamonsen, L. A., et al. Proteomics of the human endometrium and uterine fluid: a pathway to biomarker discovery. Fertil Steril. 99, 1086-1092 (2013).
  7. Haouzi, D., Dechaud, H., Assou, S., De Vos, J., Hamamah, S. Insights into human endometrial receptivity from transcriptomic and proteomic data. Reprod Biomed Online. 24, 23-34 (2012).
  8. Chen, J. I., et al. Proteomic characterization of midproliferative and midsecretory human endometrium. J Proteome Res. 8, 2032-2044 (2009).
  9. Talbi, S., et al. Molecular phenotyping of human endometrium distinguishes menstrual cycle phases and underlying biological processes in normo-ovulatory women. Endocrinology. 147, 1097-1121 (2006).
  10. Punyadeera, C., et al. Oestrogen-modulated gene expression in the human endometrium. Cell Mol Life Sci. 62, 239-250 (2005).
  11. Ponnampalam, A. P., Weston, G. C., Susil, B., Rogers, P. A. Molecular profiling of human endometrium during the menstrual cycle. Aust N Z J Obstet Gynaecol. 46, 154-158 (2006).
  12. Zhang, L., Rees, M. C., Bicknell, R. The isolation and long-term culture of normal human endometrial epithelium and stroma. Expression of mRNAs for angiogenic polypeptides basally and on oestrogen and progesterone challenges. J Cell Sci. 108, (1), 323-331 (1995).
  13. Richards, R. G., Brar, A. K., Frank, G. R., Hartman, S. M., Jikihara, H. Fibroblast cells from term human decidua closely resemble endometrial stromal cells: induction of prolactin and insulin-like growth factor binding protein-1 expression). Biol Reprod. 52, 609-615 (1995).
  14. Gellersen, B., Brosens, J. Cyclic AMP and progesterone receptor cross-talk in human endometrium: a decidualizing affair. J Endocrinol. 178, 357-372 (2003).
  15. Marsh, M. M., Hampton, A. L., Riley, S. C., Findlay, J. K., Salamonsen, L. A. Production and characterization of endothelin released by human endometrial epithelial cells in culture. J Clin Endocrinol Metab. 79, 1625-1631 (1994).
  16. Siegfried, J. M., Nelson, K. G., Martin, J. L., Kaufman, D. G. Histochemical identification of cultured cells from human endometrium. In Vitro. 20, 25-32 (1984).
  17. Rawdanowicz, T. J., Hampton, A. L., Nagase, H., Woolley, D. E., Salamonsen, L. A. Matrix metalloproteinase production by cultured human endometrial stromal cells: identification of interstitial collagenase, gelatinase-A, gelatinase-B, and stromelysin-1 and their differential regulation by interleukin-1 alpha and tumor necrosis factor-alpha. J Clin Endocrinol Metab. 79, 530-536 (1994).
  18. Dimitriadis, E., Robb, L., Salamonsen, L. A. Interleukin 11 advances progesterone-induced decidualization of human endometrial stromal cells. Mol Hum Reprod. 8, 636-643 (2002).
  19. Sakai, N., et al. Involvement of histone acetylation in ovarian steroid-induced decidualization of human endometrial stromal cells. J Biol Chem. 278, 16675-16682 (2003).
  20. Logan, P. C., Ponnampalam, A. P., Steiner, M., Mitchell, M. D. Effect of cyclic AMP and estrogen/progesterone on the transcription of DNA methyltransferases during the decidualization of human endometrial stromal cells. Mol Hum Reprod. 19, 302-312 (2013).
  21. Tamura, I., et al. Induction of IGFBP-1 expression by cAMP is associated with histone acetylation status of the promoter region in human endometrial stromal cells. Endocrinology. 153, 5612-5621 (2012).
  22. American Society for Reproductive Medicine: Quick facts about infertility. Available from: http://www.asrm.org/detail.aspx?id=2322 (2013).
  23. Salker, M., et al. Natural selection of human embryos: impaired decidualization of endometrium disables embryo-maternal interactions and causes recurrent pregnancy loss. PLoS One. 5, (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics