Två metoder för att fastställa Primära Human Endometrial stromaceller från Hysterectomy Prover

* These authors contributed equally
Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Etablera primära endometrial stromal cellkultursystem från hysterektomi exemplar är en värdefull biologisk teknik och ett avgörande steg innan bedriva ett brett spektrum av forskning syftar. Här beskriver vi två metoder som används för att fastställa stromal kulturer från kirurgiskt resekterade endometrial vävnad i mänskliga patienter.

Cite this Article

Copy Citation | Download Citations

Jividen, K., Movassagh, M. J., Jazaeri, A., Li, H. Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens. J. Vis. Exp. (87), e51513, doi:10.3791/51513 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Många försök har gjorts för att etablera sig i cellodlings vitro-system. Dessa system är konstruerade för att modellera ett stort antal in vivo-processer. Cellodlingssystem som härrör från mänskliga endometrial prover är inget undantag. Tillämpningar sträcker sig från normala cykliska fysiologiska processer till endometrial sjukdomar såsom gynekologisk cancer, infektionssjukdomar, och fortplantningsförmåga. Här ger vi två metoder för att fastställa primär endometrial stromaceller från kirurgiskt resekterade endometrial hysterektomi exemplar. Den första metoden kallas "skrapning Metoden" och införlivar mekanisk skrapning med kirurgiska eller rakblad medan den andra metoden benämns "trypsin-metoden". Denna senare metod använder den enzymatiska aktiviteten av trypsin för att främja separation av celler och primära cell utväxt. Vi illustrerar steg-för-steg-metod med hjälp av digitala bilder och mikroskopi. Vi provid ocksåe exempel för validering endometrial stromacellinjer via kvantitativa realtid polymeras kedjereaktioner (qPCR) och immunofluorescens (IF).

Introduction

Den mänskliga livmodern corpus innefattar tre skikt, det perimetrium (eller serosa), myometrium och endometrium. Skilja var och en av dessa lager är ett viktigt steg för att etablera endometrial cellinjer. Den perimetrium är den yttersta skiktet av livmodern och som är sammansatt av tunna, serösa celler. Myometrium är tjock, mellanskiktet av livmodern och består av glatta muskelceller. Endometrium identifieras som det inre skiktet av livmodern och inkluderar epiteliala och stromala cellpopulationer.

Den livmoderslemhinnan är vidare indelad i basalis lager vars stamceller befolkningen är en hypotes att återbefolka functionalis skiktet ungefär var 28 dagar 1. Det functionalis lagret av människo endometriet genomgår betydande biokemiska och morfologiska förändringar som svar på cirkulerande hormoner. Dessa hormoner härledda från hypofysen och äggstockarna.

Densamordnad produktion och frisättning av hormoner leder till en reproduktionscykel. Den reproduktiva cykeln är att förbereda livmoderslemhinnan för potentiella embryoimplantation händelser. Hos människa är den reproduktiva cykeln kallas "menstruationscykeln" och delas in i tre faser - proliferativ, sekretoriska och menstruation. Den proliferativa fasen innebär spridning av functionalis endometrial lagret medan den sekretoriska fasen präglas av functionalis mognad. Specifikt cellulära förändringar, sekret och cellulär differentiering signalerar en potentiell implantation. Om implantation inte sker före utgången av den sekretoriska fasen, är det functionalis endometrial lagret skjul under menstruationsfasen. Vikten av menstruation och de händelser som utlöser spridande av functionalis skiktet fortfarande diskuteras. Hos människor har man föreslagit att menstruationen är resultatet av en specifik medel sekretorisk differentieringsfasen händelsen kändsom "spontan decidualisering" 2. I detta manuskript ger vi detaljerad metod för både endometrial stromal cell isoleringsmetoder, och använda en kombination av immunofluorescens och digitala bilder för att påvisa effekten av dessa metoder. Dessutom tillämpar vi en vanligt förekommande in vitro modell för spontan decidualisering bekräfta endometrial stromal cellisolering.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Hysterektomi prover som används i detta manuskript samlades i överensstämmelse med ett universitet IRK-godkända etikprotokoll numrerade IRK-HSR # 14424.

1. Prov Förvärv från Clinical Source

  1. Skaffa regeringen och institutionsbaserade etiska riktlinjer och dokumentation godkännande innan början.
  2. Genomför alla steg i sterila förhållanden.
  3. Bevara patient härstammar vävnad i media (RPMI eller DMEM / hög glukos) i en 50 ml tub vid 4 ° C om provet inte kan behandlas i kultur omedelbart. Prover kan förvaras i detta tillstånd under högst 24 timmar.
  4. Tvätta vävnadsprov tre gånger med 1X steril fosfatbuffrad saltlösning (PBS) och kassera lösningen mellan tvättar.

2. Beredning av Primära cellinjer med hjälp av Skrapning metod

  1. Lägg 4-10 ml tillväxtmedium (RPMI eller DMEM / hög glukos utökat med 10% fetalt bovint serum och 1% Penicillin-streptomycin) till vävnad och lägga Fungizone (0,25 | ig / ml slutlig koncentration) under 30 min.
  2. Kassera tillväxtmediet.
  3. Tvätta vävnad två gånger med 1X PBS.
  4. Placera vävnaden på en 6 cm cellodlingsplatta att skilja mellan myometrium och endometrium lager (se figur 2A-2C för ytterligare beskrivning). Separera endometriet.
  5. Med hjälp av en skalpell eller rakblad, transekt vävnaden i små bitar medan repor på 6 cm cellodlingsskål. Dessa repor underlättar fastsättning av de framväxande primära endometrial celler. Jämfört med trypsin metod krävs mer vävnad (se fig 2D för en approximation).
  6. Försiktigt, tillsätt 2 ml av tillväxtmedier till repad skålen (vävnadsfragment kommer att synas och helst immobiliserade från repor rörelse).
  7. Överför plattan (er) till en utsedd cellodlingsinkubator (37 ° C och 5% CO2). Utse en plats för primära cellinjer, bort från OTHer cellodlingsskålar. Primära kulturer är mer känsliga för infektion och kontamination.
  8. Undersök cellerna under ett ljusmikroskop dagligen. Små populationer av celler ska växa fram genom dag två eller tre från runt skivade vävnaderna (se figur 3B).
  9. För att bibehålla kulturer, tvätta försiktigt med 1 x PBS och tillsätt färskt tillväxtmedium (2 ml) var tredje dag. När spridningshastigheten ökar kan ytterligare tillväxtmedium (3-4 ml) tillsättas till 6 cm odlingsplatta (er).
    OBS: Under tvätt-och medieförändringar, kommer bitar av vävnad sannolikt aspireras. Detta kommer inte att påverka tillväxten av vidhäftande celler. Bitar av vävnader bör aspireras genom efterföljande steg (2,10) i form av nya kolonier sannolikt inte uppstår efter en vecka.
  10. När den 6 cm plattan är cirka 75 - 80% sammanflytande (se figur 3B), passage med användning av 0,05% trypsin. Primära celler kan inte passeras i oändlighet - frysa ner en platta med celler så snart två eller tre plattor är maintained. Om fler passager behövs, följer en immortalisering protokoll (över i ref 3).

3. Beredning av Primära cellinjer med hjälp av trypsin Method

  1. Placera en liten bit av endometrial vävnad (se fig 2D för en approximation) i 2 ml av 0,25% trypsin kompletterat med kanamycin (0,03 mg / ml slutkoncentration).
  2. Inkubera vävnaden vid 37 ° C på roterande plattform i 30 min.
  3. Skaka snabbt vävnaden.
  4. Centrifugera provet vid 200 till 400 x g under 2 min och kasta bort supernatanten.
  5. Lägg färsk trypsin och kanamycin.
  6. Inkubera vävnaden vid 37 ° C under rotation under en timme.
  7. Vortexa vävnaden under 5-10 sek.
  8. Lägg 2 ml tillväxtmedium (kompletterat med 10% fetalt bovint serum och 1% penicillin-streptomycin) för att inaktivera trypsin.
  9. Centrifugera cellerna vid 200 till 400 x g under 2-3 min.
  10. Kassera supernatanten och tillsätt 2 ml växath media till de pelleterade cellerna.
  11. Plattan på en 6 cm cellodlingsskål. Skrapning av plattan som i steg 2,5 för framställning Primära cellinjer använda Skrapning metod är inte nödvändigt, men förbättrar vidhäftning och utväxt av primära kulturer.
  12. Övervaka celler i ett ljusmikroskop dagligen. Celler är vanligtvis synlig under ett ljusmikroskop efter 24 till 48 h (se fig 3C).
  13. För att bibehålla kulturerna, övervaka cellerna och ändra media var 2-3 dagar som i steg 2.9.
  14. Till passagen cellerna använder 0,05% eller 0,25% trypsin, när cellerna når 75 till 80% sammanflytning (se fig 3C).

4. Att spara extra vävnad för analys (Snap Frysning och Formalin Fixa)

  1. Tvätta prov två gånger med 1X PBS.
  2. Aspirera så mycket vätska som möjligt.
  3. För Snap Frysning, placera endometrial vävnadsprov i en 1,7 centrifugrör (se figur 2F och 2G). Placera 1,7centrifugrör i flytande kväve under 10 sekunder eller tills det kan ses att den vävnad som har frysts ned.
    OBS: Se till att inte direkt beröra flytande kväve vid beredning prover. Prover kan förvaras vid -80 ° C tills vidare bearbetning eller analys.
  4. För formalin fixering, skära en liten bit av livmodervävnad (se figur 2H), och doppa i 10% buffrad zink formalin. Efter 24 tim, kassera formalin och lägga till 70% etanol för att vävnadsprover tills vidare bearbetning.

5. Immunofluorescens (IF)

  1. Cell fixering
    1. Bered celler på ett odlingsobjektglas eller platta.
    2. Försiktigt, tvätta cellerna med 1X PBS.
    3. Lägg förhand kyld (4 ° C), metanol och aceton (blandas vid ett förhållande av 1:1) under 5 min.
    4. Lufttorka bilden innan du fortsätter. Slide kan lagras vid 4 ° C under 1-2 veckor om det behövs.
  2. Bearbetning IF
    1. Rehydrera cellerna med 1X PBS under 10 min. För following Steg 1-6, genomföra alla tvättar och inkubationer på en roterande plattform.
    2. Block med användning 1X PBS kompletterad med 1% bovint serumalbumin (BSA) och 1% artspecifik serum (källa av 2 nd antikropp) under 30 min vid rumstemperatur (RT).
    3. Inkubera i primär antikropp (se tillverkarens rekommendationer för späd antikroppar). Se Material för specifika antikroppar. Späd den primära antikroppen i färskt blockerande buffert som i steg 5.2.2. Denna inkubation kan göras under minst två timmar vid rumstemperatur eller över natten vid 4 ° C.
    4. Tvätta tre gånger med 1X PBS under 5 min vardera.
    5. Inkubera i sekundär antikropp (se tillverkarens rekommendationer för späd antikroppar). Späd den sekundära antikroppen i färskt blockerande buffert som i steg 5.2.2. För att förhindra fotoblekning, är det viktigt att genomföra detta och efterföljande steg i frånvaro av ljus.
    6. Tvätta tre gånger med 1X PBS under 5 min vardera.
    7. Thoroughly Torka glasen.
    8. Lägg monterings media och DAPI motfärgning lösning.
    9. Applicera täckglas och försegla kanterna med hjälp av tätningsmedlet (n). Objektglasen kan förvaras vid 4 ° C i mörker i upp till två veckor.

6. RNA-extraktion

  1. Pellets 1 x 10 7 celler genom centrifugering. Alla material och reagenser i detta protokoll ska RNas fritt.
  2. Lyse-celler i en ml TRIZOL-reagens, och inkubera de homogeniserade proverna för 10 min vid rumstemperatur för att fullborda upplösningen av kärnproteinkomplex.
  3. Addera 200 pl av kloroform per 1 ml av TRIZOL. Skaka kraftigt för hand i 15 sekunder och inkubera i 2-3 min vid RT.
  4. Centrifugera vid maximal hastighet (15.000 x g) under 15 min vid 4 ° C. Tre lager kommer att resultera.
  5. Överför den övre vattenhaltiga fasen till ett färskt mikrocentrifugrör. Lägg 1 il glykogen för att öka RNA-utbyte; dock endast nödvändigt detta steg när en litenmängden RNA förutses.
  6. Lägg till 0,5 ml isopropylalkohol till vattenskiktet, och invertera proverna 3-5 gånger. Inkubera proverna vid RT under 10 min. För att öka utbytet kan proverna placeras i -20 ° C eller -80 ° C under 30 min.
  7. Centrifugera vid maximal hastighet i 10 min vid 4 ° C.
  8. Vid denna punkt, bör en liten pellet av RNA synas. Kasta bort supernatanten.
  9. Tvätta RNA med 1 ml 75% etanol.
  10. Centrifugera vid maximal hastighet i 5 minuter och kassera supernatanten. Prover kan tvättas en gång till för att befria oorganiska föroreningar, men detta steg är inte nödvändigt.
  11. Kortfattat, torka RNA pellets tills RNA pellet är torr (vanligtvis tar 7-10 min).
    Notera: Ett ytterligare steg kan användas för att minska oorganiskt material och minska torktiden. Kassera supernatanten från etanoltvätt, spinnprover vid maximal hastighet under ytterligare en minut och aspirera resterande vätska. Se till att inte aspirera pellets.
  12. Lös RNA i RNas-fritt vatten, beroende på storleken av RNA-pelleten. Volymerna varierar vanligtvis från 10 till 50 pl.
  13. Inkubera proverna vid 55 ° C under 10 min och mätning av koncentrationen av RNA.
  14. Förvara proverna vid -20 ° C tills vidare bearbetning.

7. Omvänd transkription

  1. Låt provet RNA (1-3 ug) till en volym av 9 ^ il med H2O
  2. Värme RNA till 70 ° C under 10 min.
  3. För att generera en AMV Master Mix, kombinera följande reagenser: 5 l av dNTP (arbetskoncentration av 50 ^ M), 5 pl av N6 DNA oligos (arbets koncentration av 80 ^ M), 5 pl 5X AMV buffert och 1 pl av AMV . Denna Master Mix lösning är utformad per ett prov.
  4. Addera 16 pl av mastermixen till den uppvärmda RNA. Den slutliga reaktionsvolymen är 25 | il reaktion.
  5. Använd följande PCR-betingelser för omvänd transkription: (steg 1) 42 ° C under 90 min, (STAGE 2) 95 ° C under 5 min, och (etapp 3) 4 ° C tills ytterligare bearbetning.

8. Real Time PCR

  1. Genomför PCR-reaktioner med användning av de primrar, glödgningstemperaturer, cykelnummer, och reagens som finns i tabell 1.
    OBS: Det är idealiskt att följa tillverkarens anvisningar vid användning av PCR-reagens (se företags-och katalognummer i Materials).

9. In vitro decidualisering Protocol (Härstammar från Ref 4 och 5)

  1. Plate endometrial celler.
  2. Växa till en sammanflytning av 75-85%.
  3. Efter att cellerna blir konfluenta, tvätta en gång med 1 x PBS.
  4. Snabbt tillhormonfritt medium (fenolfritt RPMI supplementerat med 5% träkol remsa FBS och 1% penicillin-streptomycin).
  5. Efter 24 timmar, tillsätt hormonfritt medium kompletterat med medroxiprogesteronacetat (MPA) vid en slutlig koncentration av 1 | iM och 8-bromoadenosine 3 ', 5'-Cykliskt monofosfat (cAMP) i en slutlig koncentration av 0,5 mM.
  6. Efter minst 48 timmar, stoppa reaktionen och spara skylt (ar) för vidare bearbetning.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Som framhålls i protokollet avsnitt, se till att utföra alla metoder under regeringen, institutionella och etiska riktlinjer vid hantering och beredning av mänsklig vävnad.

Inkluderat i detta manuskript är en illustration av det generella arbetsflödet av "skrapmetoden" (Figur 1A) och "den trypsin-metoden" (Figur 1B) användes för att fastställa primära endometriala kulturer. Dessa metoder beskrivs i detalj i protokollet sektionen (se del 1 -. 3.). Båda metoderna visar sig vara framgångsrika i tillväxten av primära endometrial kulturer. Fördelen med "skrapmetoden" är en förkortad förberedelsetid; emellertid den tid det tar för att observera levande celler är vanligtvis 2-4 gånger längre jämfört med "trypsin-metoden."

Förutsatt är digitala bilder av den ursprungliga vävnads emot från vävnads upphandling. Livmoder skikten kan särskiljas genom dengrovhet av skiktet, dvs myometrium är tjock och muskulär och endometrium är tunn och mer eftergivlig. Vi har lyft fram den tjocka, glatta muskulaturen lagret (myometrium) i vitt och skiss endometrial lagret av intresse i svart från två olika hysterektomi prover (figur 2A och 2B). I figur 2C, är vävnader orienterade med myometrium uppåt medan endometriet är placerad nedåt. Det tunna, perimetrial skiktet kirurgiskt opererande och inte lyfts fram i dessa bilder. Det är också viktigt att notera att storleken hos den endometriala skiktet i dessa digitala två-dimensionella bilder är felaktigt som den faktiska 3-dimensionella skiktet är mycket tunt jämfört med det myometrium.

Skära av lämplig vävnad storlek är viktigt för både "skrapmetoden" och "den trypsin-metoden." I Figur 2D är lämpliga storlekar utses för varje metod över respektive prov. Använda en 0.5x00,5 x0.5 cm stycke för "trypsin metoden" [vänster] är tillräcklig för att etablera en kultur. Den representativa utgångsvävnad för "skrapmetoden" [höger] omfattar alla livmoder lager. Slutprodukten för "skrapmetoden" representeras i figur 2E, och det rekommenderas att minst 1x1x1 cm av endometrial vävnad användas för att etablera livskraftiga kulturer. Kravet på denna mycket vävnadsprov är en nackdel med "skrapmetoden."

Kvar vävnad används ofta på ett flertal sätt inklusive protein och RNA-analyser. För att säkerställa bevarandet av vävnadskvalitet, är det viktigt att använda en "snap frysa" metod som i protokollet avsnitt (se 4.). Denna metod är också illustreras i figur 2F och fig. 2G. Att spara extra vävnad genom formalinfixering är också en vanlig metod för patologer och forskare. Förbereda vävnad för formalinfixering beskrivs i protokollet figur 2H.

Ljusmikroskopi är nödvändig för att övervaka primära endometrial kulturer. Individuella endometrial stromaceller bör uppvisa fibroblast morfologi (Figur 3A). "Den skrapning metoden" normalt genererar kluster av tidiga framväxande celler, främst längs skalpell-inducerad repor (Figur 3B, Dag 2). "Den trypsin metoden" genererar både kluster och spridda celltillväxtmönster (figur 3C, Dag 4). Vi har inkluderat flera representativa bilder från den ursprungliga bordläggningen (dag 0) till den första passagen av varje metod (figur 3B och 3C).

Många vävnader är definierade av deras expression av vävnadsspecifika markörer såsom glattmuskelaktin (SMA) för glatt muskulatur, CD34 för immun stamceller, etc. Även om gen-och proteinexpressionsexperiment har utförts för endometriet 6-11, ett egetdometrial stromal cell specifik markör har ännu inte upptäckt. Istället forskare vanligen bedöma endometrial stroma renhet genom att mäta markörer från potentiella cell föroreningar. Till exempel är cytokeratin markörer användes för att visa epiteliala populationer. Emellertid är det mindre av ett problem, därför att etablera och upprätthålla endometriala epitel är svårt och vanligtvis selekteras mot (Ref 12 och fig. 4A). Om proverna var som skall erhållas under graviditeten, positiva uttryck av HLA-A,-B,-C visar grodd-, trofoblastceller 13. Å andra sidan, liksom andra mesenkymala fibroblaster, endometrial stromaceller uttrycka vimentin (CDH1). Vi demonstrerar med immunofluorescens, expressionen av vimentin och frånvaron av cytokeratin och E cadherin (CDH1) i våra etablerade endometrial stromaceller (figur 4b).

Slutligen ger vi funktionella bevis på primär endometrial kultur via en in vitro spontan decidualisering analys. Denna metod anpassades från Ref 4 och 5, och involverar behandling av kulturerna med en kombination av medroxiprogesteronacetat (MPA) och 8 - bromoadenosine 3 ', 5'-cykliskt monofosfat (cAMP) (beskriven i 9 In vitro decidualisering protokoll och modelleras. i fig. 5A). I närvaro av MPA och cAMP, endometrial stromaceller uppvisar signifikant förändrad genexpression profiler (översikt i ref 14). De ofta publicerade spontana decidualisering markörer är Prolaktin (PRL) och insulinliknande tillväxtfaktorbindande protein 1 (IGFBP1) (över i ref 14). Svaret på dessa två gener för MPA och cAMP är starka indikatorer på både spontana decidualisering och framgångsrik etablering av en endometrial stromal kultur. Vi visar detta i figur 5B.


Figur 1. Schematisk bild av de två primära endometrial isoleringsmetoder. (A) steg från 2,1 till 2,10 i skrapmetoden visas i ett organisationsschema. (B) steg från 3,1 till 3,14 i trypsin metoden visas i ett organisationsschema. Klicka här för att visa en större bild.

Figur 2
Figur 2. Bearbetning livmodervävnad. (AC) Kliniska livmoder prov från två kvinnliga patienter. A & F kommer från Patient 1 och B kommer från patient 2. Kirurgiskt opererande livmodervävnad (till vänster) och highlighted livmoder lager (höger). (A & B) Den myometrium är inringad i vitt och endometriet i svart. (C) Den myometrium är vänt mot kameran. (D) Inledande representativa endometrial urvalsstorlekar för både isoleringsmetoder anges. Trypsinet metod kräver ren endometriet före tillsatsen av trypsin medan skrapning metod kan använder hela uterina prover. (E) Exempel på den bearbetade endometrial prov av skrapmetod. (F & G) Foto av kvarvarande livmodervävnad som bereds för Snap Frysning. Visas en lab-made metallbehållare används för denna metod. (H) Formalin fixering för livmoder prov. Klicka här för att visa en större bild.

Figur 3 Figur 3. Lätta mikroskopi bilder av primära endometrial kulturer. . (A) Representativa bilder av endometrial stromal cellkulturer tagna vid olika befogenheter och sammanflytning (B) Representativa bilder av skrapmetoden (Dagar 0 - 16) tas av samma odlingsskålen, som drivs på 10x Anmärkning:. Visuella linjer indikerar repor från kirurgiskt blad (C) Representativa bilder av trypsin metoden.. (dag 0-16) tas av samma odlingsskålen, som drivs på 10x Klicka här för att visa en större bild.

Figur 4
Figur 4. Immun bilder av endometrial stromaceller. (A) Immunofluorescensav primära endometriala kulturer isolerades via skrapmetoden. Bilder visar förlust av cytokeratin mellan passage 2 (P2) och passagen 5 (P5). Promyelocytisk leukemi protein (PML) kärnprotein och DAPI färgning användes som kontroller. (B) Bilder visar positiv färgning för mesenkymala markör Vimentin. Bilder visar också negativ färgning för E cadherin (CDH1) och Cytokeratin. Färgning för DAPI och Promyelocytic leukemi protein (PML) lämnades som kontroller. Klicka här för att visa en större bild.

Figur 5
Figur 5. Spontan decidualisering av två primära endometrial stromaceller. (A) Disposition av experimentell förfarande. (B) uppreglering av Prolaktin (PRL) ochInsulinliknande tillväxtfaktorbindande protein 1 (IGFBP1) genuttryck som svar på MPA och cAMP. Resultaten mättes via RT-qPCR och uttryck normaliserades till GAPDH. Signifikans beräknades med användning av Students t-test (P <0,001 *** och P <0,0001 ****). Båda cellinjer isolerades med hjälp av skrapmetoden. Klicka här för att visa en större bild.

Primer Sekvens Anlöpningstemperatur (° C) Cykler Assay
Prolaktin (PRL) Framåt CATATTGCGATCCTGGAATGAGC 60 40 SYBRGreen
Prolaktin (PRL) Omvänd TCCTCAATCTCTACAGCTTTGGA 60 40 SYBRGreen
Insulinliknande tillväxtfaktorbindande protein 1 (IGFBP1)Framåt TCCTTTGGGACGCCATCAGTAC 60 40 SYBRGreen
Insulinliknande tillväxtfaktorbindande protein 1 (IGFBP1) Omvänd GATGTCTCCTGTGCCTTGGCTA 60 40 SYBRGreen
GAPDH Ospecificerat (se reagens lista) 60 40 Taqman

Tabell 1. PCR-betingelser för decidualisering markörer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Andra grupper har beskrivits och anpassad metod för beredning av endometrial stromal kulturer, varav de flesta använder kollagenas 4,12,13,15-18. I detta manuskript har vi lämnat metodik och bevis för två förenklade primära endometrial stromal odlingsmetoder, som båda används av vårt labb av ekonomiska skäl och den bekväma tillgången till trypsin och / eller ett rakblad.

När man jämför våra två metoder, både framgångsrikt generera livskraftiga primära kulturer. Vår metod som föredras är trypsin metoden eftersom det är vanligtvis en högre avkastning med en mindre krav på urvalsstorlek. Men om förberedelsetiden är begränsad, behöver skrapmetoden 30 minuter medan utstrykning av celler med användning av trypsin-metoden kräver mer än en och en halv timme.

Också värt att notera är att vi visar dessa metoder med hysterektomi prover till skillnad Endometriebiopsier. Endometrial biopsies fattas utan betydande intrång och tenderar att producera mindre exemplar. Ändå bör de metoder som beskrivs i detta manuskript (särskilt trypsin-metoden) erhållande kulturer från endometriala biopsier.

Det finns många applikationer för primär endometrial stromaceller. Jämföra endometrial stromal kulturer från människa kontra andra däggdjur kan ge ledtrådar till de frågor som har debatterats i århundraden om varför människor menstruerar. Det finns andra outforskade fysiologi studier som kräver in vitro-kultur. Av särskilt intresse är de upptäckter som ger inblickar i reproduktiva cykel händelser såsom de fynd som har länkade epigenetiska molekylära händelser till de funktionella händelser i fortplantningscykeln 19,20, 21, och granskas i ref 11.

Läkare skulle ha stor nytta av att studera livmoder stromal kultur och identifiera biomarkörerar i de fall av reproduktionsstörningar och cancer maligniteter. Mellan 2006 och 2010 rapporterades det att 7,4 miljoner kvinnor och deras partner använt infertilitet tjänster i USA 22. En betydande procent av infertilitet beror på fel på decidualisering 23. Dessutom är förhållandet mellan endometrial sjukdomar som hyperplasi och endometrios till infertilitet först nyligen som bedöms. Förmågan att studera livmoder gynekologisk cancer genom in vitro-modellering är också ovärderlig för även om avancerad endometrial sarkom är sällsynt, kan det vara dödligt. Genom att etablera in vitro primära kulturer, studerar vi effekterna av de molekylära händelser i samband med sjukdomar och kan generera förmodade kliniska tillämpningar.

Sammanfattningsvis genere representativ och effektiv in vivo-modeller för många av dessa tillämpningar är svårt. Detta gör utvecklingen av ivitro primära endometrial kulturer för att studera flera in vivo-funktioner kritisk. Dessa två endometrial isoleringsmetoder, "skrapmetoden" och "den trypsin-metoden," kommer att bidra till att ge fotfäste för vår förståelse av endometrial fysiologi och patologi.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har ingenting att utlämnande.

Acknowledgements

Vi tackar ett samarbete med Dr Thao Dang och medlemmar av hennes labb för användning av deras avbildning och mikroskoputrustning. Vi tackar också biorepository och Tissue Research Facility (BTRF) kärna, Jeff Harper, och de boende vid University of Virginia för att förse oss med livmodervävnad. Vi tackar Karol Szlachta för hjälpen med Schematisk översikt.

Materials

Name Company Catalog Number Comments
0.25 Trypsin or 0.05% Trypsin  Hyclone SH3023602 or SH30004202
1.7 micro Centrifuge Tube   Genesee Scientific 22-272A
1 µl, 20 µl, 200 ml and 1,000 µl Pipette   Genesee Scientific 24-401,24-402, 24-412, 24-430
15 ml Conical Tube  Hyclone 339650
50 ml Conical Tube  Hyclone 339652
6 cm Cell Culture Dish  Thermo scientific 12-556-002
8 well Chambers  Thermo Scientific AB-4162
Acetate  Fisher scientific C4-100
AMV RT Enzyme/Buffer  Bio Labs M077L
Bovine Serum Albumin (BSA)  Fisher Scientific BP-1605-100
Buffered Zinc Formalin  Thermo 59201ZF
Charcoal strip FBS  Fisher NC9019735
Chloroform  Fisher Scientific BP1145-1
Cover slip  Fisher Brand 12-544D
Cyclic AMP (cAMP)  Sigma B7880
DMEM/High Glucose  Hyclone SH30243FS
dNTP  Bioline BIO-39025
Donkey Anti Goat -TRITC  Santa Cruz SC-3855
Donkey Serum  Jackson’s lab 017-000-002
E Cadherin Antibody   Epitomics 1702-1
Ethanol  Fisher Scientific BP2818-1
Fetal Bovine Serum (FBS)  Fisher Scientific 03-600-511
Fungizone Amphotericin B  Gibco 15290-018
GAPDH Probe  Life Technologies HS99999905
Glycogen  5Prime 2301440
Goat Anti Mouse - FITC  Jackson’s Lab 115-096-003
Isopropanol  Fisher Scientific BP2618-1
Kanamycin   Fisher Scientific BP906-5
Medroxyprogesterone acetate (MPA)  Sigma M1629
MeOH (Methanol)  Fisher Scientific A4-08-1
Mounting Media (w/DAPI)  Vector Labratories H-1500
N6 DNA Oligos  Invitrogen
Number 15 Scraper   BD 371615
Pan Cytokeratin  Mouse mAB  Cell Signaling 4545
PBS (phosphate buffered saline)  Fisher Scientific BP-399-4
Penicillin-Streptomycin Glutamine Solution 100X   Hyclone SV30082.01
PML Anti Goat Anti body  Santa Cruz SC-9862
Primer(s)  Eurofins
RPMI  Hyclone SH30027FS
RPMI (Phenol free)  Gibco 11835
Sybr Green   Thermo Scientific AB-4162
Taqman  Thermo AB-4138
Trizol  Life Technologies 15596018
Vimentin Antibody  Epitomics 4211-1

DOWNLOAD MATERIALS LIST

References

  1. Heller, D. in The endometrium: a clinicopathologic approach. Heller, D. 56-75 (1994).
  2. Emera, D., Romero, R., Wagner, G. The evolution of menstruation: a new model for genetic assimilation: explaining molecular origins of maternal responses to fetal invasiveness. Bioessays. 34, 26-35 (2011).
  3. Gudjonsson, T., Villadsen, R., Ronnov-Jessen, L., Petersen, O. W. Immortalization protocols used in cell culture models of human breast morphogenesis. Cell Mol Life Sci. 61, 2523-2534 (2004).
  4. Brosens, J. J., Hayashi, N., White, J. O. Progesterone receptor regulates decidual prolactin expression in differentiating human endometrial stromal cells. Endocrinology. 140, 4809-4820 (1999).
  5. Jones, M. C., et al. Regulation of the SUMO pathway sensitizes differentiating human endometrial stromal cells to progesterone. Proc Natl Acad Sci U S A. 103, 16272-16277 (2006).
  6. Salamonsen, L. A., et al. Proteomics of the human endometrium and uterine fluid: a pathway to biomarker discovery. Fertil Steril. 99, 1086-1092 (2013).
  7. Haouzi, D., Dechaud, H., Assou, S., De Vos, J., Hamamah, S. Insights into human endometrial receptivity from transcriptomic and proteomic data. Reprod Biomed Online. 24, 23-34 (2012).
  8. Chen, J. I., et al. Proteomic characterization of midproliferative and midsecretory human endometrium. J Proteome Res. 8, 2032-2044 (2009).
  9. Talbi, S., et al. Molecular phenotyping of human endometrium distinguishes menstrual cycle phases and underlying biological processes in normo-ovulatory women. Endocrinology. 147, 1097-1121 (2006).
  10. Punyadeera, C., et al. Oestrogen-modulated gene expression in the human endometrium. Cell Mol Life Sci. 62, 239-250 (2005).
  11. Ponnampalam, A. P., Weston, G. C., Susil, B., Rogers, P. A. Molecular profiling of human endometrium during the menstrual cycle. Aust N Z J Obstet Gynaecol. 46, 154-158 (2006).
  12. Zhang, L., Rees, M. C., Bicknell, R. The isolation and long-term culture of normal human endometrial epithelium and stroma. Expression of mRNAs for angiogenic polypeptides basally and on oestrogen and progesterone challenges. J Cell Sci. 108, (1), 323-331 (1995).
  13. Richards, R. G., Brar, A. K., Frank, G. R., Hartman, S. M., Jikihara, H. Fibroblast cells from term human decidua closely resemble endometrial stromal cells: induction of prolactin and insulin-like growth factor binding protein-1 expression). Biol Reprod. 52, 609-615 (1995).
  14. Gellersen, B., Brosens, J. Cyclic AMP and progesterone receptor cross-talk in human endometrium: a decidualizing affair. J Endocrinol. 178, 357-372 (2003).
  15. Marsh, M. M., Hampton, A. L., Riley, S. C., Findlay, J. K., Salamonsen, L. A. Production and characterization of endothelin released by human endometrial epithelial cells in culture. J Clin Endocrinol Metab. 79, 1625-1631 (1994).
  16. Siegfried, J. M., Nelson, K. G., Martin, J. L., Kaufman, D. G. Histochemical identification of cultured cells from human endometrium. In Vitro. 20, 25-32 (1984).
  17. Rawdanowicz, T. J., Hampton, A. L., Nagase, H., Woolley, D. E., Salamonsen, L. A. Matrix metalloproteinase production by cultured human endometrial stromal cells: identification of interstitial collagenase, gelatinase-A, gelatinase-B, and stromelysin-1 and their differential regulation by interleukin-1 alpha and tumor necrosis factor-alpha. J Clin Endocrinol Metab. 79, 530-536 (1994).
  18. Dimitriadis, E., Robb, L., Salamonsen, L. A. Interleukin 11 advances progesterone-induced decidualization of human endometrial stromal cells. Mol Hum Reprod. 8, 636-643 (2002).
  19. Sakai, N., et al. Involvement of histone acetylation in ovarian steroid-induced decidualization of human endometrial stromal cells. J Biol Chem. 278, 16675-16682 (2003).
  20. Logan, P. C., Ponnampalam, A. P., Steiner, M., Mitchell, M. D. Effect of cyclic AMP and estrogen/progesterone on the transcription of DNA methyltransferases during the decidualization of human endometrial stromal cells. Mol Hum Reprod. 19, 302-312 (2013).
  21. Tamura, I., et al. Induction of IGFBP-1 expression by cAMP is associated with histone acetylation status of the promoter region in human endometrial stromal cells. Endocrinology. 153, 5612-5621 (2012).
  22. American Society for Reproductive Medicine: Quick facts about infertility. Available from: http://www.asrm.org/detail.aspx?id=2322 (2013).
  23. Salker, M., et al. Natural selection of human embryos: impaired decidualization of endometrium disables embryo-maternal interactions and causes recurrent pregnancy loss. PLoS One. 5, (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics