Den bm12 Inducerbar Model af systemisk lupus erythematosus (SLE) i C57BL / 6-mus

JoVE Journal
Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Klarquist, J., Janssen, E. M. The bm12 Inducible Model of Systemic Lupus Erythematosus (SLE) in C57BL/6 Mice. J. Vis. Exp. (105), e53319, doi:10.3791/53319 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Systemisk lupus erythematosus (SLE) er en kompleks autoimmun sygdom karakteriseret forbilledet af anti-nukleare antistof (ANA) produktion og glomerulonephritis. Talrige andre følgetilstande, herunder dermal, hjerte-lunge og leverlæsioner er forbundet med sygdom hos nogle personer. Skøn over udbredelsen i USA varierer meget, fra 150,000-1,500,000 1,2, med særlig høj forekomst hos kvinder og minoriteter 3. Selvom ætiologien af ​​SLE har været vanskeligt at få øje på, menes det at opstå fra samspillet mellem forskellige genetiske og miljømæssige faktorer, som kulminerer i systemisk autoimmunitet.

Talrige dyremodeller har været ansat til at studere faktorer, der fører til sygdomsdebut og progression. Klassiske musemodeller for SLE omfatter genetisk disponerede musestammer herunder NZB x NZW F1 modellen og dens NZM derivater, MLR / lpr-stamme, og BXSB / Yaa stamme og inducerbare systemer, såsom pristane og kronisk graft-versus-host-sygdom (cGVHD) modeller 4. Tidlige rapporter om autoantistofproduktion i GVHD modeller anvendt forskellige musestammer eller hamster stammer til forældre i F1 overførsler 5 - 8; mere almindelige metoder, der anvendes til at studere lupus-lignende sygdom omfatter i øjeblikket DBA / 2 forælder → (C57BL / 6 x DBA / 2) F1, og bm12 overføringsmodel beskrevet her. Hver model har sine egne forbehold, men de generelt deler et fælles sæt af funktioner, der korrelerer med de kliniske funktioner i human sygdom. De oftest rapporterede parametre i musemodeller omfatter splenomegali, lymfadenopati, nephritis, ANA produktion og på celleniveau, udvidelse af T follikulære hjælperceller (TFH), kimcenter (GC) B-celler og plasmaceller.

Den inducerbare bm12 model opnås ved adoptiv overføring af lymfocytter fra IA bm12 B6 (C) - H2 - Ab1 bm12 / KhEgJ (bm12) mus, en stamme identical til C57BL / 6 undtagen 3 aminosyresubstitutioner på MHC klasse II, i IA b C57BL / 6 (B6) -mus. Alloaktivering af donor CD4 T-celler ved modtagerens APC'er fører til cGVHD med symptomer ligner SLE. Specifikt omfatter disse udvidelse af donorafledte TFH, udvidelse af modtagerens-afledte GC B-celler og plasmaceller, og produktion af Anas herunder anti-dsDNA, anti-ssDNA, anti-chromatin og anti-RBC-antistoffer 9. Over tid, recipientmus udvikle glomerulonephritis i forbindelse med IgG indskud i den glomerulære, interstitiel, og vaskulære områder i nyrerne 10. Vi har for nylig vist, at i lighed med human sygdom, er der også en kritisk rolle for type I IFN i denne model 11. Især de definerer kriterier for human SLE ​​omfatter udvikling af nephritis kompatibel med SLE i nærvær af anti-dsDNA-antistoffer 12, som begge er fremtrædende træk ved denne musemodel.

Der er seVeral fordele ved bm12 model over de spontane modeller. Klassiske modeller, der udvikler SLE-lignende tegn spontant afhængige af enten hybride musestammer, indavlede musestammer ikke på B6 baggrund, eller store genetiske loci på B6 baggrund, som gør passerer til knockout eller på anden måde genetisk modificerede mus vanskeligt og tidskrævende. Med bm12 inducerbare model, kan genetisk modificerede mus tjene som enten donor eller modtager, mulighed for en hurtigere identifikation af det cellulære rum, hvor bestemte gener kan være vigtige for sygdommen. Desuden udvikling sygdom i bm12 model er meget hurtigere, kræver kun 2 uger, indtil fremkomsten af ​​Anas, i forhold til flere måneder for de fleste spontane modeller. Endvidere i modsætning til de spontane modeller, der udvikler sygdommen på forskellige tidspunkter, sygdommens indtræden og progression i bm12 → B6 model er stærkt synkroniseret. Dette muliggør generering af passende størrelse kohorter, der kan Be bruges til interventionelle eller terapeutiske strategier på ethvert stadium af udviklingen sygdom.

Hvad der følger er en detaljeret protokol for at indlede SLE-lignende autoimmunitet ved adoptiv overførsel af bm12 lymfocytter i C57BL / 6 mus, eller genetiske varianter på B6 baggrund. Derudover beskriver vi en flowcytometrisk farvningsprotokollen for optælle TFH, GC B-celler og plasmaceller-celletyper forbundet med human sygdom. Det er vigtigt, kan disse protokoller også anvendes til at karakterisere sygdommen i de fleste musemodeller for SLE og identificere TFH, GC B-celler og plasmaceller i andre sygdomsmodeller.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Animal arbejde blev udført under specifikke patogenfrie betingelser i overensstemmelse med retningslinjer fastsat af Foreningen for Vurdering og akkreditering af Laboratory Animal Care International og vores Institutional Animal Care og brug Udvalg (IACUC).

BEMÆRK: Indarbejde mus, der udtrykker en kongene markør såsom CD45,1 enten donor eller modtagende dyr om muligt, fordi det giver mulighed for overvågning af donor graft effektivitet og specifik udvidelse af donor CD4 T-celle population. Hvis overvejer brugen af ​​ellers genmodificerede mus som donor eller modtager, sikre stammen er korrekt tilbagekrydset til B6 baggrund, eller overførte celler kan afvises-dette vil blive behandlet nærmere i de repræsentative resultater og diskussion sektioner.

BEMÆRK: Følgende procedurer detalje mængder for høst 4 donor bm12 mus, som bør give nok celler til at injicere 12-16 mus. Sekstil tolv uger gamle bm12 mus giver omkring 100 til 140.000.000 lymfocytter med ca. 25% CD4 T-celler. Hvis man starter med forskellige antal af mus, eller forskellige musestammer, skala mængder op eller ned i overensstemmelse hermed. C57BL / 6-mus giver generelt lignende udbytter med tættere på kun 20% CD4 T-celler.

BEMÆRK: Udfør alle trin ved stuetemperatur, og bruge RT medier for at undgå varme og kulde chok, som kan forringe langsigtede lymfocyt levedygtighed. Udfør væv høst og væv-procestrin i en vævskultur hætte ved hjælp af aseptisk teknik. Alle medier i denne protokol er IMDM med 10% varmeinaktiveret FBS, medmindre andet er angivet, og bliver simpelthen benævnt "komplette medier".

1. ny metode til Genotypning bm12 Mus

BEMÆRK: En kort restriktionsfordøjelse-baseret protokol til genotypebestemmelse leveres her, da et enkelt og billigt alternativ til sekventering, som i øjeblikket er den eneste offentliggjorte genotype metodefor disse mus.

  1. Isoler genomisk DNA fra mus haler. Der henvises til en tidligere JOVE artikel for detaljerede protokoller på mus hale klipning og generering af cDNA fra halen fordøjer 13.
  2. Udføre en reverse transkriptase polymeriseret kædereaktion (PCR) til at amplificere 14 et fælles 474 bp DNA-fragment fra MHC-II IA b og IA bm12 anvendelse af primere og termocykliseringsbetingelser anført i tabel 1.
  3. Udfør restriktionsfordøjelse på ~ 7 pi af PCR-produktet ved hjælp af enzymet PsuI, eller et af dets isoschizomers (BstX2I, BstYl, MflI eller XhoII), som skærer vildtype IA b, men ikke IA bm12 mutant. Følg fordøje protokollen tilvejebragt af producenten, som specificerer en blanding af vand, puffer og enzym og en inkubation på 5 min. til flere timer ved 37 ° C 15.
  4. Indlæse fordøje produkt og kørt på 1% polyacrylamidgel med ethidiumbromid 14 til 30-45 min. 150V-selv optimale spænding og klokkeslæt vil variere afhængigt af PCR-gel anvendte apparatur. Visualiser DNA-bånd med en UV-lampe. Repræsentative resultater er vist i figur 1.

Figur 1
Figur 1. Repræsentative bm12 genotypebestemmelse resultater.
At identificere mus homozygote for IA bm12 / bm12 blev hale DNA screenet for bm12 ved PCR / restriktionsfordøjelse genotypebestemmelse (trin 1). Homozygot vildtype (IA b / b) DNA giver to bånd på 227 og 247 bp (visualiseret som en tyk bånd ved ~ 250 bp); homozygot bm12 (IA bm12 / bm12) DNA udbytter én band på 474 bp; og heterozygot (IA bm12 / b) DNA giver to bånd ved ~ 250 og 474 bp. Klik her for at se en større version af dette tal.

2. Høst DonorCeller

  1. Sacrifice donormus hjælp Institutional Animal Care og brug Udvalg (IACUC) -godkendte primære og sekundære eutanasi metoder. For eksempel aflive mus ved kvælning med CO2, efterfulgt af cervikal dislokation.
  2. Ved hjælp af aseptisk teknik, høst milt og lymfeknuder (overfladisk livmoderhalskræft, kæbelymfeknuderne, brachialis, aksil, mesenterial, og lyske) i 15 ml rør indeholdende komplet medier 10 ml som i 11-13.
    BEMÆRK: Se de tidligere rapporter for detaljeret lymfeknudedissektion protokoller 16 - 18. Denne model er også vellykket bruger kun musesplenocytter til overførsel, men tilføjelsen af ​​lymfeknuder reducerer det nødvendige antal donormus.
  3. Generere en enkelt-celle-suspension ved mæskning lymfevæv opsamlet i trin 2.2 gennem 70 um celle sier ved hjælp af stemplet fra en sprøjte. For bedre udbytter, ikke overbelaste sier anvendelse ~ 6 sier for hver 4mus behandlet, og skyl sier hyppigt under behandling. Kombiner væv fra 4 mus i to 50 ml koniske rør, hvorefter den centrifugeres celler i 5 minutter ved 400 xg, og der dekanteres supernatanten.
  4. Resuspender celler fra begge koniske rør i 50 ml komplette medier og overførsel til ny konisk rør. Hold dette rør ved stuetemperatur.
    BEMÆRK: Fat klæber til siderne af røret, og hvis røret ikke udskiftes, kan de endelige cellulære udbytter lide.

3. Donor Cell Counting

BEMÆRK: For at bevare den højeste levedygtighed, røde blodlegemer (RBC) lyse af hele prøven ikke anbefales.

  1. Bland enkelt celle suspension fra trin 2.4 godt, fjern 1 ml og overføre det til en separat 50 ml konisk. Braklægning resterende, uberørte celler (49 ml) ved stuetemperatur, mens tælle.
  2. Tilsæt 3 ml af en ammoniumchlorid-baserede røde blodlegemer lysepuffer til 1 ml donor celleprøve. Bland forsigtigt i 1 min. ved rokkende, derefter udfylde til 50 ml med komplet medium, ennd centrifugeres i 5 min. ved 400 xg og dekanteres supernatanten.
  3. Resuspender RBC-lyserede celler i 10 ml komplette medier og tæller (f.eks, med trypanblå ved hjælp af et hæmocytometer). Multiplicer resultat med 49-dette er det samlede antal celler tilbage i den ikke-lyserede prøve, der blev afsat. Kassér RBC-lyserede celler.

4. donorcelle mærkning og / eller CD4 T-celle Rensning

  1. Hvis det ønskes, oprense CD4 T-celler på dette stadium, selv om dette ikke er nødvendigt. Desuden, hvis det ønskes, label celler med CFSE, som i 19, eller andre cellesporing farvestoffer, hvoraf et eksempel er vist i figur 4 i den repræsentative resultatafsnittet.
    BEMÆRK: For CD4 T-celle oprensning negativ magnetisk selektion anbefales, da det kan opnå høj renhed og efterlader celler urørt med høj levedygtighed som beskrevet i 20. Det er vigtigt, at endotoxin-fri buffere anvendes; Derfor, i stedet for BSA, gør adskillelse buffer with 2% FBS og den anbefalede koncentration af EDTA.

5. Injektion af donor bm12 Cells

  1. Efter tælling donorlymfocytter i trin 3 (og oprenset eller mærket som i trin 4, hvis det ønskes), centrifuge celler i 5 minutter ved 400 x g. Dekanteres supernatanten og resuspender cellerne i PBS ved 120 millioner lymfocytter pr ml (eller 30 millioner oprensede CD4 T-celler per ml). Overfør celler til en steril 5 ml rundbundet rør eller andet sterilt rør, der nemt kan rumme en 1 ml sprøjte forsynet med en 27,5 g x 13 mm nål.
  2. Før injektion afsat et lille udsnit af donorceller fra trin 5.1 ved 4 ° C i flow farvning for at bestemme procentdelen af ​​CD4 T-celler i donorprøver. Farv disse prøver som beskrevet i trin 8 under anvendelse af den minimale antistofpanel (tabel 2).
    BEMÆRK: Hvis celler fra forskellige musestammer anvendes som separate donorer, dette er en vigtig overvejelse, og hvis CD4 T-celle procentsatser varierer betydeligt, PURification kan være påkrævet.
  3. Bland cellerne forsigtigt, men grundigt. Dette kan gøres ved pipettering celler op og ned ved hjælp af en 1 ml sprøjte uden kanyle. Efter blanding, trækker celler i 1 ml sprøjte. Vedhæft nål efter fjerne eventuelle luftbobler. Holde nålen ud, mens priming sprøjten bidrager til at opretholde cellelevedygtighed.
  4. Injicer 250 pi pr mus (som er lig med 30 millioner lymfocytter, eller 7,5 millioner oprensede CD4 T-celler per mus) intraperitonealt som beskrevet i 21.
    BEMÆRK: I forsøg vist her og i vores tidligere arbejde 11, er hver mus injiceret med 30 millioner i alt lymfocytter fra bm12 donorer, snarere end de 100 millioner samlede splenocytter traditionelt anvendes. I upublicerede data fra vores laboratorium blev ikke observeret nogen forskel i serum anti-dsDNA på dag 14 efter injektion af 30 eller 100 millioner lymfocytter per mus. Mens dette reducerer antallet af mus, der er nødvendige for eksperimenter, udvikling af nephritis with dette antal celler ikke er blevet vurderet.

6. Bestem Podning Effektivitet

NOTE 1: Dette afsnit beskriver, hvordan du bestemme graden af donorcellen podning i modtageren på dag 3 med henblik på at identificere eventuelle mus der kan have modtaget suboptimale injektioner (f.eks transplantatet i en mus er <10% af den, der ses i alle andre mus fra samme gruppe). Disse data kan også hjælpe med at afgøre, om celler fra en genetisk modificeret musestamme afvises på senere tidspunkter (for detaljer, se repræsentative resultater sektion, figur 6).

NOTE 2: Dette afsnit er kun muligt, hvis donorer og modtagere er fra mus på forskellige kongene baggrunde, f.eks, når du bruger CD45,1 bm12 donorer og CD45,2 C57BL / 6 modtagere, eller når donorceller er mærket med en celle sporing farvestof. Det er vigtigt, at 3 dage efter injektion, har CD4 T-celler gennemgået minimal udvidelse (see repræsentativt resultatafsnittet, figur 4), så observeret forskelle i graden af podning skyldes variation i injektioner, ikke ekspansion.

  1. Bedøver mus med 4% isofluran eller andet IACUC-godkendt metode. Test bageste fod reflekser for at sikre musen er korrekt bedøvet før man går videre til blodet lodtrækningen.
  2. Harvest 100-200 ml blod ved hjælp af en IACUC-godkendt fremgangsmåde, såsom retro-orbital punktur som i 22. Indsamle blod i individuelle 0,5 ml mikrocentrifugerør indeholdende et antikoagulerende, såsom rørene plasmaindsamlingscentret refereres i tabellen materialer, der indeholder lyofiliseret dikalium EDTA. Efter blodprøvetagning, tryk forsigtigt til musen øjet ved hjælp af en steril håndklæde eller gaze til at sikre de blødningen stopper, derefter placere musen tilbage i sit hjem bur, hvor det vil forblive, indtil den endelige væv høst (trin 7).
    BEMÆRK: Lad ikke mus uden opsyn, indtil mus har genvundet tilstrækkelig bevidsthed tilopretholde ventrale tilbagelænethed, og ikke returnere mus til selskab med andre, indtil fuldt tilbagebetalt.
  3. Bring blodvolumen til 500 pi med 21 ° C PBS og overføres til koniske bund mikrocentrifugerør, derefter langsomt underlag 200 pi 21 ° C med høj densitet cellesepareringspræparat opløsning med en 200 pi pipette, være omhyggelig med at minimere blanding mellem de to faser ( se Materialer Tabel til anbefalede løsninger). Centrifuger cellerne ved 700 x g i 20 minutter ved 20-25 ° C med centrifuge bremse indstillet for lavt.
  4. Fjern øverste lag indeholdende lymfocytter med en 1 ml pipette og overføres til et nyt mikrocentrifugerør indeholdende 800 pi kold fuldstændige medier. Forsigtigt blandes på vortex at blande celler. Centrifuger cellerne ved 700 x g i 5 minutter ved 4 ° C og dekantere supernatanten.
  5. Resuspender celler i 200 pi komplet medier, overførsel til en 96-brønds U-bundplade, og bejdse til flowcytometri som beskrevet i trin 8 ved hjælp af en minimal antistof panel (tabel 2) at bestemme than relative forekomst af CD4 T-celle graft som en procentdel af PBMC'er.

7. Sidste Tissue Harvest

BEMÆRK: der er beskrevet i resultatafsnittet forsøg blev høstet 14 dage efter injektion af donor celler (eller i nogle tilfælde mindre tid), da de fokuserer på den indledende udvikling af TFH celler og plasmaceller; men da denne model er en kronisk GVHD model af SLE, sygdom kan overvåges ved meget senere tidspunkter. Den optimale tidsramme vil afhænge af den forskning, spørgsmål stillet i hvert enkelt eksperiment.

  1. På et forudbestemt tidspunkt efter injektion af bm12 donorceller (trin 5.4), ofre mus med et IACUC-godkendt metode til eutanasi. Kvælning med CO2 efterfulgt af afblødning anbefales. Cervikal dislokation kan fungere som en sekundær fremgangsmåde til eutanasi, men dette kan reducere blodudtagningen udbytte.
  2. Fugt maven af ​​musen let med en sprayflaske indeholdende 70%ethanol. Lav en lille, overfladisk snit med kirurgiske sakse ca 1 cm over de kønsorganer. Trække tilbage huden på maven mod brystbenet, være omhyggelig med at holde peritoneal fascia intakt.
    BEMÆRK: Syge mus sædvanligvis er til stede med 0,5-3 ml ascites ved dag 14, som, selv om det endnu ikke er blevet velkarakteriseret, kan måles og analyseres som en yderligere sygdom parameter.
  3. Monter en 5 ml sprøjte med en 18 G nål. Stik nålen ind i den nedre højre kvadrant af maven med nålen rettet op mod dyrets hoved og ved 15 ° vinkel i forhold til planet af fascia. Placer nålespidsen nær coecum for at forhindre, at nålen i at blive tilstoppet med tarmen, mens opsugning ascites.
  4. Drej forsigtigt musen på sin side, derefter langsomt trække ascites ind i sprøjten. Når ascites er blevet inddrevet, fjern sprøjten og registrere aspirer volumen, baseret på de volumetriske markeringer på siden af ​​den SyriNSÆ.
  5. Udledning ascites i en 5 ml rundbundet rør og opbevare på is til senere behandling.
  6. Harvest blod via draw fra inferior vena cava (IVC) i det væsentlige som i 22. Ved hjælp af kedelige pincet, forsigtigt flytte tarmene til venstre side af musen, afdække IVC. Indsæt en 27,5 G nål fastgjort til en 1 ml sprøjte i IVC og langsomt trække 400-500 pi blod.
  7. For at minimere hæmolyse, injicer langsomt blod i et 0,5 ml mikrocentrifuge serum eller plasma opsamlingsrør. Til senere serum analyse af Anas ved ELISA, holde blod på is.
  8. Dissekere og opnå yderligere relevante væv (milt og, hvis det ønskes, lymfeknuder og nyrer, især hvis indsamling på senere tidspunkter og glomerulonefritis bliver scoret). Fjern milt ved forsigtigt at placere tarmene tilbage mod højre side af dyret, og trække i bugspytkirtlen, som er milten primære bindevæv.
  9. Fjern eventuelle bugspytkirtlen tilbage, vejesMilte på en høj præcision balance umiddelbart efter dissektion, som grov splenomegali er et almindeligt rapporteret parameter i musemodeller af SLE. Placer lymfoide væv i individuelle 1,5 ml rør fyldt med 1 ml komplet medier på is. Fix nyrer i 10% neutral pufret formalin eller snap fryse nyrerne til senere histologi som i 23.
  10. Centrifuge blod inden 2 timer for indsamling i 3 min. ved 10.000 xg (4 ° C). Fjern serum og opbevares ved -80 ° C til senere analyse af ANA ved ELISA. Der henvises til tidligere rapporter til detaljeret ANA ELISA-protokoller 24,25. Store serum i flere 10-20 pi prøver at minimere fryse / optøningscykler, og tillade en større række fremtidige assays.
  11. Centrifuger ascites 400 xg i 5 minutter. Fjern supernatanten med en 1 ml pipette og alikvot i flere 0,5 ml rør. Frys supernatanten ved -80 ° C til senere analyser af anti-nukleare antistoffer (Anas) eller andre opløselige inflammatoriske mediatorer.
  12. Resuspender cellulære fract ion i ca. 1 ml komplette medier og overføre 200 pi til en 96-brønds U-bundplade for flow farvning (som i trin 8).
  13. Mash hver milt gennem 70 um celle sier i separate rør og skyl med komplette medier. Resuspender splenocytter med 1 ml kold RBC lysepuffer i 1 min. og bland forsigtigt ved vuggende. Bring volumen til 10 ml med kold komplette medier og centrifugeres i 5 minutter ved 400 xg og dekanter supernatanten.
  14. Resuspender cellepelleten i 5 ml komplet medium og ud ved hjælp af et hæmocytometer. Justere lydstyrken, således at 200 pi komplette medier indeholder 1-3 millioner celler. Begynd farvning for flowcytometri (trin 8) ved hjælp af et udvidet panel (tabel 2) at kvantificere donor CD4 T-celle og modtager B-celle-differentiering og ekspansion.
    BEMÆRK: Afhængigt af, hvad laser, er tilgængelige fotomultiplikatorrør (PMT) og filtersæt kombinationer, adskillelse af T- og B-celleanalyse panel i flere paneler kan være nødvendig.
ve_title "> 8. Flow Farvning

  1. Overførsel 1-3 millioner splenocytter i 200 pi komplette medier i individuelle 5 ml rundbundede rør eller i separate brønde i en 96-brønds U-bundplade.
    BEMÆRK: Ved hjælp af en 96-brønds plade er en effektiv måde at plette flere prøver, men passe til plade prøver i hver anden brønd for at forhindre krydskontaminering. En plade med 96 brønde kan derfor holde 24 prøver.
  2. Centrifuge plade ved 500 xg i 3 min., Derefter svirp supernatant fra plade til passende (biohazard) beholder.
  3. Resuspender cellepelletene med 100 pi flow buffer (1% FBS i PBS) indeholdende en fixable levedygtighed farvestof på producentens anbefalede koncentration og renset anti-CD16 / anti-CD32-antistof cocktail på 1 pg / ml. Inkuber i 10 minutter ved 20-25 ° C, tilsæt derefter 100 pi kold komplette medier for at standse viabilitetsfarvestoffet.
    BEMÆRK: Splenocytter fra syge mus indeholder normalt relativt højt antal døde eller døende celler;anbefales derfor, at der indføjes en levedygtighed farvestof for at undgå ikke-specifikt antistof mærkning af døende celler, hvilket resulterer i renere, mere pålidelige data. Tilsvarende er den anti-CD16 / anti-CD32 cocktail inkluderet for at blokere ikke-specifik fluorescens-mærket antistof binding med Fc-receptorer.
  4. Centrifuge plade ved 500 xg i 3 min., Derefter svirp supernatant fra plade til biologisk farlige beholder. Resuspender celler i 200 pi-flow bufferen. Centrifuge plade ved 500 xg i 3 min., Derefter svirp supernatant fra plade til biologisk farlige beholder.
  5. Resuspender celler i 50 pi flow buffer indeholdende antistofcocktail (tabel 2). Inkuber i 20 minutter ved 4 ° C, hvorefter der tilsættes 150 ul-flow bufferen. Gentag vasketrin 8.4.
  6. Resuspender celler med 100 pi 2% paraformaldehyd i PBS. Inkuber i 30 minutter ved 4 ° C, hvorefter der tilsættes 100 ul-flow bufferen. Centrifuge plade ved 500 xg i 3 min., Derefter svirp supernatant fra plade til biologisk farlige beholder.
  7. Resuspend i 200 pi flow buffer, overførsel til flyde rør indsætter eller standard flow-rør, tilføje en ekstra 100-200 pi flow buffer, og opbevares ved 4 ° C i mørke, indtil erhverve på flowcytometer.
  8. Erhverve på et flowcytometer udstyret med de nødvendige lasere og PMT'er til de valgte antistof paneler inden for flere dage efter farvning. Optag forward scatter bredde og / eller højde foruden at sende scatter område, sidespredning område og areal af de fluorescerende parametre udnyttet. For pålidelige resultater, erhverve ≥1,000 donor celler i hver WT prøve, eller et tilsvarende antal af de samlede lymfocytter i genetisk modificerede eller på anden måde manipulerede mus, der viser minimal udvidelse af donor celler, hvor samling af så mange begivenheder måske ikke er mulig.
    BEMÆRK: Flowcytometri analyser er beskrevet i detaljer i den repræsentative resultatafsnittet (figur 3 - 6).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Syge mus udvikler splenomegali i så lidt som 14 dage udstiller milt 2-3 gange størrelsen af sunde mus i masse og cellularitet (figur 2).

Splenocytter sekventielt gated på lysspredning (FSC-A ved SSC-A), eliminering af dubletter (FSC-W eller -H af FSC-A), levedygtige celler (lav Farvning af levedygtighed farvestof) og CD4 + TCRβ + (figur 3A). Donorceller skelnes fra modtagende celler baseret på CD45,1 og CD45,2 (figur 3B, nederst til venstre). Donorceller overvejende vedtage en T follikulær hjælper (TFH) cellefænotype, som er kendetegnet ved opregulering af PD-1, CXCR5, Bcl-6 og ICOS (figur 3B, C). En del af modtageren CD4 T-celle population differentierer også tages TFH (figur 3B, nederst til højre). Efter en indledende die-off og / eller migration af overførte celler, udvidelse af donor-afledte TFH er logaritmisk, reaching 10-20 millioner celler i milt fra mus 14 dage efter injektion (figur 3D).

CFSE-mærkning af overførte lymfocytter viste, at donor-CD4 T-celler differentierer til TFH tidligt efter aktivering; væsentlige alle delte celler observeret på dag 3, 7 og 14 opreguleres CXCR5 og PD-1 (figur 4). Spredning peak profiler også foreslå, at en forholdsvis lav procentdel af donor CD4 T-celler undergik alloaktivering og division. På dag 14, de fleste af de påviselige donorceller er dem, der har delt ud over den maksimale antal delinger målelige af CFSE.

Udvidelsen af donorafledte TFH er ledsaget af en tilsvarende akkumulering af endogen GC B-celler og plasmaceller (figur 5A). Plasma celleakkumulering i milten er forsinket sammenlignet med TFH, ikke udviser nogen stigning i forhold til naive dyr på dag 3 eller 7 (figur 5B). Accordingly, anti-nukleare antistoffer ikke er let detekterbare før dag 9 (data ikke vist), men kan pålideligt kvantificeret på dag 14 11.

Gennem brug af kongene markører, har vi observeret afstødning af donorceller i multiple stammer. Selvom det er et almindeligt problem, når mus ikke er tilstrækkeligt tilbagekrydset til C57BL / 6 baggrund, vi også observeret afstødning, når bm12 celler blev overført til B6.PL- Thy1 a / ​​CyJ (CD90.1) mus, der generelt anses for at være fuldt tilbagekrydses. Derfor er mus rutinemæssigt screenet på dag ~ 3 ved Flowfarvning blodprøver for at vurdere effektiviteten af ​​den oprindelige CD4 T-celle graft; vi kender fra CFSE spredning eksperimenter, transplanterede celler har udvidet meget lidt på dette tidlige tidspunkt. Disse resultater er derefter sammenlignet med resultaterne fra dag 14 høsten. I et eksempel tilfælde af afslag, blev 30 millioner CD45,1 + bm12 lymfocytter overført til Cardif - / - Mus, der var blevet tilbagekrydset til C57BL / 6-mus i 12 generationer. På dag 5, alle mus viste tilsvarende podning (2-3% af cirkulerende CD4 T-celler), men på dag 14, blev bm12 donorceller helt elimineret fra genetisk modificerede modtager (figur 6).

Figur 2
Figur 2. Spleen vækstkinetik efter injektion af bm12 lymfocytter. Milte blev vejet på en høj præcisionsvægt direkte efter excision (venstre). Levende celleantal blev bestemt ved tælling med et hæmocytometer under anvendelse af trypanblåt til at udelukke døde celler (højre). Resultaterne er afbildet som gennemsnit ± SEM, hvor n = 9, 4, 3, og 6, henholdsvis. Klik her for at se en større version af dette tal.

jpg "/>
Figur 3. Analyse af T hjælper celle follikulær ekspansion i bm12 model af SLE. CD45,1 + bm12 lymfocytter blev overført til C57BL / 6-modtagere og miltene blev analyseret 14 dage senere. (A) Repræsentant gating strategi viser "lymfocytter" (første panel), "enkelte celler" (andet panel), "levende celler" (tredje panel), og "CD4 T-celler" (fjerde panel). (B) Donor celler skelnes fra modtagerlandene CD4 T-celler ved CD45,1 og CD45,2 farvning og analyseret for ekspression af PD-1 og CXCR5. (C) Donorceller vedtage TFH fænotype, som angivet ved opregulering af adskillige proteiner almindeligvis er forbundet med TFH. (D) Typiske resultater viser en udvidelse af donorafledte TFH (defineret som CD4 + CD45,1 + PD-1 + CXCR5 + levende celler) på dag 3, 7 og 14 efter overføringen. Resultaterne er vist ens gennemsnit ± SEM, hvor n = 5, 4, 3, og 6, henholdsvis. Klik her for at se en større version af dette tal.

Figur 4
Figur 4. PD-1 og CXCR5 opreguleres på delende celler. Bm12 celler blev mærket med CFSE før injektion i C57BL / 6-recipienter. Repræsentative flow plots er vist for donor CD4 T-celler ved 3, 7 og 14 dage efter injektion. Klik her for at se en større version af dette tal.

Figur 5
Figur 5. Udvidelse af milt plasmaceller og GC B-celler. (A) Repræsentative flow plots fra naive mus milt, eller dem framus 14 dage efter CD45,1 + bm12 overførsel. Plasmaceller defineres som CD138 + CD19 lave levende celler (top paneler). GC B-celler er en delmængde af CD19 + B-celler, som udtrykker GL-7 og Fas (bundpaneler). (B) Quantitave data, der viser akkumuleringen af milt plasmaceller over tid. Resultaterne er afbildet som gennemsnit ± SEM, hvor n = 5, 4, 3, og 6, henholdsvis. Klik her for at se en større version af dette tal.

Figur 6
Figur 6. Bm12 transplantater afvises af nogle genmodificerede recipientmus. CD45,1 + bm12 lymfocytter blev overført til enten genetisk modificerede mus (top paneler) eller C57BL / 6 (nederst paneler) recipientmus. Mus blev tappet på 5 dage efter injektion og vurderet for graft effektivitet. Splenocyts fra de samme mus blev analyseret 14 dage senere. Klik her for at se en større version af dette tal.

Primer navn Sequence (5 '- 3') Annealingstemperatur
Bm12F CGTGGTCCCCGCTGTCCCCC * 65 ° C
Bm12R GGGCAGAGGGCAGAGGTGAG
Segment Antal cykler Temperatur Varighed
1 1 95 ° C 2 min.
2 40 95 ° C 15 sek.
* 65 - 0,5 ° C / trin 15 sek.
72 ° C 45 sek.
3 1 72 ° C 10 min.

Tabel 1:. Primere og termocykliseringsbetingelser for bm12 genotypebestemmelse Optimale termocykliseringsbetingelser vil afhænge af de præcise reagenser og instrumenter. Disse betingelser er blevet optimeret til en thermocycler stand til at ændre annealingstemperatur på hvert trin, selvom protokollen kan også arbejde med en statisk udglødning temperatur.

Tabel 2
Tabel 2:. Antistof paneler til milt TFH, GC B og plasma-celle identifikation ved flowcytometri Præsenteret er paneler, vi har brugt med succestil vurdering af transplantat effektivitet på dag 3 (venstre) og analyse af T- og B-celler på dag 14 efter bm12 celleinjektion (midten). Disse er blevet optimeret til en LSRII med 5 lasere (355, 405, 488, 561, og 640 nm). Anbefalet filter sæt for hver fluorokrom er anført (til højre), selvom disse kan ikke være den bedste løsning for hver maskine. Afhængig af hvad laser, PMT og filtersæt kombinationer er tilgængelige, adskillelse af T- og B-celleanalyse panel i flere paneler kan være nødvendig.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Den bm12 inducerbar model er en forholdsvis let og effektiv måde at studere cellulære og molekylære processer i SLE. Kronisk aktivering af adoptivt overført CD4 T-celler rettet mod selv-antigener fører til akkumulering af TFH, GC B-celler og plasmaceller, som kan måles ved flowcytometri som beskrevet her. Fremtidige studier under anvendelse af denne model kan hurtigt og nemt interrogere rolle kandidatgener og nye terapier i autoimmune kimcenter processer, der ligner dem, der forekommer hos patienter med SLE, og i sidste ende styrer den patologiske akkumulering af autoantistoffer. Endvidere kan flowcytometrisk analyse beskrevet her anvendes til at undersøge yderligere musemodeller, der involverer udviklingen af ​​immunoglobuliner, herunder, men ikke begrænset til autoimmunitet, infektion og allergi.

Ligesom alle dyremodeller for sygdomme hos mennesker, denne model har også sine begrænsninger. I betragtning af den hastighed, hvormed sygdommen develOPS og dens størrelse, ikke alle gener involveret i udviklingen af ​​SLE er sandsynligvis vil være nødvendige for patogenicitet i denne model. Derudover skal man sørge for at udelukke graftafstødning når data tyder på minimal udvidelse af TFH i genmodificerede modtagere. Kongene markører bør anvendes til at bekræfte tilstedeværelsen af donorceller ved høst især da recipientceller også kan differentiere til TFH (figur 3B), som ellers kunne maskere fravær af donorceller. Ved hjælp kongene markører, observerede vi fuldstændig afskaffelse af donor celler, der åbenbart nærede afvisning antigener ved dag 14 (figur 6). Vi har med succes brugt CD45,1 + bm12 og CD45,2 + bm12 mus som donorer, og CD45,1 + BoyJ (B6.SJL- Ptprc en PEPC b / BoyJ) og CD45,2 + C57BL / 6 mus som modtagere (figur 3, 6, 7, og upublicerede data). Men vildtype kongeneCD90.1 + -celler fra B6.PL- Thy1 a / ​​CyJ musestamme ikke pode godt, heller ikke CD90.2 + bm12 celler graft godt i en CD90.1 + modtager (upublicerede data), et fænomen, der er åbenbart ikke unikke for denne model 26.

Enten C57BL / 6 eller bm12 mus kan tjene som donor eller modtageren, som oprindeligt beskrevet af Morris et al. 9, i vores laboratorium finder vi imidlertid overførslen af bm12 celler i B6 mus producerer mere ensartet ekspansion af T-celle og B-celle befolkninger på dag 14. Endvidere bør donor- og modtagerlande mus fra forskellige grupper være køns- og alder-matchede. Selv om forsøg rapporteret i den første beskrivelse af bm12 modellen ikke fundet nogen signifikant forskel i nogen parameter sygdom mellem han → mandlige og kvindelige → kvindelige overførsler 9, er mandlige → kvindelige overførsler ikke anbefales, som mandlige antigen (HY) udtrykt af overførte CD4 T-celler kan fremkalde graft rejeIndsatsen i kvindelige modtagere 27.

Ved valg af antistoffer og fluorochromer for kongene markører, skal det bemærkes, at donorceller bliver positive for modtageren kongene markering i varierende grad, således at en CD45,2 - gate ville ikke udgør hele CD45,1 + graft. Fænomenet er tydeligt i en sammenligning af CD45,2 ekspression ved CD45,1 + naive, CD45,1 + donoren og CD45,2 + modtagende CD4 T-celler (figur 7). Især donorceller synes også at opregulere ekspression af deres egen kongene markering, sammenlignet med naive (Figur 7). Lignende resultater ses også med CD45,2 + bm12 overførsel til CD45,1 + BoyJ mus (data ikke vist). Formentlig, erhvervelse af modtagerens CD45 resultater fra trogocytosis 28 af aktiverede CD4 T-celler efter gentagne interaktioner med modtager B-celler. Faktisk bm12 tilstandl kan vise et nyttigt redskab til at studere processen med trogocytosis in vivo.

Figur 7
Figur 7. Donorceller erhverve modtageren CD45 congene markør. CD45,1 + bm12 lymfocytter blev overført til CD45,2 + C57BL / 6 modtagere. Donor, recipient, og naive (CD45,1 +) CD4 T-celler vurderes for CD45,1 og CD45,2 udtryk 14 dage efter overførslen. Klik her for at se en større version af dette tal.

Det er blevet vist, at overførsel af oprensede bm12 CD4 T-celler i C57BL / 7 mus er tilstrækkelige til at indlede sygdommen 29; dog tilsvarende sygdom udvikler sig, når hele lymfocytter overføres, og rensning er ikke nødvendigvis påkrævet at studere sygdommen afhængighed T cell-iboende genekspression. Eisenberg og kolleger, tydeligt vist, at antistofproducerende celle i bm12 model er næsten udelukkende på modtager oprindelse 30. Desuden er kravet om modtagende CD4 T-celler 10 er begrænset til "næring" af B-celler i løbet af deres udvikling, som kan modregnes ved tilsætning af exogent IL-4 31, selv om vores data viser, at modtageren T-celler kan deltage noget i kimcentret respons, da nogle af dem udvikler en TFH fænotype (figur 3B, nederst til højre).

Et kritisk beslutning, der skal gøres for hver bm12 eksperiment er, når at høste væv til analyser. Selvfølgelig beslutningen afhænger af præcis hvilke faktorer er vigtige for den aktuelle undersøgelse, som kan variere. De her beskrevne eksperimenter tage op til 14 dage, da de fokuserer på den indledende udvikling af TFH celler og plasmaceller; Men da denne model er en kroniskGVHD model af SLE, kan sygdom monitoreres meget længere. Faktisk visse kliniske træk ved SLE, herunder glomerulonephritis, udvikle sig senere. Proteinuri er blevet opdaget så tidligt som 2 uger efter injektion, men når topniveauer på 4-8 uger efter injektion 10,31. Derudover analyser af flowcytometrisk beskrives her er blevet optimeret til eksperimenter varighed 2 uger. Vi finder en lang række GC B-celler og plasmaceller på dette tidspunkt; selv, da ekstra tid, kan en stor procentdel af ANA-udskillende plasmaceller opholde sig i knoglemarven 32. Desuden plasmaceller identificeret ved denne strøm farvning panel sandsynligvis også omfatte plasmablasts-in for at skelne mellem disse to celletyper, ville yderligere antistoffer være påkrævet. TFH ekspansion formentlig når et højdepunkt på et tidspunkt efter den 14-dages-vinduet, som vi har fokuseret. Men for at vi ved, har ingen undersøgelser rapporteret bm12 donorcelle nummer ud over 2 uger, eller brugd kongene markører til at spore adoptivt overført celler.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
B6.SJL-Ptprca Pepcb/BoyJ The Jackson Laboratory 001162 CD45.1+ BoyJ mouse strain
B6(C)-H2-Ab1bm12/KhEgJ The Jackson Laboratory 001162 Bm12 mouse strain
FastDigest PsuI Life Technologies FD1554 Restriction digest enzyme for genotyping
1X RBC Lysis Buffer eBioscience 00-4333-57
IMDM GE Healthcare SH30228.01
Plasma Separation Tube (PST) BD 365974 Blood collection tube with Dipotassium EDTA
Serum Separation Tube (SST) BD 365967 Blood collection tube with Clot activator / SST Gel
Ficoll GE Healthcare 17-1440-02  High density cell separation solution
Lympholyte-M Cedarlane CL5030 High density cell separation solution
GL-7-biotin eBioscience 13-5902-82 
Streptavidin-BUV395 BD 564176
CD138-BV421 BioLegend 142508
CD4-BV510 BioLegend 100559
TCRβ-BV605 BD 562840
CD45.1-BV711 BioLegend 110739
CD45.2-FITC BioLegend 109806
PD-1-PE BioLegend 135206
CD19-PerCP BioLegend 115532
Fas-PE-Cy7 BD 557653
CXCR5-APC BioLegend 145506
Fixable Viability Dye ef780 eBioscience 65-0865-18
CD4-BV421 BioLegend 100443
1.2 ml FACS tube inserts, racked USA Scientific 1412-1400
BD Falcon™ Round-Bottom Tubes BD 352017

DOWNLOAD MATERIALS LIST

References

  1. Helmick, C. G., Felson, D. T., et al. Part I. Arthritis Rheum. Estimates of the prevalence of arthritis and other rheumatic conditions in the United States. 58, 15-25 (2008).
  2. Lupus Foundation of America Web Site. Available from: http://www.lupus.org/answers/entry/what-is-lupus (2015).
  3. Somers, E. C., Marder, W., et al. Population-based incidence and prevalence of systemic lupus erythematosus: The Michigan lupus epidemiology and surveillance program. Arthritis and Rheumatol. 66, 369-378 (2014).
  4. Perry, D., Sang, A., Yin, Y., Zheng, Y. -Y., Morel, L. Murine models of systemic lupus erythematosus. J Biomed Biotechnol. 2011, 271694 (2011).
  5. Lindholm, L., Rydberg, L., Strannegård, O. Development of host plasma cells during graft-versus-host reactions in mice. Eur J Immunol. 3, (8), 511-515 (1973).
  6. Fialkow, P. J., Gilchrist, C., Allison, A. C. Autoimmunity in chronic graft-versus-host disease. Clin Exp Immunol. 13, 479-486 (1973).
  7. Streilein, J. W., Stone, M. J., Duncan, W. R. Studies on the Specificity of Autoantibodies Produced in Systemic Graft-vs-Host Disease. J Immunol. 114, (1), 255-260 (1975).
  8. Gleichmann, E., Gleichmann, H. Diseases caused by reactions of T lymphocytes to in compatible structures of the major histocompatibility complex. I. Autoimmune hemolytic anemia. Eur J Immunol. 6, (12), 899 (1976).
  9. Morris, S., Cohen, P. L., Eisenberg, R. Experimental induction of systemic lupus erythematosus by recognition of foreign Ia. Clin Immunol Immunopathol. 57, (2), 263-273 (1990).
  10. Chen, F., Maldonado, M., Madaio, M., Eisenberg, R. The Role of Host (Endogenous) T Cells in Chronic Graft-Versus-Host Autoimmune Disease. J Immunol. 161, (11), 5880-5885 (1998).
  11. Klarquist, J., Hennies, C. M., Lehn, M. A., Reboulet, R. A., Feau, S., Janssen, E. M. STING-Mediated DNA Sensing Promotes Antitumor and Autoimmune Responses to Dying Cells. J Immunol. 193, 6124-6134 (2014).
  12. Petri, M., Orbai, A. -M., et al. Derivation and validation of systemic lupus international collaborating clinics classification criteria for systemic lupus erythematosus. Arthritis Rheum. 64, (8), 2677-2686 (2012).
  13. Zangala, T. Isolation of genomic DNA from mouse tails. J Vis Exp. (6), e246 (2007).
  14. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J Vis Exp. (63), e3998 (2012).
  15. Product information: Thermo Scientific FastDigest PsuI. Thermo Scientific. Available from: https://tools.lifetechnologies.com/content/sfs/manuals/MAN0012567_FastDigest_PsuI_UG.pdf (2012).
  16. Matheu, M. P., Parker, I., Cahalan, M. D. Dissection and 2-photon imaging of peripheral lymph nodes in mice. J Vis Exp. (7), e265 (2007).
  17. Harrell, M. I., Iritani, B. M., Ruddell, A. Lymph node mapping in the mouse. J Immunol Methods. 332, (1-2), 170-174 (2008).
  18. Covelli, V. Chapter 3, Internal examination. Guide to the necroscopy of the mouse. Available from: http://eulep.pdn.cam.ac.uk/Necropsy_of_the_Mouse/index.php?file=Chapter_3.html (2009).
  19. Quah, B. J. C., Parish, C. R. The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation. J Vis Exp. (44), e2259 (2010).
  20. Matheu, M. P., Cahalan, M. D. Isolation of CD4+ T cells from mouse lymph nodes using Miltenyi MACS purification. J Vis Exp. (9), e53319 (2007).
  21. Machholz, E., Mulder, G., Ruiz, C., Corning, B. F., Pritchett-Corning, K. R. Manual Restraint and Common Compound Administration Routes in Mice and Rats. J Vis Exp. (67), e2771 (2012).
  22. Hoff, J. Methods of Blood Collection in the Mouse. Lab Animal. 29, (10), 47-53 (2000).
  23. Cohen, M., Varki, N. M., Jankowski, M. D., Gagneux, P. Using Unfixed, Frozen Tissues to Study Natural Mucin Distribution. J Vis Exp. (67), e3928 (2012).
  24. Cohen, P. L., Maldonado, M. A. Animal models for SLE. Curr Protoc Immunol.. Chapter 15, Unit 15.20 (2003).
  25. Seavey, M. M., Lu, L. D., Stump, K. L. Animal models of systemic lupus erythematosus (SLE) and ex vivo assay design for drug discovery. Curr Protoc Pharmacol. Chapter 5, Unit 5 (2011).
  26. McKenna, K. C., Vicetti Miguel, R. D., Beatty, K. M., Bilonick, R. A. A caveat for T cell transfer studies: generation of cytotoxic anti-Thy1.2 antibodies in Thy1.1 congenic mice given Thy1.2+ tumors or T cells. J Leukoc Biol. 89, (2), 291-300 (2011).
  27. Scott, D. M., Ehrmann, I. E., et al. Identification of a mouse male-specific transplantation antigen H-Y. Nature. 376, 695-698 (1995).
  28. Joly, E., Hudrisier, D. What is trogocytosis and what is its purpose. Nat Immunol. 4, (9), 815 (2003).
  29. Brown, D. R., Calpe, S., et al. Cutting edge: an NK cell-independent role for Slamf4 in controlling humoral autoimmunity. J Immunol. 187, (1), 21-25 (2011).
  30. Morris, S. C., Cheek, R. L., Cohen, P. L., Eisenberg, R. A. Allotype-specific immunoregulation of autoantibody production by host B cells in chronic graft-versus host disease. J Immunol. 144, (3), 916-922 (1990).
  31. Choudhury, A., Cohen, P. L., Eisenberg, R. A. B cells require “nurturing” by CD4 T cells during development in order to respond in chronic graft-versus-host model of systemic lupus erythematosus. Clin Immunol. 136, (1), 105-115 (2010).
  32. Slifka, M. K., Antia, R., Whitmire, J. K., Ahmed, R. Humoral immunity due to long-lived plasma cells. Immunity. 8, (3), 363-372 (1998).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics