C57BL / 6 마​​우스의 전신 홍 반성 루푸스의 BM12 유도 성 모델 (SLE)

JoVE Journal
Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Klarquist, J., Janssen, E. M. The bm12 Inducible Model of Systemic Lupus Erythematosus (SLE) in C57BL/6 Mice. J. Vis. Exp. (105), e53319, doi:10.3791/53319 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

전신성 홍 반성 루푸스 (SLE)는 항핵 항체 (ANA) 생산 및 사구체 신염을 특징으로 prototypically 복잡한자가 면역 질환이다. 많은 다른 피부를 포함하여 후유증, 심장 - 폐 및 간 병변은 몇몇 개인의 질병과 관련이있다. 미국에서 보급 추정치는 여성과 소수 민족 (3)에서 특히 높은 빈도로, 150,000-1,500,000 1, 2에서 널리 다릅니다. SLE의 원인이 식별 곤란 하였지만, 전신성자가 면역에 절정 다양한 유전 적 및 환경 적 요인의 상호 작용으로부터 발생하는 것으로 생각된다.

많은 동물 모델은 질병 발병과 진행으로 이어지는 요인을 연구하기 위해 사용되었다. SLE의 클래식 마우스 모델은 P 등 안에 1000mg F1 모델과 NZM 유도체, MLR / LPR 변형 및 BXSB / YAA 변형 및 유도 시스템 NZB x를 포함하여 유 전적으로 걸리기 마우스 균주를 포함ristane 및 만성 이식편 대 숙주 질환 (cGVHD) 모델 4. GVHD 모델에서자가 항체 생산의 초기 보고서는 F1 전송 5에 부모에 대한 다양한 마우스 균주 또는 햄스터 균주를 사용 - 8; 루푸스와 같은 질병을 연구하는 데 더 일반적인 방법은 현재 DBA / 2 부모 → (C57BL / 6 ×의 DBA / 2) F1, 여기에 설명 된 BM12 전송 모델을 포함한다. 각 모델은 자신의주의를 가지고 있지만, 그들은 일반적으로 인간의 질병의 임상 적 특징과 상관 관계 기능의 공통 집합을 공유합니다. 마우스 모델에서 가장 흔히보고 된 파라미터는, 비장 종대, 신장염, ANA 생산을 포함하고, 세포 수준에서, T 모낭 헬퍼 세포 (TFH), 배 중심 (GC) B 세포와 플라즈마 세포의 팽창.

H2 - - AB1 BM12 / KhEgJ (BM12) 마우스, 변형 내가 유도 BM12 모델은 IA BM12 B6 (C)에서 림프구의 입양 전송에 의해 달성된다MHC 클래스 II에 3 아미노산 치환을 제외하고 C57BL / 6 dentical, IA에 C57BL / 6 (B6) 마우스 나. 받는 사람 장갑차에 의한 기증자 CD4 T 세포의 Alloactivati​​on는 증상이 밀접하게 SLE를 닮은으로 cGVHD로 연결됩니다. 특히, 이러한 도너 유래 TFH의 팽창, 수신자 유래 GC의 B 세포와 플라즈마 세포의 팽창 및 항 dsDNA, 항 ssDNA를 방지 염색질 및 안티 RBC 항체 9 포함한 아나의 생산을 포함한다. 시간이 지남에 따라,받는 사람 마우스는 사구체 간질에 IgG의 예금 및 신장 (10)의 혈관 영역과 관련된 사구체 신염을 개발한다. 우리는 최근 인간의 질병과 유사한, 나는이 모델 11 IFN 유형에 대한 중요한 역할도 있습니다, 것으로 나타났습니다. 특히, 인간 SLE 대한 정의 기준은 항 dsDNA의 존재 하에서 SLE와 호환 신염의 개발이 마우스 모델의 두드러진 특징은 둘 다 12 항체를 포함한다.

있다 SE자연 모델에 비해 BM12 모델의 veral 장점. 자발적으로 SLE 같은 징후를 개발 클래식 모델은 녹아웃하거나 유전자 변형 마우스 어렵고 시간이 많이 소요하는 교차 만든다 하이브리드 마우스 변종이 아닌 B6 배경에 B6 배경, 또는 대형 유전 좌위에 근친 마우스 균주 중 하나에 의존한다. BM12 유도 모델, 유전자 변형 마우스는 특정 유전자 질환에 중요 할 수있는 셀룰러 구획의보다 신속한 식별을 허용 도너 또는 수신자 중 하나의 역할을 할 수있다. 또한, BM12 모델 질환 개발은 대부분 자발적 모델 수개월에 비해 아나의 출현까지 단지 2 주 필요한 훨씬 빠르다. 또한, 서로 다른 시점에서 질환이 자발적 모델 달리 BM12의 → B6의 모델에서 질병의 발병 및 진행은 고도로 동기화된다. 이것은 수 b 적절한 크기의 코호트 생성을 허용전자는 질병 개발의 모든 단계에서 중재 또는 치료 전략에 사용됩니다.

다음은 B6 배경에 C57BL / 6 마​​우스에 BM12 림프구의 입양 전송, 또는 유전자 변형에 의해 전신성 홍 반성 루푸스와 같은자가 면역을 개시하기위한 상세한 프로토콜입니다. 또한, 우리는 TFH, GC B 세포를 열거하는 유세포 염색 프로토콜을 기술하고, 형질 세포 - 세포 유형은 인간의 질병과 관련된. 중요한 것은, 이러한 프로토콜은 SLE의 대부분의 마우스 모델에서 질병의 특성 및 기타 질병 모델에서 TFH, GC B 세포와 플라즈마 세포를 식별하기 위해 사용될 수있다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

동물의 작업은 평가 및 실험 동물 관리 국제 인증 및 우리의 기관 동물 관리 및 사용위원회 협회 (IACUC)에 의해 설정 지침에 따라 특정 병원균이없는 조건에서 수행 하였다.

주 : 이러한 도너받는 동물 또는 가능한 경우에 하나로서 CD45.1 congenic 마커를 발현하는 마우스 통합, 이것은 도너 그래프트 효율과 도너 CD4 T 세포의 특정 집단 팽창을 모니터링 할 수있게하기 때문이다. 도너 또는 수신자 달리 유전자 변형 마우스의 사용을 고려하는 경우, 균주가 적절 B6 배경에 backcrossed되거나 전송 세포 거부-이는 될 수 대표적인 결과 및 토론 섹션에서 더욱 상세히 언급 될 것이다 보장.

참고 : 12-16 쥐를 주입하기에 충분한 세포를 생성한다 마우스 BM12 수확 4 기증자에 대한 다음 절차의 세부 볼륨. 여섯십이주 된 BM12 마우스에 약 25 % CD4 T 세포와 약 100-140000000 림프구를 얻을 수 있습니다. 위 또는 아래로 따라 마우스의 다른 번호 또는 다른 마우스 변종, 규모의 볼륨으로 시작합니다. C57BL / 6 마​​우스는 일반적으로 20 % CD4 T 세포에 가까운 유사한 수익률을 제공합니다.

참고 : 실온에서 모든 단계를 수행하고 장기 림프구의 생존 능력을 손상시킬 수 있습니다 더위와 추위 충격을 피하기 위해 RT 미디어를 사용합니다. 조직 수확 및 무균 기술을 사용하여 조직 배양 후드에서 조직 - 처리 단계를 수행한다. 이 프로토콜의 모든 매체와 IMDM 인 10 % 열 - 불 활성화 된 달리 지시되지 않는 한, FBS, 단순히이라고한다 "완전한 매체."

1. 새로운 방법 유전자형 BM12 마우스에 대한

주 : 유전자형에 대한 간략한 요약 제한 기반 프로토콜은 단지 출판 유전자형 인 시퀀싱 방법에 간단하고 저렴한 대안으로서, 여기에 제공된다이 쥐.

  1. 마우스 꼬리에서 게놈 DNA를 분리합니다. 마우스 꼬리 자르기에 대한 자세한 프로토콜에 대한 이전의 조브 기사와 꼬리에서의 cDNA의 생성을 참조하십시오 (13)를 소화.
  2. 표 1의 프라이머 및 열 순환 조건을 사용 BM12 MHC-II B와 IA IA에서 공통 474 염기쌍의 DNA 단편을 증폭하기 위해 역전사 중합 효소 연쇄 반응 (PCR) (14)을 수행한다.
  3. 제한 효소 PsuI 또는 야생형에게 IA B를 잘라 그 isoschizomers (BstX2I, BstYI, MflI 또는 XhoII) 중 하나가 아닌 IA BM12 돌연변이를 사용하여 PCR 생성물 ~ 7 μL에 다이제스트 수행. 물 혼합물을 지정 버퍼 것이다 효소 제조, 및 5 분의 인큐베이션에 의해 제공된 프로토콜에 따라 다이제스트. 37 ° C를 15에서 몇 시간에.
  4. 로드 생성물을 소화하고 30-45 분간 티듐 브로마이드 (14) 1 % 폴리 아크릴 아미드 겔상에서 실행. (1)에서50V-불구하고 최적의 전압 및 시간 설정이 사용되는 PCR 젤 장치에 따라 달라집니다. 자외선 조명으로 DNA 밴드를 시각화. 대표 결과는 그림 1에 나타내었다.

그림 1
유전자형 결과 BM12 그림 1. 대표.
IA BM12 / BM12에 대한 동형 접합 마우스를 확인하려면, 꼬리 DNA를 PCR로 BM12에 대한 상영되었다 / 제한 유전자형 (1 단계)을 소화. 동형 접합 야생 유형 (IA B는 / B) DNA는 227 두 밴드 (~ 250 bp의 하나의 두꺼운 밴드로 시각) 247 BP를 산출; 동형 접합 BM12 (IA BM12 / BM12) DNA 수익률 474 bp의 하나의 밴드; 와 이형은 (IA의 BM12은 / B) DNA는 ~ 250 및 474 bp의 두 밴드를 얻을 수 있습니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

2. 수확 기부세포

  1. 기관 동물 관리 및 사용위원회 (IACUC)를 사용하여 희생 기증자 마우스는 기본 및 보조 안락사 방법을 -approved. 예를 들어, 경추 탈구이어서 CO 2 질식에 의해 안락사 쥐.
  2. 11 ~ 13과 10 ml의에게 완전한 매체를 포함하는 15 ml의 튜브에 무균 기술, 수확 비장과 림프절 (피상적 인 자궁 경부, 하악, 상완, 겨드랑이, 장간막, 그리고 사타구니)를 사용.
    참고 : 자세한 림프절 절제술 프로토콜 (16)에 대한 이전의 보고서를 참조하십시오 - 18. 이 모델은 이전에 대해서만 마우스 비장 세포를 사용하여도 성공적이지만, 림프절 외에도 크게 공여 마우스의 필요한 수를 감소시킨다.
  3. 주사기의 플런저를 사용하여 70 μm의 셀 스트레이너를 통해 단계 2.2에서 수집 된 림프 조직을 매쉬업하여 단일 세포 현탁액을 생성합니다. 매 4 더 나은 금리를 들어, 과부하가 걸리지 않도록 여과기를 사용하기는 ~ 6 여과기마우스 처리하고, 처리 자주하는 동안 여과기를 씻어. 400 XG에서 5 분 후, 두 50 ML 원뿔 튜브에 4 쥐에서 원심 분리기 세포 조직을 결합하고 상층 액을 가만히 따르다.
  4. 50 ml의 완전한 미디어와 새로운 원뿔 관에 전송 모두 원뿔 튜브에서 재현 탁 세포. 실온에서이 튜브를 유지합니다.
    주 : 지방 관의 측면에 부착하고, 상기 튜브가 교체되지 않은 경우, 최종 세포 수율이 나빠질 수있다.

3. 기증자 세포 계수

참고 : 전체 샘플의 가장 높은 생존 능력, 적혈구 (RBC) 용해를 유지하려면하지 않는 것이 좋습니다.

  1. 물론 단계 2.4에서 단일 세포 현탁액을 혼합 한 용액을 제거하고 별도의 50 ㎖ 원뿔로 전송. 계산하는 동안 옆으로 실온에서, 손길이 닿지 않은 세포 (49 ml)에 남아있는 설정합니다.
  2. 1ml의 공여체 세포 샘플에 염화 암모늄 계 적혈구 세포 용해 완충액 3 mL로 추가한다. 1 분 동안 부드럽게 섞는다. 흔들어, 다음 전체 미디어와 50ml로 작성차 5 분 동안 원심 분리기. 400 XG와 캔트 상층 액에서.
  3. 재현 탁 (혈구를 사용하여 트리 판 블루 예) 10 ml의 완전한 매체와 카운트 세포를 적혈구는-용해. 곱셈 결과에 의해 49-이것은 방치 하였다 비 용균 샘플에 남아있는 셀들의 총 개수이다. 취소 세포를 적혈구는-용해.

및 / 또는 CD4 T 세포 정화 4. 기증자 셀 라벨

  1. 원한다면이 필요한 것은 아니지만,이 단계에서 CD4 T 세포를 정제. 19와 CFSE와 레이블 세포 또는 다른 세포 추적 염료, 원한다면 또한, 일례로는 대표적인 결과 부분의도 4에 도시된다.
    참고 : 높은 순도를 달성하고 20에 기술 된 바와 같이 높은 생존 능력 손길이 닿지 않은 세포 잎 수 CD4 T 세포 정화를 들어, 부정적인 자기 선택이 좋습니다. 이는 독소 가능한 버퍼가 사용되는 것이 중요하다; 따라서, 대신 BSA의 분리 버퍼 위트을H 2 % FBS와 EDTA의 권장 농도.

기증자 BM12 세포의 5 주입

  1. 400 × g으로 5 분 동안 3 단계 (정제 또는 필요에 따라 4 단계로 표시), 원심 분리기에서 세포를 공여자 림프구를 카운트 한 후. ml의 당 120,000,000 림프구 (또는 ml의 당 3000 만 정제 CD4 T 세포)에서 PBS에 뜨는 및에 resuspend 세포를 가만히 따르다. 멸균 5ml를 쉽게 27.5 G X 13mm 바늘을 장착 한 ML의 주사기를 수용 둥근 바닥 튜브, 또는 다른 멸균 튜브에 세포를 전송합니다.
  2. 도너 샘플 내의 CD4 T 세포의 비율을 결정하기 위해 흐름 염색 4 ℃에서 따로 단계 5.1에서 공여 세포의 작은 샘플을 설정하기에 앞서 주입. 최소 항체 패널 (표 2)를 사용하여 단계 8에 기재된 바와 같이 이들 샘플을 염색.
    주 : 상이한 마우스 균주에서 분리 된 세포를 도너로서 사용하는 경우, 이것은 중요한 고려 사항이며, CD4 T 세포의 비율은 실질적으로 달라질 경우 끝까지 마음형 치수가 요구 될 수있다.
  3. 부드럽게, 그러나 철저하게 세포를 섞는다. 이것은 최대 세포를 피펫 팅에 의해 연결된 바늘없이 1 mL의 주사기를 이용하여 아래로 행해질 수있다. 혼합 한 후, 1 ML의 주사기로 세포를 그립니다. 공기 방울을 제거한 후 바늘을 연결합니다. 주사기를 프라이밍을 끈 상태에서 바늘을 유지하는 것은 세포 생존 능력을 유지하는 데 도움이됩니다.
  4. 21에 기술 된 바와 같이, 복강 내 (30,000,000 림프구, 마우스 당 750 만 정제 CD4 T 세포와 동일하다)을 마우스 1 마리당 250 μl를 주입한다.
    참고 : 여기에 표시된 실험에서 우리의 이전 작업 (11)에, 각각의 마우스가 오히려 전통적으로 사용되는 1 억 총 비장 세포보다 BM12 기증자로부터 3,000 만 총 림프구 주입된다. 우리가 실험실에서 출판되지 않은 데이터에 차이는 마우스 당 30 억 림프구의 주사 다음 14 일에 혈청 항 dsDNA 관찰되지 않았다. 이로 인해 실험에 필요한 생쥐의 수, 신장염 재치의 개발을 감소하면서H 세포의 수는 평가되지 않았다.

6. 효율성을 접목 결정

주 1 :이 섹션에서는 최적 주사를받은 수있는 마우스 (예, 한 마우스에 이식은 볼이의 <10 % 식별하기 위해 3 일에서받는 사람의 기증자 세포 이식의 정도를 확인하는 방법에 대해 설명합니다 같은 그룹에서 다른 모든 마우스). 이러한 데이터는 유전자 변형 마우스 변형에서 세포 (자세한 내용은, 대표적인 결과 섹션을 참조하십시오 그림 6) 나중에 지점에서 거부 여부를 확인하는 데 도움이 될 수 있습니다.

주 2 :이 섹션은 CD45.1 BM12 기증자와 CD45.2 C57BL / 6 수신자를 사용하는 경우 기증자와받는 사람이 다른 congenic 배경, 예를 들어,에 생쥐있는 경우에만 가능하다, 또는 공여 세포는 세포 추적 염료로 표시하는 경우. 중요한 3 일 후 분사에서, CD4 T 세포의 팽창을 최소화받은 (SE이식의 정도에서 관찰 차이가 주사의 변화로 인해 확장되지 않도록 전자 대표 결과 섹션, 그림 4).

  1. 4 % 이소 플루 란 또는 다른 IACUC 승인 방법으로 쥐를 마취. 제대로 혈액 무승부를 진행하기 전에 마취 마우스를 보장하기 위해 후방 발 반사 신경을 테스트합니다.
  2. 같은 22와 복고풍 궤도 구멍으로 IACUC 승인 방법을 사용하여 수확 100-200 μL 혈액입니다. 동결 건조 칼륨 EDTA를 함유 물질 테이블에서 참조 플라즈마 수집 튜브 같은 항 응집제를 함유하는 개개의 0.5 ml의 마이크로 원심 튜브에 혈액을 수집한다. 채혈 후 최종 조직 수확 (7 단계) 될 때까지 유지됩니다 여기서 다시 홈 케이지에서 마우스를 한 후, 출혈 중지를 보장 배치 멸균 수건이나 거즈를 사용하여 마우스 눈에 부드러운 압력을 적용합니다.
    참고 : 마우스가 충분한 의식을 회복 한 무인 때까지 쥐를 두지 마십시오복부 드러 누움을 유지하고 완전히 회복 될 때까지 다른 사람의 회사에 마우스를 반환하지 않습니다.
  3. (천천히 두 단계 사이에 혼합 최소화하기 위해주의하고, 200 μL 피펫으로 21 ° C 고밀도 세포 분리 솔루션의 200 μl를 밑받침, 21 ° C PBS로 500 μL 혈액 볼륨을 가져오고 원뿔 바닥 microcentrifuge 관에 전송 ) 권장 해결 방법에 대한 자료 표를 참조하십시오. 낮게 설정 원심 브레이크와 20 ~ 25 ℃에서 20 분 동안 700 XG에 원심 분리기 세포.
  4. 800 μL에게 차가운 완벽한 미디어를 포함하는 새로운 microcentrifuge 관에 1 ML의 피펫 및 전송과 림프구를 포함하는 상위 레이어를 제거합니다. 부드럽게 세포를 섞어 소용돌이. 5 4 ° C에서 최소 및 캔트 상층 액 700 XG에 원심 분리기 세포.
  5. 200 μL에 재현 탁 세포 t를 결정하는 최소 항체 패널 (표 2)를 사용하여 단계 8에 기재된 바와 같이 유동 세포 계측법에 대한 전체 미디어, 96 웰 U 바닥 판에 전사하고, 얼룩그 PBMC를 백분율로 CD4 T 세포의 상대적인 풍부함 그래프트.

7. 최종 조직 수확

주 : 결과 섹션에서 설명한 실험 14 일 공여 세포의 주입 후 수거 하였다 (또는 어떤 경우에 더 적은 시간), 그들이 TFH 세포와 플라즈마 세포의 초기 개발에 초점으로; 이 모델은 SLE의 만성 GVHD 모델이기 때문에, 많은 질환은 이후 시점에서 모니터링 될 수있다. 최적의 기간은 각 실험에서 제기 된 연구 문제에 따라 달라집니다.

  1. BM12 공여 세포 (단계 5.4)의 주입 후 소정의 시점에서, 안락사 IACUC 승인 방법을 사용하여 마우스를 희생. 방혈 다음 CO 2 질식을 권장합니다. 경추 탈구 안락사 보조 방법으로서 기능 할 수 있지만, 이것은 피 연신 수율을 감소시킬 수있다.
  2. 가볍게 70 %를 함유하는 스프레이 병 마우스의 복부 젖은에탄올. 약 1cm 성기 위 수술 가위로 작은, 피상적 절개를합니다. 그대로 복막 근막을 유지하기 위해주의하고, 흉골쪽으로 복부의 피부를 다시 그립니다.
    주 :이 아직 잘 특징되지 않았지만, 측정 추가적인 질병 인자로 분석 될 수있다 (14) 일에 0.5-3 ml의 복수, 본 일반적으로 병에 걸린 쥐.
  3. 18 G 바늘 5 ML의 주사기를 장착한다. 동물의 머리쪽으로 및 근막의 평면에 15도 각도로 지시 바늘로 복부의 오른쪽 아래 사분면에 바늘을 삽입합니다. 복수를 흡입하면서 소장에 막힌 얻기에서 바늘을 방지하기 위해 맹장 근처에 바늘 끝을 배치합니다.
  4. 조심스럽게 천천히 주사기로 복수를 그릴, 옆에 마우스를 회전합니다. 복수가 복구되면, 주사기를 제거하고 syri의 측면에 마킹 체적에 기초 흡 부피를 기록NGE.
  5. 나중에 처리를 위해 얼음에 5 ml의 둥근 바닥 튜브 및 저장소로 배출 복수.
  6. 기본적으로 22와 하대 정맥 (IVC)에서 추첨을 통해 수확 혈액. 무딘 집게를 사용하여 부드럽게 IVC를 폭로, 마우스의 왼쪽으로 창자를 이동합니다. IVC로 1 ML의 주사기에 장착 27.5 G 바늘을 삽입하고 천천히 혈액의 400-500 μl를 그립니다.
  7. 용혈을 최소화하기 위해 천천히 0.5 ml의 마이크로 원심의 혈청 또는 혈장 수집 튜브로 혈액을 주입. ELISA로 아나 이후 혈청 분석을 위해, 얼음에 혈액을 유지.
  8. (원하는 림프절, 신장, 특히 나중에 포인트와 사구체 신염에서 수집하는 것은 채점됩니다 경우, 비장과) 해부 및 추가 관련 조직을 얻을 수 있습니다. 부드럽게 창자 다시 동물의 오른쪽 방향으로 배치하고, 비장의 기본 결합 조직이다 췌장, 당겨 비장을 제거합니다.
  9. 남아있는 췌장을 제거한 다음 무게총 비장은 SLE의 마우스 모델에서 일반적으로보고 파라미터이기 때문에, 즉시 절개 후 고정밀 균형 비장. 얼음에 1ml의 완전한 미디어 가득 각각 1.5 ml의 튜브에 림프 조직을 놓습니다. 10 % 중성 포르말린에 신장을 수정 또는 23과 나중에 조직학에 대한 신장을 동결 스냅.
  10. 3 분 동안 수집의 2 시간 내에 원심 분리기 혈액. 10,000 XG (4 ° C를)에서. ELISA로 ANA 이후 분석을 위해 -80 ° C에서 혈청 및 저장소를 제거합니다. 자세한 ANA ELISA 프로토콜 (24, 25)에 대한 이전의 보고서를 참조하십시오. 다수의 10 ~ 20 μL 씩 보관 혈청 동결 / 해동 사이클을 최소화하고, 미래 분석의 큰 수를 허용합니다.
  11. 원심 분리기는 5 분 400 XG를 복수. ml의 0.5 여러 개의 튜브에 1 ML의 피펫과 나누어 함께 뜨는을 제거합니다. 반핵 항체 (수요일) 또는 다른 수용성 염증 매개 이후 분석을 위해 -80 ° C에서 상층 액을 동결.
  12. 재현 탁 세포 fract 약 1 ml의 완전한 미디어 이온 (단계 8에서와 같이) 유동 염색 용 96 웰 U 바닥 플레이트에 200 μL를 전송.
  13. 별도의 튜브에 70 μm의 셀 스트레이너를 통해 각각의 비장 매쉬와 완전한 미디어 씻어. 1 분 동안 1 ㎖의 차가운 RBC 용해 완충액으로 비장 세포를 재현 탁. 그리고 흔들어 가볍게 섞는다. 400 XG에서 5 분 동안 차가운 완전한 매체와 원심 분리기 10 ml의 볼륨을 가져오고 뜨는을 가만히 따르다.
  14. 5ml에 재현 탁 세포 펠렛은 전체 미디어는 혈구를 사용하여 계산. 전체 미디어의 200 μL가 1-3000000 세포를 포함하도록 볼륨을 조정합니다. 기증자 CD4 T 세포 및받는 사람 B 세포 분화 및 확장을 정량화하기 위해 확장 패널 (표 2)를 사용하여 유동 세포 계측법 (8 단계)에 대한 염색 시작합니다.
    참고 : 어떤 레이저에 따라서는, 광전자 증 배관 (PMT), 및 필터 설정 조합은 여러 패널로 T와 B 세포의 분석 패널을 분리하는 것이 필요할 수있다 사용할 수 있습니다.
ve_title "> 8. 흐름 염색

  1. 전사, 또는 96 웰 U 바닥 플레이트의 별도 웰에 둥근 바닥 튜브 개별 5 ㎖에 200 μL 완전한 미디어 1-3000000 비장.
    참고 : 96 웰 플레이트를 이용하여 다수의 시료를 염색하지만, 교차 오염을 방지하기 위해, 그 밖의 모든 웰에 시료를 플레이트에 조심하는 효율적인 방법이다. 한 96 웰 플레이트 (24) 샘플을 적절히를 보유 할 수 있습니다.
  2. 3 분 500 XG에 원심 분리기 판. 적절한 (생물) 용기에 판에서 다음 영화 상층 액.
  3. 제조업체에서 권장하는 농도 1 μg의 / ㎖에서 항 CD16 / 항 CD32 항체 칵테일 정제에서 고칠 생존 염료를 포함하는 (PBS에 1 % FBS) 흐름 버퍼 100 μL와 세포 펠렛을 재현 탁. 다음 생존 염료을 해소하기 위해 100 μL 감기 전체 미디어를 추가, 20 ~ 25 ℃에서 10 분 동안 품어.
    참고 : 병에 걸린 마우스의 비장 세포는 일반적으로 죽었거나 죽어가는 세포의 상대적으로 높은 숫자를 포함;따라서, 생존 염료의 포함은 세포 죽어 청소기, 더 신뢰할 수있는 데이터의 결과의 비 특이 항체 라벨을 방지하는 것이 좋습니다. 마찬가지로, 항 CD16 / 항 - CD32는 칵테일의 Fc 수용체 결합에 의해 비 특이 형광 표지 된 항체를 차단하기 위해 포함된다.
  4. 3 분 500 XG에 원심 분리기 판., 생물 학적 용기에 판에서 다음 영화 상층 액. 200 μL 플로우 버퍼에 재현 탁 된 세포. 3 분 500 XG에 원심 분리기 판., 생물 학적 용기에 판에서 다음 영화 상층 액.
  5. 50 μL 흐름 버퍼를 포함하는 항체 칵테일을 Resuspend 세포 (표 2). 4 ° C에서 20 분 동안 품어, 150 μL 흐름 버퍼를 추가합니다. 반복 세척 단계 8.4.
  6. PBS 100 μL 2 % 파라 포름 알데히드와 재현 탁 세포. 4 ℃에서 30 분 동안 품어, 다음 100 μL 흐름 버퍼를 추가합니다. 3 분 500 XG에 원심 분리기 판., 생물 학적 용기에 판에서 다음 영화 상층 액.
  7. ResuspeND 200 μL 유동 완충액, 관 삽입물 또는 표준 유동관​​ 흐름 유동 세포 계측기에 취득 될 때까지 어두운 4 ℃에서 추가로 100 ~ 200 ㎕의 유동 완충액, 및 저장소를 추가로 전송.
  8. 사이토 염색 몇 일 이내에 선택 항체 패널에 적합한 레이저와의 PMT가 장착 된 흐름에 취득. 또한 레코드 전방 산란 폭 및 / 또는 높이가 산란 영역 측면 산란 영역 및 이용 형광 파라미터 영역을 전달한다. 신뢰할 수있는 결과를 들어, ≥1,0​​00 기증자 각 WT 샘플에서 세포, 또는 너무 많은 이벤트의 수집이 가능하지 않을 수 있습니다 공여 세포의 최소한의 확장을 보여 유전자 변형하거나 조작 생쥐에서 총 림프구의 상당 수를 획득.
    주 : 분석은 (- 6도 3) 대표 결과 섹션에서 상세히 설명된다 유동 세포 계측법.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

병에 걸린 마우스는 질량과 세포 수 (그림 2)의 측면에서 비장을 2 ~ 3 회 건강한 쥐의 크기를 나타내는, 적은 14 일 종대을 개발한다.

비장 세포는 순차적으로 빛 산란 (SSC-에 의해 FSC-A)에 문이있다, 이중선 (FSC-으로 FSC-W 또는 -H), 생존 세포 (생존 염료의 낮은 염색) 및 CD4 + TCRβ + (그림의 제거 3A). 공여 세포는 CD45.1 및 CD45.2 (도 3b, 왼쪽 아래)에 기초하여 수신자 세포로부터 구별된다. PD-1, CXCR5,과 Bcl-6, 및 ICOS (도 3B, C)의 상향 조절을 특징으로 공여 세포는 주로, T의 모낭 헬퍼 (TFH) 세포의 표현형을 채택한다. 수신자 CD4 T 세포 집단의 일부는 또한 TFH (도 3b, 오른쪽 아래)로 구별. 전사 셀 초기 다이 - 오프 및 / 또는 이송 후, 도너 유래 TFH의 팽창은 대수, R이고쥐의 비장에서 10-20000000 세포를 eaching 십사일 주입 (그림 3D) 후.

전송 림프구의 CFSE - 라벨은 CD4 T 세포가 초기 활성화 후 TFH로 분화하는 기증자를 보여; 본질적으로 모든 분할 셀은 3 일, 7에서 관찰하고, 14 CXCR5과 PD-1을 (도 4)를 상향 조절. 확산 피크 프로파일은 또한 기증자 CD4 T 세포의 상대적으로 낮은 비율 alloactivati​​on과 분열을 시행하는 것이 좋습니다. 날 (14)에 의해, 검출 공여 세포의 대부분은 CFSE에 의한 측정 부문의 최대 수 초과 분할 한 것들이다.

도너 - 유도 TFH의 팽창은 내인성 GC의 B 세포와 플라즈마 세포 (도 5a)의 대응 누적 수반된다. 비장 형질 세포 축적 3 일 또는 7 (도 5b)에 나이브 동물 위에 더 증가 나타내지 않는, TFH에 비해 지연된다. Accordingly, 항핵 항체는 종래 9 일 (데이터는 도시하지 않음)에 용이하게 검출되지 않지만 안정적 일 14 일 11 일에 정량화 될 수있다.

congenic 마커를 사용하여, 우리는 여러 균주에 공여 세포의 거부 반응을 관찰했다. 이 마우스는 충분히 C57BL / 6 배경에 backcrossed되지 않는 일반적인 문제이지만 BM12 세포는 일반적으로 완전히로 간주됩니다 B6.PL- Thy1 / CyJ (CD90.1) 마우스에 전송 될 때, 우리는 거부 반응을 관찰 backcrossed. 따라서, 마우스는 통상적으로 초기 CD4 T 세포 이식의 효율을 평가하기 위해 유동 염색에 의해 혈액 샘플을 3 일 ~ 스크리닝한다; 우리는 세포가 초기 시점에서 매우 작은 확대 이식 CFSE 증식​​ 실험에서 알고있다. 이러한 결과는 14 일 수확에서 얻어진 결과와 비교 한 후이다. 거부 예 케이스 천만 CD45.1 + BM12 림프구 Cardif로 옮겼다 - / - 12 세대에 대한 C57BL / 6 마우스에 backcrossed했다 쥐. 5 일째, 모든 마우스는 등가 래프팅 (CD4 T 세포를 순환 2-3 %)을 표시하지만, 일 (14)에 의해, BM12 공여 세포는 완전히 전적으로 변형 된 수신자 (도 6)로부터 제거 하였다.

그림 2
도 2 비장 성장 동역학 BM12 림프구의 주입 후에. 비장 직접 절단 (왼쪽) 후 고정밀 밸런스에 칭량 하였다. 생균 수 (오른쪽) 사균을 제외하는 트립 판 블루를 이용하여 혈구 계수하여 결정 하였다. 결과는 SEM, 평균 ±로 묘사된다 여기서 n = 9, 4, 3, 6, 각각. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

JPG "/>
SLE. CD45.1 + BM12 림프구의 BM12 모델 T 여포 헬퍼 세포의 확장 그림 3. 분석은 C57BL / 6 수신자로 전송하고 비장 14 일 후 분석 하였다. (A) "림프구"(첫 번째 패널), "단일 셀"(두 번째 패널), "살아있는 세포"(제 3 패널)와 "CD4 T 세포 '(제 4 패널)을 보여주는 대표적인 게이팅 전략. (B) 공여 세포는 CD45.1 및 CD45.2 염색으로받는 CD4 T 세포 구분 및 PD-1 및 CXCR5의 발현을 위해 분석된다. 일반적 TFH과 관련된 여러 단백질의 상향 조절로 나타낸 바와 같이 (C) 공여 세포는 TFH 표현형을 채택한다. (D) 3 일, 7시, 포스트 (14) 및 트랜스퍼 (CD4 + CD45.1 + PD-1 + + CXCR5 생균으로 정의) 도너 유래 TFH의 확장을 나타내는 전형적인 결과. 결과가 도시되어있다S는 ± SEM을 의미 여기서 n = 5, 4, 3, 6, 각각. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 4
그림 4. PD-1과 CXCR5는 분열하는 세포에서 상향 조절된다. BM12 세포 전에 C57BL / 6 수신자에 주입 CFSE으로 표시했다. 대표적인 흐름 플롯은 3, 7시에 기증자 CD4 T 세포에 대해 표시, 14 일 주사 후.되는 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 5
도 5의 플라즈마 비장 세포 및 GC B 세포의 확장. (A) 나이브 마우스 비장 주제 유동 플롯, 또는 이들로부터십사일 CD45.1 + BM12 전송 후 마우스. 플라즈마 세포는 CD138 + CD19 낮은 살아있는 세포 (상단 패널)로 정의됩니다. GC B 세포는 GL-7 개의 FA (하단 패널)을 표현하는 CD19 + B 세포의 서브 세트이다. (B) Quantitave 데이터는 시간 경과에 플라스마 비장 세포의 축적을 도시. 결과는 SEM, 평균 ±로 묘사된다 여기서 n = 5, 4, 3, 6, 각각. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 6
그림 6. BM12 이식 일부 유전자 변형받는 사람 마우스에 의해 거부됩니다. CD45.1 + BM12 림프구는 유전자 변형 마우스 (상단 패널) 또는 C57BL / 6 (하단 패널)받는 사람 마우스 하나에 옮겼다. 마우스 5 일 포스트 주입에 출혈 및 이식 효율을 평가 하였다. 비장같은 쥐에서의이 십사일 후 분석 하였다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

프라이머 이름 시퀀스 (5 '- 3') 어닐링 온도
Bm12F CGTGGTCCCCGCTGTCCCCC * 65 ° C
Bm12R GGGCAGAGGGCAGAGGTGAG
분절 사이클의 수 온도 지속
1 1 95 ° C 2 분.
(2) (40) 95 ° C 15 초.
* 65-0.5 ° C / 단계 15 초.
72 ° C 45 초.
3 1 72 ° C 10 분.

표 1 :. 프라이머 및 BM12의 유전자형에 대한 열 순환 조건 최적의 열 순환 조건은 사용되는 정확한 시약 및 장비에 따라 달라집니다. 프로토콜은 또한 정적 어닐링 온도를 사용하여 작동 할 수 있지만 이러한 조건은, 모든 단계에서 어닐링 온도를 변화시킬 수있는 열 순환기에 대해 최적화되었다.

표 2
표 2 :. 우리가 성공적으로 사용한 패널은 비장 TFH, GC B와 유동 세포 계측법에 의해 형질 세포 식별을위한 항체 패널 제시3 일 (왼쪽)와 BM12 세포 주입 (가운데) 후 14 일에서 T 세포와 B 세포의 분석에 이식 효율을 평가. 이 5 레이저 (355, 405, 488, 561, 640 ㎚)와 LSRII에 최적화되어있다. 이 모든 시스템에 대한 최선의 선택되지 않을 수 있지만 각각의 형광 색소 권장 필터 세트, (오른쪽) 표시됩니다. 무엇 레이저, PMT, 및 필터 설정의 조합에 따라 여러 개의 패널로 T와 B 세포의 분석 패널을 분리하는 것이 필요할 수있다 사용할 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

BM12 유도 모델은 SLE의 세포 및 분자 프로세스를 연구하는 비교적 간단하고 효율적인 방법입니다. 자기 항원에 대해 지시 적응 적 전송 CD4 T 세포의 활성화는 만성 여기 기술 된 바와 같이, 유동 세포 계측법에 의해 측정 될 수 TFH, GC B 세포와 플라즈마 세포의 축적에 이르게. 빠르고 쉽게 SLE 환자에서 발생하는 것과 유사하고, 궁극적으로 병리 적자가 항체의 축적을 제어하는​​자가 면역 배 중심 공정에서 후보 유전자 및 신규 치료법의 역할을 할 수 심문이 모델을 이용하여 미래 연구. 또한, 여기에 설명 유세포 분석을 비롯한 면역 글로불린의 추가 개발을 포함 마우스 모델을 연구하는 데 사용하지만,자가 면역, 감염, 및 알레르기에 한정 될 수 없다.

인간의 질병의 모든 동물 모델과 마찬가지로이 모델은 한계가있다. 어떤 질병 (STABLE)와 속도 감안할 때OPS와 그 크기는 SLE의 개발에 관련된 모든 유전자는이 모델에 필요한 병원성 될 가능성이 없다. 데이터가 유전자 변형받는 사람의 TFH의 최소한의 확장을 제안 할 때 또한주의가 이식 거부를 배제하기 위해주의해야한다. Congenic 마커받는 세포는 그렇지 공여 세포의 부재를 마스크 할 수 TFH (도 3B)로 분화 할 수 특히 이후 수확에서 공여 세포의 존재를 확인하는데 사용되어야한다. congenic 마커를 사용하여, 우리는 분명 14 일 (그림 6)에 의해 거부 항원을 숨겨 공여 세포의 완전한 제거를 관찰했다. 우리는 성공적으로 기증자로 CD45.1 + BM12 및 CD45.2 + BM12 마우스를 사용하고, 한 수신자 (그림 같은 CD45.1 + BoyJ (B6.SJL- Ptprc PEPC의 B / BoyJ)와 CD45.2 + C57BL / 6 마우스 3, 6, 7, 미발표 데이타). 그러나, 야생형 congenicB6.PL- Thy1의 / CyJ 마우스 변형에서 CD90.1 + 세포는 분명하지 않은 현상을 잘 접목,도 CD90.1 +받는 사람 (게시되지 않은 데이터)에 이식 잘 CD90.2 + BM12 세포를하지 않는다 이 모델 (26)에 고유.

어느 C57BL / 6 BM12 마우스는 처음 모리스 등에 의해보고 된 기증자 또는받는 사람, 역할을 할 수 있습니다. 9 그러나, 우리의 실험실에서 우리는 B6 마우스에 BM12 세포의 전송이 T 세포와 B 세포의 일관성 확장을 생산 찾아 하루에 14에서 인구는 또한, 다른 그룹에서 기증자와받는 사람 마우스는 성별과 연령 일치해야합니다. BM12 모델의 첫 번째 설명에서보고 된 실험은 남성 → 남성과 여성 → 여성 전송 (9) 사이에 질병 매개 변수에서 유의 한 차이를 발견하지 않지만, 남성 → 여성 전송은 남성 항원 (HY)로, 조언 전송 CD4 T 세포에 의해 표현되지 않습니다 이식 reje을 야기 할 수 있음여성받는 사람 27 ction의.

게이트 전체 CD45.1 + 이식을 구성하지 것이다 - congenic 마커에 대한 항체 및 형광 색소를 선택하면 공여 세포는 CD45.2 것으로, 다양한 각도로받는 사람 congenic 마커에 대한 긍정적이 될 것을 주목해야한다. 현상 명확 CD45.1 + 나이브, CD45.1 + 도너 및 CD45.2받는 CD4 + T 세포 (도 7)에 의해 CD45.2 발현의 비교에 도시되어있다. 특히, 도너 세포는 나이브 컨트롤 (도 7)에 비해, 자신 congenic 마커의 발현을 상향 조절하는 것으로 보인다. 유사한 결과가 또한 CD45.1 + BoyJ 마우스로 CD45.2 + BM12 전송으로 볼 수있다 (데이터는 미도시). 아마도, 활성화 된 CD4 T 세포에 의해 trogocytosis 28받는 사람 CD45 결과의 인수받는 B 세포와의 상호 작용을 반복 다음. 사실, BM12 모드L은 생체 내에서 trogocytosis 과정 연구에 유용한 도구를 증명할 수있다.

그림 7
그림 7. 기증자 세포는 획득받는 사람 CD45 congenic 마커. CD45.1 + BM12 림프구 CD45.2 + C57BL / 6 수신자로 옮겼다. 기증자,받는 사람, 그리고 순진한 (CD45.1의 +) CD4 T 세포 14 일 전송 후 CD45.1와 CD45.2 식에 대한 평가된다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그것은 C57BL / 7 마우스에 정제 BM12 CD4 T 세포의 전달이 병 (29)을 시작하기에 충분한 것으로 밝혀졌다; 그러나 해당하는 질병은 전체 림프구가 전송 될 때 개발, 정제는 반드시 T 가전에 따라 질병 의존성을 연구 할 필요가 없습니다LL-고유 유전자 발현. 아이젠 버그와 동료, 명확하게 BM12 모델의 항체 생산 세포가 거의 독점적으로받는 사람의 기원 (30)는 것을 보여 주었다. 또한, 수신자 CD4 T 세포 10 요건은 우리의 데이타는 그 수신인을 나타낼지라도 T 세포가 참여할 수 상계 외인성 IL-4 (31)의 첨가에 의해 될 수있는 그들의 개발 동안 B 세포의 '양육'에 한한다 다소 배 중심에 응답하여, 그들 중 일부는 TFH 표현형 (그림 3B, 오른쪽 아래)를 개발 할 수있다.

분석을위한 조직을 수확 할 때마다 BM12 실험을 위해 만든해야 하나 중요한 결정이다. 물론 결정 요인이 다를 수 있습니다 본 연구에 중요한 정확히에 따라 달라집니다. 그들은 TFH 세포와 형질 세포의 초기 개발에 초점을 여기에 기술 된 실험은 14 일까지 걸릴; 그러나,이 모델은 이후 만성적 인SLE의 GVHD 모델은 질병은 더 이상 모니터링 할 수 있습니다. 사실, 사구체 신염을 포함한 SLE의 특정 임상 양상, 나중에 개발할 수 있습니다. 단백뇨는 주입 후 10,31 4-8주에서 최고 수준을 빠르면 2와 주에게 포스트 분사를 감지하지만, 도달하고있다. 또한, 유세포 분석은 여기에 설명 된 2 주 지속 실험을 위해 최적화되었다. 우리는이 시점에서 GC의 B 세포와 플라즈마 세포의 상당수를 발견; 추가 시간을 부여하더라도, ANA 분비 혈장 세포의 큰 비율은 골수 (32)에 상주 할 수있다. 또한,이 유동 염색 패널에 의해 식별 형질 세포 가능성도 plasmablasts 인 두 종류의 세포를 구별하기 위해 포함 추가적인 항체가 요구 될 것이다. TFH 확장 아마도 우리가 초점을 맞추었다되는 14 일 윈도우 후 어느 시점에서 피크에 도달한다. 그러나, 우리의 지식에 대한 연구가 이주를 넘어 공여 세포 수 BM12보고되지 않았거나 사용D congenic 마커 적응 적 전송 세포를 추적합니다.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
B6.SJL-Ptprca Pepcb/BoyJ The Jackson Laboratory 001162 CD45.1+ BoyJ mouse strain
B6(C)-H2-Ab1bm12/KhEgJ The Jackson Laboratory 001162 Bm12 mouse strain
FastDigest PsuI Life Technologies FD1554 Restriction digest enzyme for genotyping
1X RBC Lysis Buffer eBioscience 00-4333-57
IMDM GE Healthcare SH30228.01
Plasma Separation Tube (PST) BD 365974 Blood collection tube with Dipotassium EDTA
Serum Separation Tube (SST) BD 365967 Blood collection tube with Clot activator / SST Gel
Ficoll GE Healthcare 17-1440-02  High density cell separation solution
Lympholyte-M Cedarlane CL5030 High density cell separation solution
GL-7-biotin eBioscience 13-5902-82 
Streptavidin-BUV395 BD 564176
CD138-BV421 BioLegend 142508
CD4-BV510 BioLegend 100559
TCRβ-BV605 BD 562840
CD45.1-BV711 BioLegend 110739
CD45.2-FITC BioLegend 109806
PD-1-PE BioLegend 135206
CD19-PerCP BioLegend 115532
Fas-PE-Cy7 BD 557653
CXCR5-APC BioLegend 145506
Fixable Viability Dye ef780 eBioscience 65-0865-18
CD4-BV421 BioLegend 100443
1.2 ml FACS tube inserts, racked USA Scientific 1412-1400
BD Falcon™ Round-Bottom Tubes BD 352017

DOWNLOAD MATERIALS LIST

References

  1. Helmick, C. G., Felson, D. T., et al. Part I. Arthritis Rheum. Estimates of the prevalence of arthritis and other rheumatic conditions in the United States. 58, 15-25 (2008).
  2. Lupus Foundation of America Web Site. Available from: http://www.lupus.org/answers/entry/what-is-lupus (2015).
  3. Somers, E. C., Marder, W., et al. Population-based incidence and prevalence of systemic lupus erythematosus: The Michigan lupus epidemiology and surveillance program. Arthritis and Rheumatol. 66, 369-378 (2014).
  4. Perry, D., Sang, A., Yin, Y., Zheng, Y. -Y., Morel, L. Murine models of systemic lupus erythematosus. J Biomed Biotechnol. 2011, 271694 (2011).
  5. Lindholm, L., Rydberg, L., Strannegård, O. Development of host plasma cells during graft-versus-host reactions in mice. Eur J Immunol. 3, (8), 511-515 (1973).
  6. Fialkow, P. J., Gilchrist, C., Allison, A. C. Autoimmunity in chronic graft-versus-host disease. Clin Exp Immunol. 13, 479-486 (1973).
  7. Streilein, J. W., Stone, M. J., Duncan, W. R. Studies on the Specificity of Autoantibodies Produced in Systemic Graft-vs-Host Disease. J Immunol. 114, (1), 255-260 (1975).
  8. Gleichmann, E., Gleichmann, H. Diseases caused by reactions of T lymphocytes to in compatible structures of the major histocompatibility complex. I. Autoimmune hemolytic anemia. Eur J Immunol. 6, (12), 899 (1976).
  9. Morris, S., Cohen, P. L., Eisenberg, R. Experimental induction of systemic lupus erythematosus by recognition of foreign Ia. Clin Immunol Immunopathol. 57, (2), 263-273 (1990).
  10. Chen, F., Maldonado, M., Madaio, M., Eisenberg, R. The Role of Host (Endogenous) T Cells in Chronic Graft-Versus-Host Autoimmune Disease. J Immunol. 161, (11), 5880-5885 (1998).
  11. Klarquist, J., Hennies, C. M., Lehn, M. A., Reboulet, R. A., Feau, S., Janssen, E. M. STING-Mediated DNA Sensing Promotes Antitumor and Autoimmune Responses to Dying Cells. J Immunol. 193, 6124-6134 (2014).
  12. Petri, M., Orbai, A. -M., et al. Derivation and validation of systemic lupus international collaborating clinics classification criteria for systemic lupus erythematosus. Arthritis Rheum. 64, (8), 2677-2686 (2012).
  13. Zangala, T. Isolation of genomic DNA from mouse tails. J Vis Exp. (6), e246 (2007).
  14. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J Vis Exp. (63), e3998 (2012).
  15. Product information: Thermo Scientific FastDigest PsuI. Thermo Scientific. Available from: https://tools.lifetechnologies.com/content/sfs/manuals/MAN0012567_FastDigest_PsuI_UG.pdf (2012).
  16. Matheu, M. P., Parker, I., Cahalan, M. D. Dissection and 2-photon imaging of peripheral lymph nodes in mice. J Vis Exp. (7), e265 (2007).
  17. Harrell, M. I., Iritani, B. M., Ruddell, A. Lymph node mapping in the mouse. J Immunol Methods. 332, (1-2), 170-174 (2008).
  18. Covelli, V. Chapter 3, Internal examination. Guide to the necroscopy of the mouse. Available from: http://eulep.pdn.cam.ac.uk/Necropsy_of_the_Mouse/index.php?file=Chapter_3.html (2009).
  19. Quah, B. J. C., Parish, C. R. The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation. J Vis Exp. (44), e2259 (2010).
  20. Matheu, M. P., Cahalan, M. D. Isolation of CD4+ T cells from mouse lymph nodes using Miltenyi MACS purification. J Vis Exp. (9), e53319 (2007).
  21. Machholz, E., Mulder, G., Ruiz, C., Corning, B. F., Pritchett-Corning, K. R. Manual Restraint and Common Compound Administration Routes in Mice and Rats. J Vis Exp. (67), e2771 (2012).
  22. Hoff, J. Methods of Blood Collection in the Mouse. Lab Animal. 29, (10), 47-53 (2000).
  23. Cohen, M., Varki, N. M., Jankowski, M. D., Gagneux, P. Using Unfixed, Frozen Tissues to Study Natural Mucin Distribution. J Vis Exp. (67), e3928 (2012).
  24. Cohen, P. L., Maldonado, M. A. Animal models for SLE. Curr Protoc Immunol.. Chapter 15, Unit 15.20 (2003).
  25. Seavey, M. M., Lu, L. D., Stump, K. L. Animal models of systemic lupus erythematosus (SLE) and ex vivo assay design for drug discovery. Curr Protoc Pharmacol. Chapter 5, Unit 5 (2011).
  26. McKenna, K. C., Vicetti Miguel, R. D., Beatty, K. M., Bilonick, R. A. A caveat for T cell transfer studies: generation of cytotoxic anti-Thy1.2 antibodies in Thy1.1 congenic mice given Thy1.2+ tumors or T cells. J Leukoc Biol. 89, (2), 291-300 (2011).
  27. Scott, D. M., Ehrmann, I. E., et al. Identification of a mouse male-specific transplantation antigen H-Y. Nature. 376, 695-698 (1995).
  28. Joly, E., Hudrisier, D. What is trogocytosis and what is its purpose. Nat Immunol. 4, (9), 815 (2003).
  29. Brown, D. R., Calpe, S., et al. Cutting edge: an NK cell-independent role for Slamf4 in controlling humoral autoimmunity. J Immunol. 187, (1), 21-25 (2011).
  30. Morris, S. C., Cheek, R. L., Cohen, P. L., Eisenberg, R. A. Allotype-specific immunoregulation of autoantibody production by host B cells in chronic graft-versus host disease. J Immunol. 144, (3), 916-922 (1990).
  31. Choudhury, A., Cohen, P. L., Eisenberg, R. A. B cells require “nurturing” by CD4 T cells during development in order to respond in chronic graft-versus-host model of systemic lupus erythematosus. Clin Immunol. 136, (1), 105-115 (2010).
  32. Slifka, M. K., Antia, R., Whitmire, J. K., Ahmed, R. Humoral immunity due to long-lived plasma cells. Immunity. 8, (3), 363-372 (1998).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics