C57BL / 6 FARELERDE SLE bm12 İndüklenebilir Modeli (SLE)

JoVE Journal
Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Klarquist, J., Janssen, E. M. The bm12 Inducible Model of Systemic Lupus Erythematosus (SLE) in C57BL/6 Mice. J. Vis. Exp. (105), e53319, doi:10.3791/53319 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Sistemik lupus erythematosus (SLE), anti-nükleer antikor (ANA) üretim ve glomerulonefrit prototip, özelliği kompleks otoimmün bir hastalıktır. Çok sayıda diğer deri dahil olmak üzere, sekeller, kardiyo-pulmoner ve hepatik lezyon bazı kişilerde hastalığı ile ilişkilidir. ABD'de yaygınlık tahminleri kadınların ve azınlıkların 3 özellikle yüksek insidans ile, 150,000-1,500,000 1,2 dan, büyük ölçüde değişmektedir. SLE etyolojisi ayırt etmek zor olsa da, sistemik otoimmünite sonuçlanan çeşitli genetik ve çevresel faktörlerin etkileşimi kaynaklandığı düşünülmektedir.

Çeşitli hayvan modelleri hastalığın başlangıcı ve ilerlemesinde yol açan faktörleri incelemek için istihdam edilmiştir. SLE Klasik fare modelleri p gibi NZW F1 modeli ve NZM türevleri, MLR / lpr zorlanma ve BXSB / Yaa zorlanma ve indüklenebilir sistemleri NZB x dahil genetik yatkın fare suşları arasında,ristane ve kronik Graft Versus Host Hastalığı (GVHH) 'nın modelleri 4. GVHD modellerinde otoantikor üretiminin ilk raporlar F1 transferleri 5 içine ebeveyn için çeşitli fare suşları veya hamster suşu kullanılmıştır - 8; lupus benzeri hastalığı incelemek için kullanılan daha yaygın yöntemler şu DBA / 2 üst → (C57BL / 6 x DBA / 2) F1 ve burada açıklanan bm12 transferi modeli bulunmaktadır. Her model kendi uyarılar vardır, ama bunlar genellikle insan hastalığın klinik özellikleri ile ilişkili özellikler ortak bir dizi paylaşır. Fare modellerinde en sık bildirilen parametreler, splenomegali lenfadenopati, nefrit, ANA üretimini içerir ve hücresel düzeyde, T foliküler yardımcı hücrelerin (TFH), germinal merkez (GC) B hücreleri ve plazma hücrelerinin genişlemesi.

- H2 - Ab 1 bm12 / KhEgJ (bm12) fareler, bir gerilme i uyanlabilir bm12 modeli IA bm12 B6 (C) lenfositlerin adoptif nakli ile elde edilirMHC sınıf II üzerinde 3 amino asit ikameleri haricinde C57BL / 6'ya Dentical, IA içine C57BL / 6 (B6) fareler, b. Alıcı APCler tarafından verici CD4 T hücrelerinin Alloactivation belirtileri yakın SLE benzeyen GVHH yol açar. Spesifik olarak, bu verici türetilmiş TFH genişlemesi, alıcının türetilmiş GC B hücreleri ve plazma hücrelerinin genişlemesini ve anti-dsDNA, anti-ssDNA, anti-kromatin ve anti-RBC antikorlar da dahil olmak üzere 9 Anas üretimini içerir. Zamanla, alıcı fareler glomerüler, interstisyel IgG mevduat ve böbrekler 10 damar bölgeleri ile ilişkili glomerülonefrit gelişebilir. Son zamanlarda insan hastalığına benzer, bu modelde 11 IFN tipi için kritik bir rol da vardır, göstermiştir. Özellikle, insan SLE ​​için belirleyici kriter, anti-dsDNA varlığında SLE uyumlu nefritin gelişmesini, bu fare modelinde belirgin özellikleri olan, her ikisi de 12 antikorları içerir.

Var sespontan modeller üzerinde bm12 modelinin veral avantajları. Kendiliğinden SLE benzeri belirtiler geliştirmek Classic modelleri nakavt ya da başka genetiği değiştirilmiş fareler zor ve zaman alıcı kapısı yapmak melez fare suşları değil, B6 zemin üzerine B6 arka plan, ya da büyük genetik lokusların üzerinde kendilenmiş fare suşlarının ya güvenmek. Bm12 uyarılabilir model, genetik olarak tadil edilmiş farenin özel genler hastalık için önemli olabilir hücresel bölmesinin daha hızlı biçimde teşhisine izin veren, donör veya alıcı olarak görev yapabilir. Ayrıca, bm12 modelinde hastalık gelişimi en spontan modelleri için birkaç ay ile karşılaştırıldığında, Anas görünümünü kadar sadece 2 hafta gerektiren, çok daha hızlıdır. Ayrıca, farklı zaman noktalarında hastalığı geliştirmek kendiliğinden model aksine, bm12 → B6 modelde hastalığın başlangıcı ve işleyişi yüksek senkronize edilir. Bu olabilir b uygun boyutta kohortların üretimi sağlare hastalık gelişiminin her aşamasında girişimsel ya da terapötik stratejiler için kullanılır.

Aşağıda B6 arka plan üzerinde, C57BL / 6 farelerine bm12 lenfositler adoptif nakli, ya da genetik türevleri tarafından SLE-benzeri otoimmünite başlatılması için ayrıntılı bir protokoldür. Buna ek olarak, TFH GC B hücreleri numaralandırma için bir akış sitometri boyama protokolü tarif eder ve plazma hücrelerinin hücre türleri, insan hastalığı ile ilişkilidir. Daha da önemlisi, bu protokoller SLE Birçok fare modellerinde hastalığa karakterize ve diğer hastalık modellerinde TFH GC B hücreleri ve plazma hücreleri tanımlamak için kullanılabilir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Hayvan çalışmaları değerlendirme ve laboratuvar Animal Care International Akreditasyon ve Kurumsal Hayvan Bakımı ve Kullanımı Komitesi Derneği (IACUC) tarafından belirlenen esaslara uygun olarak spesifik patojen içermeyen koşullar altında gerçekleştirildi.

NOT: Bu tür vericiden veya alıcı hayvanlar mümkünse birinin üzerine CD45.1 gibi konjenik işaretleyici ifade birleştirin fareler, bu donör greft verimliliği ve donör CD4 T hücre popülasyonunun spesifik genişleme izlenmesi için izin verir, çünkü. Donör veya alıcı olarak aksi genetiği değiştirilmiş farelerin kullanılması göz önünde olursa, gerilme düzgün B6 arka plana backcrossed edilir veya transfer hücreleri reddedilmez-bu olabilir temsilcisi sonuçları ve tartışma bölümlerinde daha ayrıntılı olarak ele alınacaktır emin olun.

NOT: 12-16 fareler enjekte için yeterli hücreleri vermelidir farelerin bm12 hasat 4 donör için aşağıdaki prosedürleri ayrıntı hacimleri. Altıoniki haftalık bm12 farelere yaklaşık% 25 CD4 T hücreleri ile kabaca 100-140.000.000 lenfositleri verim. Yukarı veya aşağı buna göre farelerin farklı sayılar veya farklı fare türüne, ölçek hacmi ile başlayarak edin. C57BL / 6 fareleri, genel olarak sadece% 20 CD4 T hücrelerine daha yakın benzer verimler verir.

NOT: oda sıcaklığında tüm adımları uygulayın ve uzun vadeli lenfosit canlılığı bozabilir ısı ve soğuk şoku önlemek için RT ortam kullanın. Doku hasat ve aseptik teknik kullanılarak bir doku kültürü kaputu doku işleme adımları uygulayın. Bu protokol tüm medya ile IMDM ise% 10 ısı ile inaktive aksi belirtilmediği sürece, FBS ve basitçe anılacaktır "eksiksiz bir medya."

1. Yeni Bir Yöntem genotipleme bm12 fareler için

NOT: genotipleme için kısa bir kısıtlama sindirmek tabanlı protokol şu anda sadece yayınlanmış genotipleme yöntemidir sıralamaya basit ve ucuz bir alternatif olarak, burada sağlananBu fareler için.

  1. Fare kuyrukları genomik DNA izole. Fare kuyruğu kupürü hakkında ayrıntılı protokoller için bir önceki vallahi makale ve kuyruk cDNA nesil bakınız 13 sindirir.
  2. Tablo 1 'de listelenen primerler ve ısı döngüsü koşulları kullanılarak bm12 MHC-II IA b ve IA ortak 474 bp'lik bir DNA fragmanını çoğaltmak için bir ters transkriptaz polimerize zincir reaksiyonu (PCR) 14 gerçekleştirin.
  3. Sınır enzimi PsuI veya vahşi tip IA b keser onun isoschizomers (BstX2I, BstYI, MflI veya XhoII) birini, ancak IA bm12 mutant kullanılarak PCR ürünü ~ 7 ul ile sindirmek gerçekleştirin. Su karışımı belirtmek tampon ve enzim olacak üreticiler, ve 5 dakikalık bir inkübasyon ile sağlanan protokol sindirimi takip edin. 37 ° C'de 15 ile birkaç saat.
  4. Yük ürün sindirimi ve 30-45 dakika boyunca, etidyum bromür 14 ile birlikte% 1 poliakrilamid jel üzerinde yapılmıştır. 1 de50V-gerçi optimum voltaj ve saat ayarları kullanılan PCR jel aparat bağlı olarak değişecektir. UV ışığı ile DNA bantları gözünüzde canlandırın. Örnek sonuçlar Şekil 1 'de gösterilmiştir.

figür 1
Genotipleme sonuçları bm12 Şekil 1. Temsilcisi.
IA bm12 / bm12 olmayan homozigoz farelerde, belirlemek için, kuyruk DNA'sının PCR ile bm12 için taranmıştır / kısıtlama genotipleme (Adım 1) sindiremez. Homozigot vahşi tip (IA b / b) DNA, 227 iki bant ve (~ 250 bp az bir kalın bant olarak görüntülendi) 247 bp verir; homozigot bm12 (IA bm12 / bm12) DNA ürünleri 474 bp bir bant; ve heterozigot (IA bm12 / b), DNA ~ 250 ve 474 bp iki bant verir. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

2. Hasat DonörHücreler

  1. Kurumsal Hayvan Bakım ve Kullanım Komitesi (IACUC) kullanarak Kurban donör fareler birincil ve ikincil ötenazi yöntemleri -onaylı. Örneğin, sonra servikal dislokasyon yapılmıştır CO2 ile havasız bırakılarak fareler euthanize.
  2. 11-13 gibi 10 ml tam medya içeren 15 ml tüpler içine aseptik teknik, hasat dalak ve lenf nodları (yüzeysel servikal, mandibular, brakial, aksiller, mezenter ve inguinal) kullanma.
    NOT: Ayrıntılı lenf nodu diseksiyonu protokolleri 16 önceki raporlarda bakın - 18. Bu model transferi için yalnızca fare splenositlerin kullanarak da başarılı olur, ancak lenf nodu eklenmesi önemli ölçüde donör farelerin gerekli sayısını azaltır.
  3. Bir şırınga pistonu kullanarak 70 mikron hücre süzgeçler ile adım 2.2 toplanan lenfoid dokuların ezme tek bir hücre süspansiyonu oluşturun. Her 4 için daha iyi verim için, aşırı yüklemeyin süzgeçler kullanımı ~ 6 süzgeçlerfareler işlenir ve işleme sık iken pislik tutucu durulayın. 400 x g'de 5 dakika boyunca, daha sonra iki 50 ml konik tüp içine 4 fareden gelen santrifüj hücre dokuları birleştirin ve süpernatant süzün.
  4. 50 ml tam medya ve yeni konik tüp transferi hem konik tüpler gelen süspanse hücreleri. Oda sıcaklığında bu tüp tutun.
    NOT: Yağ tüp yüzüne yapışır ve tüp yerini değilse, nihai hücresel verimleri düşebilir.

3. Donör Hücre Sayım

NOT: Numunenin tamamının en canlılık, kırmızı kan hücresi (RBC) liziz korumak için tavsiye edilmez.

  1. Iyi adım 2.4 tek bir hücre süspansiyonu karıştırın 1 ml çıkarın ve ayrı bir 50 ml'lik konik aktarın. Sayarken kenara oda sıcaklığında, el değmemiş hücreler (49 ml) Kalan ayarlayın.
  2. 1 ml verici hücre örneği bir amonyum klorür-esaslı alyuvar lisiz tamponu 3 ml ekleyin. 1 dakika boyunca yavaşça karıştırın. Sallanan, daha sonra tam ortam, bir 50 ml doldurmaknd 5 dakika santrifüj. 400 xg ve decant süpernatant de.
  3. Süspanse (Hemasitometre kullanarak tripan mavisi ile, örneğin,) 10 ml tam medya ve sayım hücre RBC-lize. Ile çarpın sonucu 49-Bu kenara non-lize bir numune içinde Kalan hücrelerin toplam sayısıdır. Sil hücreleri RBC-lize edildi.

Ve / veya CD4 T hücre Arıtma 4. Donör Hücre Etiketleme

  1. Eğer arzu edilirse, bu gerekli olmasa da, bu aşamada, CD4 T hücrelerinin saflaştırılması. 19 deki gibi CFSE ile etiket hücreleri, ya da diğer hücre izleme boyalar, arzu edildiği takdirde ayrıca, bir örneği temsil edici sonuçları bölümünün Şekil 4 'de gösterilmiştir.
    NOT: Bu yüksek saflıkta elde etmek ve 20 de tarif edildiği gibi, yüksek yaşama kabiliyetiyle, el değmemiş hücrelerinin yaprakları gibi bir CD4 T hücresi Saflaştırma için, negatif manyetik seçim önerilir. Bu endotoksin içermeyen tamponlar kullanılması önemlidir; Bu nedenle, bunun yerine BSA ayırma tamponu wit yapmakh% 2 FBS ve EDTA tavsiye edilen konsantrasyondur.

Donör bm12 Hücreleri 5. Enjeksiyon

  1. 400 x g'de 5 dakika boyunca aşama 3 (ve saflaştırılmış ya da arzu edildiği gibi, Aşama 4'te olduğu gibi etiketlenmiştir), santrifüj hücreleri donör lenfositlerinin sayılmasından sonra. Ml başına 120 milyon lenfositleri (ya da ml başına 30 milyon saflaştırılmış CD4 T hücrelerinin) PBS içinde supernatant ve tekrar süspansiyon hücreleri süzün. Steril, 5 ml kolayca 27,5 G x 13 mm iğne ile donatılmış 1 ml şırınga kapasiteli yuvarlak tabanlı bir tüp ya da başka steril tüp hücreleri aktarın.
  2. Donör örnekleri içinde, CD4 T hücrelerinin yüzdesini belirlemek için akış boyama 4 ° C'de kenara aşama 5,1 donör hücrelerin küçük bir model olan, enjeksiyon öncesinde. Olan en az antikor paneli (Tablo 2) kullanılarak Aşama 8'de tarif edildiği gibi, bu örnekler Leke.
    Not: farklı fare türüne alınan hücreler, ayrı verici olarak kullanılır, bu önemli bir husustur, ve CD4 T hücre yüzdesi büyük oranda, pur farklılık varsaUS-PS gerekli olabilir.
  3. Yavaşça, ama iyice hücreleri karıştırın. Bu kadar hücrelerin pipetleme tarafından ve ekli iğne olmadan 1 ml şırınga kullanarak aşağı yapılabilir. Karıştırma sonrası, 1 ml şırınganın içine hücreleri çizin. Hava kabarcıklarını çıkardıktan sonra iğne takın. Şırınga emişli sırasında kapalı tutulması iğne hücre canlılığı korumaya yardımcı olur.
  4. 21 de tarif edildiği gibi, intraperitonal (30000000 lenfosit veya fare başına 7.500.000 saflaştırılmış CD4 T hücrelerinin eşit) fare başına 250 ul enjekte edilir.
    Not: Burada gösterilen deneylerde ve önceki çalışma 11'de, her bir fare yerine, geleneksel olarak kullanılan 100,000,000 toplam splenositler daha bm12 vericilerden 30000000, toplam lemfositler enjekte edilir. Laboratuarımızda yayınlanmamış veriler, herhangi bir fark fare başına 30 ya da 100,000,000 lenfosit enjeksiyondan sonraki 14. günde serum anti-dsDNA'nın gözlenmiştir. Bu önemli ölçüde deneyler için gerekli olan farelerin sayısı, nefrit wit gelişimini azaltırkenh hücreleri bu sayı değerlendirilmemiştir.

6. Verimlilik Aşılama belirleyin

NOT 1: Bu bölümde optimal enjeksiyonları almış olabilirsiniz herhangi bir fare (örneğin, bir fare greft görülen bunun <% 10 belirlemek için 3. günde alıcı verici hücre aşılama derecesini belirlemek için nasıl anlatacağız Aynı gruptaki diğer tüm fareler). Bu veriler aynı zamanda genetik olarak değiştirilmiş fare suşundan hücreleri (detaylar için temsili sonuçlar bölümüne bakınız Şekil 6), daha sonra zaman noktalarında reddedilen olup olmadığını belirlemenize yardımcı olabilir.

NOT 2: Bu bölüm CD45.1 bm12 donörler ve CD45.2 C57BL / 6 alıcıları kullanırken bağışçılar ve alıcıların farklı konjenik geçmişlere, örneğin, üzerinde farelerden ise mümkündür, ya da donör hücreleri hücre izleme boya ile etiketlenmiş zaman. Önemlisi, 3 gün sonrası enjeksiyon de, CD4 T hücreleri minimal genişleme uğramıştır (seaşılama derecesi gözlenen farklılıklar enjeksiyonlar değişkenlik genişleme nedeniyle değildir bu yüzden e temsili sonuçlar bölümünde, Şekil 4).

  1. % 4 izofluran veya diğer IACUC onaylı yöntemle fareler anestezi. Düzgün kan beraberlik geçmeden önce anestezi fare sağlamak için arka ayak refleksleri test edin.
  2. Örneğin 22 gibi, retro orbital damar ağını delmek olarak, IACUC onaylı bir yöntem kullanarak Hasat 100-200 ul kanı. Örneğin liyofilize dipotasyum EDTA içeren malzeme tabloda başvurulan plazma toplama tüpleri, gibi bir anti-pıhtılaştırıcı madde ihtiva eden ayrı ayrı 0,5 ml mikrosantrifüj tüpleri içine kan toplamak. Kan alımından sonra, nihai doku hasat (Adım 7) kadar kalacak yere geri evde kafes içinde fare daha sonra, kanama durur sağlamak yerleştirmek için steril bir havlu veya gazlı bez kullanarak fare göz hafifçe basınç uygulayın.
    NOT: Fareler yeterli bilince kavuştular gözetimsiz kadar fareler bırakmayınventral yatma korumak ve tamamen iyileşti kadar başkalarının şirkete fareler dönmez.
  3. (Daha sonra yavaşça iki faz arasında karıştırılması en aza indirmek için dikkatli olmak, 200 ul pipet ile 21 ° C yüksek yoğunluklu hücre ayrıştırma çözeltisi 200 ul altında yatan, 21 ° C PBS ile 500 ul kan hacmi getirmek ve konik alt mikrosantrifüj tüpüne transfer ) önerilen çözümler için malzemeler Tablo bkz. Düşüğe ayarlanmış santrifüj fren 20-25 ° C de 20 dakika boyunca 700 x g'de santrifüjleyin hücreleri.
  4. 800 mL soğuk tam ortam içeren yeni bir mikrosantrifüj tüpüne 1 ml pipet ve transfer ile lenfositlerin içeren üst tabakayı çıkarın. Yavaşça hücreleri karıştırmak için vorteks. 5, 4 ° C'de dakikada ve dökme sıvı supernatant 700 x g'de santrifüjleyin hücreleri.
  5. 200 ul içinde süspanse hücreleri t belirlemek için olan en az antikor paneli (Tablo 2) kullanılarak Aşama 8'de tarif sitometrisi olarak akış için tam bir ortam, 96 oyuklu U tabanlı plakaya transfer ve lekeO PBMC yüzdesi olarak CD4 T hücre greft göreli bolluk.

7. Final Doku Hasat

NOT: Bu sonuçlar bölümünde tarif edilen deneyler 14 gün donör hücrelerin enjeksiyonundan sonra hasat edilmiştir (ya da bazı durumlarda daha az zaman olarak), bu TFH hücreleri ve plazma hücrelerinin ilk geliştirilmesi de gibidir; Bu model, SLE kronik GVHD modeli olduğu, ancak, hastalık daha sonraki zaman noktalarında izlenebilir. Optimum zaman aralığı her deneyde yöneltilen araştırma sorusuna bağlıdır.

  1. Bm12 donör hücreleri (aşama 5,4) enjeksiyonundan sonra önceden tespit edilmiş bir zaman noktasında, ötenazi, IACUC onaylı yöntem kullanılarak fareler kurban. Kansız bırakılarak ardından CO2 ile boğma tavsiye edilir. Servikal dislokasyon ötenazi ikincil yöntem olarak işlev görebilir, fakat bu kan beraberlik verimini düşürebilir.
  2. Hafifçe% 70 içeren bir sprey şişesi ile fare karın Islaketanol. Yaklaşık 1 cm genital üzerinde cerrahi makas ile küçük, yüzeysel kesi olun. Sağlam periton fasya tutmak için dikkatli olmak, sternum doğru karın derisinin geriye çekilmesi.
    Not: henüz iyi karakterize edilmemiş olmasına rağmen, ölçülmüş ve ilave bir hastalık parametresi olarak analiz edilebilir 14. günde 0.5-3 mi asit, genellikle, bu hastalıklı farelerin.
  3. 18 G iğne ile 5 ml şırınga takın. Hayvanın kafasına doğru ve fasya düzlemine 15 ° açıda yukarıya yönelik iğne ile karın sağ alt kadranda içine iğne takın. Assitler aspire ederken bağırsak ile tıkanmış iğne önlemeye yardımcı olmak için çekum yakın iğne ucu yerleştirin.
  4. Dikkatle sonra yavaşça enjektöre assitler çizin yan fare döndürün. Asit elde edildikten sonra, şırınga çıkarın ve syri tarafında hacimsel işaretlere bağlı olarak aspirat hacmi, kayıtnge.
  5. Daha sonra işlenmek için buz üzerinde 5 ml'lik yuvarlak dipli bir tüp ve deposuna Deşarj asit.
  6. Esasen 22 olarak inferior vena kava (IVC) dan beraberlik yoluyla Hasat kan. Donuk forseps kullanarak, yavaşça IVC ortaya çıkarılması, farenin sol tarafına bağırsakları hareket ettirin. IVC içine 1 ml şırınga takılan bir 27.5 G iğne takın ve yavaş yavaş kan 400-500 ul çizin.
  7. Hemoliz en aza indirmek için, yavaş yavaş 0.5 ml mikrosantrifüj serum veya plazma toplama tüpüne kan enjekte. ELISA ile Anas sonra serum analizi için buz üzerinde kan tutmak.
  8. (Istenen lenf nodları ve böbrekler, özellikle daha sonraki zaman noktalarında ve glomerülonefrit de toplama atılır eğer, dalak ve) incelemek ve alakalı ek dokular edinin. Yavaşça bağırsak geri hayvanın sağ tarafına doğru yerleştirerek ve dalak birincil bağ dokusu olan pankreas, dalak çekerek çıkartın.
  9. Kalan pankreas çıkarın, sonra tartmakBrüt splenomegali SLE fare modellerinde yaygın bildirilen parametre olarak, hemen diseksiyonu sonrası yüksek hassasiyetli dengesi üzerinde dalak. Buz üzerinde 1 ml tam ortam ile doldurulmuş ayrı ayrı 1,5 ml tüpler içinde lenf dokuları yerleştirin. % 10 nötral tamponlu formalin böbrekleri Fix veya 23 gibi daha sonraki histoloji için böbrekleri dondurmak oturtun.
  10. 3 dakika boyunca toplama 2 saat içinde Santrifüj kan. 10,000 x g'de (4 ° C). ELISA ile ANA sonra analiz için -80 ° C'de serum ve mağaza çıkarın. Detaylı ANA ELISA protokolleri 24,25 önceki raporlara bakın. Birden çok 10-20 ul alikotları saklayın serum donma / çözülme devrelerine en aza indirmek ve gelecekteki deneyler daha fazla sayıda izin vermek.
  11. Santrifüj 5 dakika boyunca 400 xg Asitli. 0.5 ml birkaç tüpleri içine 1 ml pipet ve kısım ile süpernatantı. Antinükleer antikorlar (Anas) ya da diğer çözünebilir enflamatuar aracıların daha sonraki analizler için -80 ° C'de süpernatan dondurun.
  12. Süspanse hücresel kuruş Yaklaşık 1 ml tamamlanmış ortam iyon ve (Kademe 8'deki gibi) akış boyama için 96 oyuklu U tabanlı plakaya 200 ul aktarma.
  13. Ayrı tüpler içine 70 mikron hücre süzgeçler sayesinde her dalak ezin ve eksiksiz bir medya ile durulayın. 1 dakika boyunca 1 ml soğuk eritrosit lizis tamponu ile splenositlerin yeniden süspanse edin. ve sallanan hafifçe karıştırın. 400 x g'de 5 dakika boyunca soğuk tam ortam ve santrifüj ile 10 ml hacim getirin ve süpernatant süzün.
  14. 5 ml tekrar süspansiyon hücre pelet tam medya ve hemasitometre kullanarak saymak. Eksiksiz bir medya 200 ul 1-3 milyon hücre içerecek şekilde ses seviyesini ayarlayın. Donör CD4 T hücre ve alıcı B hücresi farklılaşması ve genişleme ölçmek için uzun bir paneli (Tablo 2) kullanılarak akış sitometrisi (Aşama 8) için boyama başlayın.
    NOT: Ne lazer bağlı olarak, photomultiplier tüp (PMT) ve filtre seti kombinasyonları birden paneller içerisine T ve B hücre analizi paneli ayıran gerekli olabilir, vardır.
ve_title "> 8. Akış Boyama

  1. Aktarım, ya da 96 oyuklu U tabanlı plakanın ayrı oyuklarına yuvarlak tabanlı tüp bağımsız 5 ml 200 ul komple ortam içinde 1-3.000.000 splenositler.
    NOT: 96-plaka kullanarak birden fazla numune leke, ancak çapraz bulaşmayı önlemek için her kuyuda örnekleri plaka dikkat çekmek için etkili bir yoldur. Bir 96-yuvalı plaka 24 örnekleri uygun şekilde tutabilir.
  2. 3 dakika boyunca 500 xg'de Santrifüj plaka., Uygun (biohazard) kabın içine plakadan sonra fiske süpernatant.
  3. İmalatçının tavsiye ettiği konsantrasyon ve 1 ug / ml'de anti-CD16 / anti-CD32 antikor kokteyli, saflaştırılmış bir tamir edilebilir canlılığı boya ihtiva eden (PBS içinde% 1 FBS) akışı, tampon 100 ul hücre pelletleri yeniden süspanse edin. Daha sonra canlılığı boya söndürmek için 100 ul soğuk tam ortam eklemek, 20-25 ° C'de 10 dakika süreyle inkübe edilir.
    NOT: hastalıklı farelerin splenositler genellikle ölü veya ölmekte hücrelerin nispeten yüksek sayı içeren;Bu nedenle, bir canlılığı, boyanın dahil, ölen hücrelerden daha temiz, daha güvenilir veri elde spesifik olmayan antikor etiketleme önlemek için önerilir. Benzer şekilde, anti-CD16 / anti-CD32 kokteyli Fc reseptörlerinin spesifik olmayan bağlanma floresan etiketli antikor engellemek için dahil edilir.
  4. 3 dakika boyunca 500 xg'de Santrifüj plaka., Biohazard kabına plakadan sonra fiske süpernatant. 200 ul akış tamponu içinde süspanse hücreleri. 3 dakika boyunca 500 xg'de Santrifüj plaka., Biohazard kabına plakadan sonra fiske süpernatant.
  5. 50 ul akış tamponu ihtiva eden antikor kokteyli içinde süspanse hücreleri (Tablo 2). 4 ° C'de 20 dakika boyunca inkübe, daha sonra 150 ul akış tamponu ilave edin. Tekrarlayın yıkama adımı 8.4.
  6. PBS içinde 100 | il% 2 paraformaldehid ile yeniden süspanse hücreleri. 4 ° C'de 30 dakika boyunca inkübe, daha sonra 100 ul akış tamponu ilave edin. 3 dakika boyunca 500 xg'de Santrifüj plaka., Biohazard kabına plakadan sonra fiske süpernatant.
  7. Resuspend 200 ul akış tamponu içinde, boru parçaları veya standart akış tüpleri akışı akış sitometresinde elde kadar karanlıkta 4 ° C'de ilave 100-200 ul akış tamponu ve mağaza eklemek için aktarın.
  8. Sitometresi boyanma birkaç gün içinde seçilen antikor panelleri için uygun lazerler ve Proje Yönetim Ekipleri ile donatılmış bir akış edinin. Ayrıca rekor ileri dağılım genişliği ve / veya yükseklik dağılım alanı, yan dağılım alanı ve kullanılan floresan parametrelerin alanını iletmek. Güvenilir sonuçlar için, ≥1,000 verici her WT numune hücreleri, ya da çok olayların toplanması mümkün olmayabilir donör hücreleri, minimal genişleme gösteren genetiği değiştirilmiş veya başka manipüle farelerde toplam lenfosit eşdeğer sayıda kazanır.
    Not: analizler (- 6 Şekil 3) temsilci sonuçlar bölümünde ayrıntılı olarak tarif edilmiştir akım sitometrisi.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Hastalıklı farelerin kütle ve hücreselliği (Şekil 2) olarak dalak 2-3 kez, sağlıklı farelerin büyüklüğü sergileyen az 14 gün gibi splenomegali gelişir.

Splenositler sırayla ışık dağılım (SSC-A tarafından FSC-A) kapılı, çift (FSC-A tarafından FSC-W veya H), canlı hücreleri (canlılık boya düşük boyama), ve CD4 + TCRβ + (Şekil ortadan kaldırılması Şekil 3A). Donör hücreleri CD45.1 ve CD45.2 (Şekil 3B, sol alt) göre, alıcı hücrelerden ayrılır. PD-1, CXCR5, Bcl-6 ve ICOS (Şekil 3B, C) ​​regülasyonu ile karakterize edilen donör hücreler ağırlıklı olarak bir T yardımcı foliküler (TFH) hücre fenotipi kabul eder. Alıcı CD4 T hücre popülasyonunun bir kısmı da TFH (Şekil 3B, sağ alt) içine ayırır. Aktarılan hücrelerin bir başlangıç ​​kalıp-off ve / veya göç sonrası, donör kaynaklı TFH genişleme logaritmik, rfarelerin dalaklarında 10-20.000.000 hücreleri eaching 14 gün enjeksiyonu (Şekil 3B) daha sonra.

Devredilen lenfositlerin KAKE etiketleme CD4 T hücreleri erken aktivasyon sonrasında TFH içine ayırt o donör gösterdi; esasen tamamının bölünmüş hücreler 3, 7 görülür ve 14 CXCR5 PD-1 (Şekil 4) yukarı regüle. Proliferasyon pik profilleri ayrıca donör CD4 T hücrelerinin, nispeten düşük bir yüzdesi alloactivation ve bölme uygulandı göstermektedir. 14. günde, tespit donör hücrelerin en CFSE ile ölçülebilen bölümleri maksimum sayısının ötesinde bölünmüş olanlardır.

Donör kaynaklı TFH genişlemesi endojen GC B hücreleri ve plazma hücrelerinin (Şekil 5A) karşılık gelen bir birikimi eşlik eder. Dalakta Plazma hücre akümülasyonu gün 3 veya 7 (Şekil 5B) ile saf hayvanlar üzerinde herhangi bir artış sergileyen, TFH kıyasla geciktirilir. Accordingly, antinükleer antikorlar öncesi gün 9 (veriler gösterilmemiştir) kolaylıkla tespit edilebilir değildir, ancak güvenilir 14. günde 11 ile sayısal olarak tespit edilebilir.

Konjenik markerlerin kullanımı sayesinde, bir çok türüne verici hücreler reddedilmesine gözlemledik. Bu, farelerin yeterli C57BL / 6 arka backcrossed olmayan yaygın bir sorun olmakla birlikte bm12 hücreler genellikle tam olarak kabul edilir B6.PL- Thy1 a / ​​CyJ (CD90.1) farelere aktarıldı zaman da ret gözlenen backcrossed. Bu nedenle, fareler rutin başlangıç ​​CD4 T hücresi greft etkinliğini değerlendirmek için akış boyama kan örnekleri gün ~ 3 taranmaktadır; Biz Hücreler bu erken zaman noktasında çok az genişlettik aşılı KAKE çoğalması deneylerden biliyoruz. Bu sonuçlar, günde 14 hasat elde edilen sonuçlar ile karşılaştırıldığında daha sonra. Reddinin bir örnek durumda, 30000000 CD45.1 + bm12 lenfositler Cardif aktarılmıştır - / - 12 kuşaktır C57BL / 6 farelerine geri çaprazlanmıştır edilmiş fareler. Gün 5 'de, tüm farelerin eşdeğer greftleme (CD4 + T hücreleri, dolaşımdaki 2-3%) görülmektedir, ancak günde 14 ile bm12 donör hücrelerin tamamen genetik olarak tadil edilmiş bir alıcıya (Şekil 6) için elimine edilmiştir.

Şekil 2,
Şekil 2. Dalak büyüme kinetiği bm12 lenfositlerin enjeksiyonundan sonra. Dalaklar doğrudan eksizyon (solda) sonra yüksek hassasiyetli dengesi üzerinde tartıldı. Canlı hücre sayısı (sağ) ölü hücreleri hariç tripan mavisi kullanarak hemositometre ile sayılarak belirlenmiştir. Sonuçlar SEM, ortalama ± olarak tasvir edilmektedir burada n = 9, 4, 3, 6, sırasıyla. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

jpg "/>
SLE. CD45.1 + bm12 lenfosit bm12 modelinde T foliküler yardımcı hücre genleşme Şekil 3. Analiz C57BL / 6 alıcı içine aktarıldı ve dalakları 14 gün sonra analiz edildi. (A) "lenfositleri" (ilk panel), "tek hücreler" (ikinci panel), "canlı hücreleri" (üçüncü paneli), ve "CD4 T hücreleri" (dördüncü panel) gösteren Temsilcisi yolluk stratejisi. (B) Donör hücreleri CD45.1 ve CD45.2 boyama ile alıcı CD4 T hücreleri ayırt ve PB-1 ve CXCR5 ekspresyonu için analiz edilir. Yaygın TFH ile ilişkili çeşitli proteinlerin regülasyonu ile gösterildiği gibi (C) Donör hücreleri, TFH fenotip kabul eder. (D) gün 3, 7 de ve 14 sonrası transferi (CD4 + CD45.1 + PD-1 + CXCR5 + canlı hücreler olarak tanımlanır) verici kaynaklı TFH genişleme gösteren tipik sonuçlar. Sonuçlar tasvir edilmektedir as ± SEM, ortalama n = 5, 4, 3, 6, sırasıyla. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 4,
Şekil 4. PD-1 ve CXCR5 bölünen hücreler üzerinde yukarı regüle edilmiştir. Hücreler, steril Bm12 C57BL / 6 alıcı enjekte edilmeden CFSE ile etiketlenmiştir. Temsili akış araziler 3, 7 donör CD4 T hücreleri için gösterilen ve 14 gün enjeksiyonundan sonra. Olan bu rakamın büyük halini görmek için buraya tıklayınız.

Şekil 5,
Şekil 5. dalak plazma hücreleri ve GC B hücrelerinin Genişleme. (A) naif fare dalak Temsilcisi akış araziler, ya gelenler14 gün CD45.1 + bm12 transfer edildikten sonra fareler. Plazma hücreleri CD138 + CD19, düşük canlı hücreler (üst panel) gibi tanımlanmıştır. GC B hücreleri GL-7 ve Fas (alt paneller) ifade CD19 + B hücreleri, bir alt kümesidir. (B) Niceliksel veriler zaman içinde dalak plazma hücrelerinin birikimi gösteren. Sonuçlar SEM, ortalama ± olarak tasvir edildiği n = 5, 4, 3, 6, sırasıyla. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 6,
Şekil 6. Bm12 greftler bazı genetik olarak değiştirilmiş farelerin alıcı tarafından reddedilir. CD45.1 + bm12 lenfositler, genetiği değiştirilmiş farelerde (üst paneller) veya C57BL / 6 (alt paneller) alıcı farelere ya aktarıldı. Fareler 5 gün sonrası enjeksiyon de kan ve greft verimliliği açısından değerlendirildi. SplenositAynı farelerden alınan s 14 gün sonra analiz edilmiştir. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Primer adı Sıra (5 '- 3'), Tavlama Sıcaklığı
Bm12F CGTGGTCCCCGCTGTCCCCC * 65 ° C
Bm12R GGGCAGAGGGCAGAGGTGAG
Segment Döngü sayısı Isı Süre
1 1 95 ° C 2 dak.
2 40 95 ° C 15 sn.
* 65-,5 ° C / adım 15 sn.
72 ° C 45 sn.
3 1 72 ° C 10 dk.

Tablo 1:. Primerler ve bm12 genotipleme için ısı döngüsü şartları en uygun ısı döngüsü şartları kullanılan tam reaktifler ve aletleri bağlı olacaktır. Protokol aynı zamanda statik bir tavlama sıcaklığı kullanılarak işe yarayabilir ama bu koşullar, her adımda tavlama sıcaklığının değiştirilmesi edebilen bir PCR için optimize edilmiştir.

Tablo 2
Tablo 2:. Başarıyla kullanmış paneller dalak TFH, GC Yatak ve akış sitometri plazma hücre tanımlaması için antikor paneller Sunan vardır3. günde (sol) ve bm12 hücre enjeksiyonu (orta) 14 gün sonra T ve B hücrelerinin analizi greft etkinliğini değerlendirmek için. Bunlar 5 lazerler (355, 405, 488, 561, ve 640 nm) sahip bir LSRII için optimize edilmiştir. Bu her makine için en iyi seçenek olmayabilir ama her florokrom için önerilen filtre setleri, (sağda) listelenmiştir. Ne lazer, PMT ve filtre seti kombinasyonları bağlı olarak birden paneller içerisine T ve B hücre analizi paneli ayıran gerekli olabilir, vardır.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Bm12 indüklenebilir modeli SLE hücresel ve moleküler süreçler incelemek için nispeten kolay ve etkili bir yoldur. Çok kendi antigenine karşı yönlendirilen adoptively transfer CD4 T hücrelerinin aktivasyonu kronik, burada açıklandığı gibi, akış sitometresi ile ölçülebilir TFH GC B hücreleri ve plazma hücrelerinin birikmesine yol açar. Hızla ve kolayca SLE hastalarında meydana benzeyen ve sonuçta otoantikorların patolojik birikimini yöneten otoimmün germinal merkez süreçlerinde aday genler ve yeni tedavilerin rolü sorguya bu model kullanılarak gelecekteki çalışmalar. Bundan başka, burada açıklanan akış sitometrik analizi de dahil olmak üzere immünoglobülin gelişimini içeren ek bir fare modelleri incelemek için kullanılabilir, ancak otoimmünite, enfeksiyon, alerji ve sınırlayıcı olmamak kaydıyla.

Insan hastalığının tüm hayvan modellerinde olduğu gibi, bu model aynı zamanda sınırlamaları vardır. Hangi hastalık devel ile hız göz önüne alındığındaop ve büyüklüğü, SLE gelişimi ile ilgili tüm genler, bu modelde, patojenik için gerekli olması muhtemel değildir. Veri genetiği değiştirilmiş alıcılarda TFH minimal genişleme önermek Ayrıca, bakım greft reddini ekarte etmek için alınmalıdır. Konjenik belirteçler alıcı hücreler aynı zamanda başka verici hücre yokluğu maske TFH (Şekil 3B), farklılaşabildiği özellikle hasatta donör hücrelerin varlığını doğrulamak için kullanılır. Konjenik işaretlerini kullanarak, belirgin bir gün 14 (Şekil 6) tarafından reddedilmesi antijenleri barındıran donör hücreleri tamamen ortadan kaldırılması görülmektedir. Başarıyla vericileri olarak CD45.1 + bm12 ve CD45.2 + bm12 fareler kullanılır ve adres alıcıları (Şekiller olarak CD45.1 + BoyJ (B6.SJL- Ptprc a PEPC b / BoyJ) ve CD45.2 + C57BL / 6 fareleri 3, 6, 7, ve yayınlanmamış veriler). Bununla birlikte, yabani tip konjenikB6.PL- Thy1 a / ​​CyJ fare suşundan CD90.1 + hücreler, besbelli değil bir fenomen de greft, ne de CD90.1 + alıcı (yayınlanmamış veriler) greft iyi CD90.2 + bm12 hücreleri yapmayın Bu model 26 özgü.

Her iki C57BL / 6 ya da bm12 farenin başlangıçta Morris ve arkadaşları tarafından rapor verici veya alıcı olarak görev yapabilir. 9 Ancak laboratuarımızda Biz B6 farelere bm12 hücre transferi, T hücresi ve B hücresi daha tutarlı genişlemesi oluşturur arayan 14. gün de popülasyonlar Ayrıca, farklı gruplardan donör ve alıcı fareler cinsiyet ve yaş eşleştirilmiş olmalıdır. Bm12 modelinin ilk açıklamasında bildirilen deneyler erkek → erkek ve kadın → kadın transferler 9 arasında herhangi bir hastalık parametresinde anlamlı fark bulunmamasına rağmen, erkek → kadın transferler erkek antijen (HY) olarak, tavsiye transfer CD4 T hücreleri tarafından ifade edilmeyen greft reje indükleyebilirdişi alıcıların 27 ction.

Kapı, tüm CD45.1 + graft teşkil etmez - konjenik markörler için antikorlar ve fluorochromes seçerken, verici hücreler, bir CD45.2 olduğu, çeşitli derecelerde, alıcı konjenik marker için pozitif hale olduğu not edilmelidir. Fenomeni açık CD45.1 + naiv, CD45.1 + verici ve alıcı CD45.2 + CD4 T hücreleri (Şekil 7) tarafından CD45.2 ifade bir karşılaştırma gösterilmiştir. Özellikle, donör hücreleri naif kontroller (Şekil 7) ile karşılaştırıldığında, kendi konjenik işaretleyicinin ekspresyonunu yukarı-regüle görünmektedir. Benzer sonuçlar CD45.1 + BoyJ farelere CD45.2 + bm12 transferi ile birlikte görülür (veriler gösterilmemiştir). Muhtemelen, aktif CD4 T hücreleri tarafından trogocytosis 28 dan alıcı CD45 sonuçlarının edinimi alıcı B hücreleri ile etkileşimleri tekrarlanan aşağıdaki. Aslında, bm12 modul in vivo trogocytosis sürecini incelemek yararlı bir araç ispat edebilir.

Şekil 7,
Şekil 7. Donör hücreleri elde alıcı CD45 konjenik kalem. CD45.1 + bm12 lenfositler CD45.2 +, C57BL / 6 alıcı içerisine transfer edilmiştir. Donör, alıcı ve naif (CD45.1 +) CD4 T hücreleri 14 gün transferden sonra CD45.1 ve CD45.2 ifade değerlendirilir. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Bu C57BL / 7 farelere saflaştırılmıştır bm12 CD4 T hücrelerinin transferi hastalığı 29 başlatmak için yeterli olduğu gösterilmiştir; Bununla birlikte, eş hastalığı Bütün lenfositler transfer edildiğinde geliştirir ve saflaştırma zorunlu T ce üzerine hastalığı bağımlılığı çalışma için gerekli değildirll-içsel gen ekspresyonu. Eisenberg ve arkadaşları, açık bir şekilde bm12 modelinde antikor üreten hücre neredeyse sadece alıcı kökenli 30 arasında olduğunu ortaya koymuştur. Ayrıca, alıcı CD4 T hücreleri 10 gereksinimi verilerimiz alıcı göstermektedir, ancak T hücreleri katılabilir, off-set eksojen IL-4 31 eklenerek olabilir gelişim sırasında B hücrelerinin 'beslenmesi' sınırlıdır biraz germinal merkez yanıt, bazıları bir TFH fenotip (Şekil 3B, sağ altta) geliştirmek gibi.

Analizler için dokuların hasat zaman her bm12 deney için yapılmalıdır biri kritik bir karardır. Tabii ki karar faktörleri değişebilir çalışmada, için önemli olan tam olarak ne bağlıdır. Onlar TFH hücreleri ve plazma hücrelerinin ilk geliştirme odaklanmak burada açıklanan deneyler, 14 gün kadar sürebilir; Bununla birlikte, bu model yana kronikSLE GVHD modeli, hastalık daha uzun izlenebilir. Aslında, glomerülonefrit dahil SLE bazı klinik özellikleri, daha sonra gelişir. Proteinüri sonrası enjeksiyon 10,31 4-8 hafta zirve seviyeleri gibi erken 2 olarak haftalar sonrası enjeksiyon algılandı, ancak ulaşır olmuştur. Ayrıca, akım sitometri burada açıklanan analizleri 2 hafta süren deneyler için optimize edilmiştir. Bu zaman noktasında GC B hücreleri ve plazma hücrelerinin önemli bir sayısını bulmak; , ek süre verilmiş olmasına rağmen, ANA-salgılayan plazma hücrelerinin büyük bir yüzdesi, kemik iliğinde 32 bulunabilir. Ayrıca, bu akış boyama paneli tarafından tanımlanan plazma hücreleri büyük olasılıkla da plazmablastlar Giriş Bu iki hücre tipleri arasında ayırt etmek için dahil ek antikorlar gerekli olacaktır. TFH genişleme muhtemelen biz odaklanmıştır hangi 14 günlük penceresinden sonra bir noktada doruğa ulaşır. Ancak, bildiğimiz kadarıyla, hiçbir çalışma 2 hafta ötesinde donör hücre sayısı bm12 bildirilmiştir, ya da kullanımd konjenik belirteçler adoptively transfer hücreleri izlemek için.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
B6.SJL-Ptprca Pepcb/BoyJ The Jackson Laboratory 001162 CD45.1+ BoyJ mouse strain
B6(C)-H2-Ab1bm12/KhEgJ The Jackson Laboratory 001162 Bm12 mouse strain
FastDigest PsuI Life Technologies FD1554 Restriction digest enzyme for genotyping
1X RBC Lysis Buffer eBioscience 00-4333-57
IMDM GE Healthcare SH30228.01
Plasma Separation Tube (PST) BD 365974 Blood collection tube with Dipotassium EDTA
Serum Separation Tube (SST) BD 365967 Blood collection tube with Clot activator / SST Gel
Ficoll GE Healthcare 17-1440-02  High density cell separation solution
Lympholyte-M Cedarlane CL5030 High density cell separation solution
GL-7-biotin eBioscience 13-5902-82 
Streptavidin-BUV395 BD 564176
CD138-BV421 BioLegend 142508
CD4-BV510 BioLegend 100559
TCRβ-BV605 BD 562840
CD45.1-BV711 BioLegend 110739
CD45.2-FITC BioLegend 109806
PD-1-PE BioLegend 135206
CD19-PerCP BioLegend 115532
Fas-PE-Cy7 BD 557653
CXCR5-APC BioLegend 145506
Fixable Viability Dye ef780 eBioscience 65-0865-18
CD4-BV421 BioLegend 100443
1.2 ml FACS tube inserts, racked USA Scientific 1412-1400
BD Falcon™ Round-Bottom Tubes BD 352017

DOWNLOAD MATERIALS LIST

References

  1. Helmick, C. G., Felson, D. T., et al. Part I. Arthritis Rheum. Estimates of the prevalence of arthritis and other rheumatic conditions in the United States. 58, 15-25 (2008).
  2. Lupus Foundation of America Web Site. Available from: http://www.lupus.org/answers/entry/what-is-lupus (2015).
  3. Somers, E. C., Marder, W., et al. Population-based incidence and prevalence of systemic lupus erythematosus: The Michigan lupus epidemiology and surveillance program. Arthritis and Rheumatol. 66, 369-378 (2014).
  4. Perry, D., Sang, A., Yin, Y., Zheng, Y. -Y., Morel, L. Murine models of systemic lupus erythematosus. J Biomed Biotechnol. 2011, 271694 (2011).
  5. Lindholm, L., Rydberg, L., Strannegård, O. Development of host plasma cells during graft-versus-host reactions in mice. Eur J Immunol. 3, (8), 511-515 (1973).
  6. Fialkow, P. J., Gilchrist, C., Allison, A. C. Autoimmunity in chronic graft-versus-host disease. Clin Exp Immunol. 13, 479-486 (1973).
  7. Streilein, J. W., Stone, M. J., Duncan, W. R. Studies on the Specificity of Autoantibodies Produced in Systemic Graft-vs-Host Disease. J Immunol. 114, (1), 255-260 (1975).
  8. Gleichmann, E., Gleichmann, H. Diseases caused by reactions of T lymphocytes to in compatible structures of the major histocompatibility complex. I. Autoimmune hemolytic anemia. Eur J Immunol. 6, (12), 899 (1976).
  9. Morris, S., Cohen, P. L., Eisenberg, R. Experimental induction of systemic lupus erythematosus by recognition of foreign Ia. Clin Immunol Immunopathol. 57, (2), 263-273 (1990).
  10. Chen, F., Maldonado, M., Madaio, M., Eisenberg, R. The Role of Host (Endogenous) T Cells in Chronic Graft-Versus-Host Autoimmune Disease. J Immunol. 161, (11), 5880-5885 (1998).
  11. Klarquist, J., Hennies, C. M., Lehn, M. A., Reboulet, R. A., Feau, S., Janssen, E. M. STING-Mediated DNA Sensing Promotes Antitumor and Autoimmune Responses to Dying Cells. J Immunol. 193, 6124-6134 (2014).
  12. Petri, M., Orbai, A. -M., et al. Derivation and validation of systemic lupus international collaborating clinics classification criteria for systemic lupus erythematosus. Arthritis Rheum. 64, (8), 2677-2686 (2012).
  13. Zangala, T. Isolation of genomic DNA from mouse tails. J Vis Exp. (6), e246 (2007).
  14. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J Vis Exp. (63), e3998 (2012).
  15. Product information: Thermo Scientific FastDigest PsuI. Thermo Scientific. Available from: https://tools.lifetechnologies.com/content/sfs/manuals/MAN0012567_FastDigest_PsuI_UG.pdf (2012).
  16. Matheu, M. P., Parker, I., Cahalan, M. D. Dissection and 2-photon imaging of peripheral lymph nodes in mice. J Vis Exp. (7), e265 (2007).
  17. Harrell, M. I., Iritani, B. M., Ruddell, A. Lymph node mapping in the mouse. J Immunol Methods. 332, (1-2), 170-174 (2008).
  18. Covelli, V. Chapter 3, Internal examination. Guide to the necroscopy of the mouse. Available from: http://eulep.pdn.cam.ac.uk/Necropsy_of_the_Mouse/index.php?file=Chapter_3.html (2009).
  19. Quah, B. J. C., Parish, C. R. The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation. J Vis Exp. (44), e2259 (2010).
  20. Matheu, M. P., Cahalan, M. D. Isolation of CD4+ T cells from mouse lymph nodes using Miltenyi MACS purification. J Vis Exp. (9), e53319 (2007).
  21. Machholz, E., Mulder, G., Ruiz, C., Corning, B. F., Pritchett-Corning, K. R. Manual Restraint and Common Compound Administration Routes in Mice and Rats. J Vis Exp. (67), e2771 (2012).
  22. Hoff, J. Methods of Blood Collection in the Mouse. Lab Animal. 29, (10), 47-53 (2000).
  23. Cohen, M., Varki, N. M., Jankowski, M. D., Gagneux, P. Using Unfixed, Frozen Tissues to Study Natural Mucin Distribution. J Vis Exp. (67), e3928 (2012).
  24. Cohen, P. L., Maldonado, M. A. Animal models for SLE. Curr Protoc Immunol.. Chapter 15, Unit 15.20 (2003).
  25. Seavey, M. M., Lu, L. D., Stump, K. L. Animal models of systemic lupus erythematosus (SLE) and ex vivo assay design for drug discovery. Curr Protoc Pharmacol. Chapter 5, Unit 5 (2011).
  26. McKenna, K. C., Vicetti Miguel, R. D., Beatty, K. M., Bilonick, R. A. A caveat for T cell transfer studies: generation of cytotoxic anti-Thy1.2 antibodies in Thy1.1 congenic mice given Thy1.2+ tumors or T cells. J Leukoc Biol. 89, (2), 291-300 (2011).
  27. Scott, D. M., Ehrmann, I. E., et al. Identification of a mouse male-specific transplantation antigen H-Y. Nature. 376, 695-698 (1995).
  28. Joly, E., Hudrisier, D. What is trogocytosis and what is its purpose. Nat Immunol. 4, (9), 815 (2003).
  29. Brown, D. R., Calpe, S., et al. Cutting edge: an NK cell-independent role for Slamf4 in controlling humoral autoimmunity. J Immunol. 187, (1), 21-25 (2011).
  30. Morris, S. C., Cheek, R. L., Cohen, P. L., Eisenberg, R. A. Allotype-specific immunoregulation of autoantibody production by host B cells in chronic graft-versus host disease. J Immunol. 144, (3), 916-922 (1990).
  31. Choudhury, A., Cohen, P. L., Eisenberg, R. A. B cells require “nurturing” by CD4 T cells during development in order to respond in chronic graft-versus-host model of systemic lupus erythematosus. Clin Immunol. 136, (1), 105-115 (2010).
  32. Slifka, M. K., Antia, R., Whitmire, J. K., Ahmed, R. Humoral immunity due to long-lived plasma cells. Immunity. 8, (3), 363-372 (1998).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics