El inducible Modelo BM12 del lupus eritematoso sistémico (LES) en ratones C57BL / 6 ratones

JoVE Journal
Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Klarquist, J., Janssen, E. M. The bm12 Inducible Model of Systemic Lupus Erythematosus (SLE) in C57BL/6 Mice. J. Vis. Exp. (105), e53319, doi:10.3791/53319 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

El lupus eritematoso sistémico (LES) es una enfermedad compleja caracterizada prototípicamente por el anticuerpo antinuclear (ANA) la producción y la glomerulonefritis. Numerosas otras secuelas, incluyendo dérmica, cardio-pulmonar y lesiones hepáticas están asociadas con la enfermedad en algunas personas. Las estimaciones de prevalencia en los EE.UU. varían ampliamente, desde 150,000-1,500,000 1,2, con especial incidencia en las mujeres de alto y las minorías 3. Aunque la etiología de LES ha sido difícil de discernir, se cree que surgen de la interacción de diversos factores genéticos y ambientales, que culminan en la autoinmunidad sistémica.

Se han empleado numerosos modelos animales para estudiar los factores que conducen a la aparición de enfermedades y la progresión. Los modelos clásicos de ratón de LES incluyen cepas de ratones genéticamente predispuestos incluido el NZB x NZW modelo F1 y sus derivados NZM, la cepa / lpr MLR, y la cepa BXSB / Yaa, y los sistemas inducibles, tales como el penfermedad crónica de injerto contra huésped (cGVHD) modelos de 4 y ristane. Los primeros informes de la producción de autoanticuerpos en los modelos de EICH utilizan diversas cepas de ratón o cepas de hámster para padres en las transferencias de F1 5 - 8; métodos más comunes utilizados para estudiar la enfermedad similar al lupus incluyen actualmente el DBA / 2 padres → (C57BL / 6 x DBA / 2) F1, y el modelo de transferencia BM12 se describe aquí. Cada modelo tiene sus propias advertencias, pero generalmente comparten un conjunto común de características que se correlacionan con las características clínicas de la enfermedad humana. Los parámetros más frecuentemente reportados en modelos de ratón incluyen esplenomegalia, linfadenopatía, la nefritis, la producción de ANA, y en el nivel celular, la expansión de las células T helper (foliculares TFH), centro (GC) células B germinales y células plasmáticas.

El modelo BM12 inducible se consigue mediante la transferencia adoptiva de linfocitos de IA BM12 B6 (C) - H2 - Ab1 BM12 / KhEgJ (BM12) ratones, una cepa identical de C57BL / 6 a excepción de 3 sustituciones de aminoácidos en el MHC de clase II, en IA b / 6 (B6) ratones C57BL. Alloactivation de donantes de células T CD4 por destinatario APC lleva a cGVHD con síntomas muy parecidas a LES. Específicamente, éstos incluyen expansión de donante derivado Tfh, la expansión de las células B GC receptores derivados y células plasmáticas, y la producción de ANAs incluyendo anti-dsDNA, anti-ssDNA, anti-cromatina, y los anticuerpos anti-RBC 9. Con el tiempo, los ratones receptores desarrollan glomerulonefritis asociada con depósitos de IgG en el glomerular, intersticial, y regiones vasculares de los riñones 10. Recientemente hemos demostrado que, similar a la enfermedad humana, también hay un papel crítico para la IFN de tipo I en este modelo 11. En particular, los criterios que definen para SLE humano incluyen el desarrollo de nefritis compatible con SLE ​​en presencia de anticuerpos anti-dsDNA 12, ambos de los cuales son características prominentes de este modelo de ratón.

Hay seVeral ventajas del modelo BM12 en los modelos espontáneos. Los modelos clásicos que se desarrollan signos-LES como espontáneamente se basan en cualquiera de las cepas de ratón híbridos, cepas puras ratón no en el fondo B6, o grande loci genéticos en el fondo B6, que hacen que cruzan a octavos de final, o de lo contrario los ratones modificados genéticamente difícil y lleva mucho tiempo. Con el modelo inducible BM12, los ratones modificados genéticamente pueden servir ya sea como el donante o el receptor, lo que permite más rápida identificación del compartimento celular en el que genes en particular puede ser importante para la enfermedad. Además, el desarrollo de la enfermedad en el modelo BM12 es mucho más rápido, que requiere sólo 2 semanas hasta la aparición de ANA, en comparación con varios meses para los modelos más espontáneas. Además, en contraste con los modelos espontáneos que se desarrollan la enfermedad en diferentes puntos de tiempo, el inicio de la enfermedad y la progresión en el modelo B6 BM12 → es altamente sincronizadas. Esto permite la generación de cohortes de tamaño apropiado que se be utiliza para estrategias de intervención o terapéuticos en cualquier etapa del desarrollo de la enfermedad.

Lo que sigue es un protocolo detallado para iniciar-LES como autoinmunidad por la transferencia adoptiva de linfocitos BM12, los cuales en ratones C57BL / 6, o variantes genéticas en el fondo B6. Además, se describe un protocolo de tinción de citometría de flujo para enumerar Tfh, las células B GC, y los tipos de células células plasmáticas asociadas con la enfermedad humana. Es importante destacar que estos protocolos también pueden ser utilizados para caracterizar la enfermedad en la mayoría de los modelos de ratón de SLE e identificar Tfh, las células B GC y células plasmáticas en otros modelos de enfermedad.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Trabajo con animales se realizó en condiciones libres de patógenos específicos, de acuerdo con las directrices establecidas por la Asociación para la Evaluación y Acreditación de Laboratorio Animal Care International y nuestra Institucional Cuidado de Animales y el empleo Comisión (IACUC).

NOTA: Incorporar los ratones que expresan un marcador congenic como CD45.1 a cada donante o animales receptores, si es posible, ya que esto permite la monitorización de la eficiencia de injerto donante y ampliación específica del donante población de células T CD4. Si está considerando el uso de ratones modificados genéticamente, como lo contrario de donantes o receptores, garantizar la cepa se backcrossed correctamente al fondo B6, o se tratará con mayor detalle en los resultados representativos y secciones de discusión células transferidas puede ser este rechazó.

NOTA: Los siguientes procedimientos volúmenes de detalle para la cosecha 4 donantes BM12 ratones, que debe producir suficientes células para inyectar 12-16 ratones. Seisa doce ratones BM12, los cuales semanas de edad dió aproximadamente 100-140 million linfocitos con aproximadamente 25% de células T CD4. Si a partir de un número diferente de los ratones, o diferentes cepas de ratón, los volúmenes de escala hacia arriba o hacia abajo en consecuencia. C57BL / 6 ratones generalmente dan rendimientos similares con más cerca de sólo el 20% las células T CD4.

NOTA: Realice todos los pasos a temperatura ambiente y el uso de los medios de comunicación RT para evitar el calor y el frío de choque, lo que puede poner en peligro la viabilidad de los linfocitos a largo plazo. Realizar tejido-cosecha y los pasos de procesamiento de tejidos en una campana de cultivo de tejidos utilizando una técnica aséptica. Todos los medios de comunicación en este protocolo es IMDM con 10% de SFB, a menos que se indique lo contrario, y será denominado simplemente inactivado por calor "medio completo".

1. Novela Método de Genotipado BM12 Ratones

NOTA: Un protocolo de restricción breve basada en la digestión para el genotipado se ofrece aquí, como una alternativa sencilla y barata de secuenciación, que es actualmente el único método de genotipificación publicadapara estos ratones.

  1. Aislar el ADN genómico de colas de ratón. Por favor, consulte a un artículo JoVe anterior para los protocolos detallados en el recorte de la cola del ratón y la generación de cDNA a partir de la cola digiere 13.
  2. Realizar una reacción en cadena polimerizada con transcriptasa inversa (PCR) 14 para amplificar un fragmento de ADN común 474 pb de MHC-II IA IA b y BM12 usando cebadores y condiciones de termociclado enumerados en la Tabla 1.
  3. Realice digestión de restricción en ~ 7 l del producto de PCR utilizando la enzima PsuI, o uno de sus isoesquizómeros (BstX2I, BstYI, MflI o XhoII), que corta tipo salvaje IA b, pero no IA BM12 mutante. Siga digerir protocolo proporcionado por el fabricante, que especificará una mezcla de agua, tampón y enzima, y ​​una incubación de 5 min. a varias horas a 37 ° C 15.
  4. Cargar digerir producto y ejecutar en 1% en gel de poliacrilamida con bromuro de etidio 14 durante 30-45 min. a 150V, aunque los valores óptimos de voltaje y de tiempo variarán dependiendo del aparato de gel de PCR utilizado. Visualizar bandas de ADN con un iluminador de UV. Los resultados representativos se muestran en la Figura 1.

Figura 1
Figura 1. Representante BM12 genotipo resultados.
Para identificar los ratones homocigotos para IA BM12 / BM12, el ADN de la cola se proyectó para BM12 por PCR / digestión de restricción genotipado (Paso 1). Tipo salvaje homocigotos (IA b / b) ADN produce dos bandas de 227 y 247 pb (visualizado como una banda gruesa en ~ 250 pb); BM12 homocigotos (IA BM12 / BM12) rendimientos de ADN una banda a 474 pb; y heterocigóticos (IA BM12 / b) ADN produce dos bandas a ~ 250 y 474 pb. Por favor haga clic aquí para ver una versión más grande de esta figura.

Donantes 2. CosecharLas células

  1. Ratones donantes Sacrificio utilizando Institucional Cuidado de Animales y el empleo Comisión (IACUC) -aprobada métodos de eutanasia de primaria y secundaria. Por ejemplo, la eutanasia a los ratones por asfixia con CO 2 seguido por dislocación cervical.
  2. Utilizando una técnica aséptica, bazos de cosecha y de los ganglios linfáticos (cervical superficial, mandibular, braquial, axilar, mesentérica, e inguinales) en tubos de 15 ml que contienen 10 ml de medio completo como en 11-13.
    NOTA: Consulte los informes anteriores para los protocolos de disección de ganglios linfáticos detallada 16 - 18. Este modelo también tiene éxito usando sólo esplenocitos de ratón para la transferencia, pero la adición de los ganglios linfáticos reduce significativamente el número requerido de ratones donantes.
  3. Generar una suspensión de una sola célula por maceración tejidos linfoides recogidos en el paso 2.2 a través de 70 micras coladores celulares utilizando el émbolo de una jeringa. Para obtener mejores rendimientos, no sobrecargue los coladores de uso ~ 6 coladores por cada 4ratones procesada, y enjuagar los coladores con frecuencia al procesar. Combinar los tejidos de 4 ratones en dos tubos cónicos de 50 ml, a continuación, centrifugar las células durante 5 min a 400 xg y decantar el sobrenadante.
  4. Resuspender las células de ambos tubos cónicos de 50 ml de medio completo y traslado al nuevo tubo cónico. Mantenga este tubo a temperatura ambiente.
    NOTA: La grasa se adhiere a los lados del tubo, y si el tubo no se sustituye, los rendimientos celulares finales puede sufrir.

3. Donantes Recuento celular

NOTA: Para preservar la lisis mayor viabilidad, de glóbulos rojos (RBC) de toda la muestra, no se recomienda.

  1. Mezclar suspensión de células individuales desde el paso 2.4 así, quite 1 ml y transferirlo a un cónico de 50 ml separado. Set restante a un lado, las células intactas (49 ml) a temperatura ambiente mientras cuenta.
  2. Añadir 3 ml de una sangre roja tampón de lisis celular basada en cloruro de amonio a la muestra de células 1 ml de donantes. Mezclar suavemente durante 1 min. oscilando, luego llenar hasta 50 ml con medio completo, unnd centrifugar durante 5 min. a 400 xg y el sobrenadante decante.
  3. Resuspender las células de glóbulos rojos se lisaron en 10 ml de medio completo y recuento (por ejemplo, con azul de tripano usando un hemocitómetro). Multiplicar el resultado por 49 que es el número total de células que permanecen en la muestra no lisadas que fue puesto a un lado. Células Descartar RBC lisada.

4. donante de la célula de etiquetado y / o CD4 T Purificación celular

  1. Si se desea, purificar las células T CD4 en esta etapa, aunque esto no es necesario. Además, si se desea, las células de la etiqueta con CFSE, como en 19, u otros colorantes de rastreo celular, un ejemplo del cual se muestra en la Figura 4 de la sección de resultados representativo.
    NOTA: Para la purificación de células T CD4, se recomienda la selección magnética negativa, ya que puede alcanzar una alta pureza y deja intactas las células con alta viabilidad como se describe en 20. Es importante que se utilizan tampones libres de endotoxina; Por lo tanto, en lugar de BSA, hacer la separación ingenio búferh 2% de FBS y la concentración recomendada de EDTA.

5. La inyección de células donantes BM12, los cuales

  1. Después de contar los linfocitos del donante en el paso 3 (y purificada o etiquetado como en el paso 4, según se desee), las células de centrifugación durante 5 min a 400 x g. Decantar células sobrenadante y resuspender en PBS a 120 millones de linfocitos por ml (o 30 millones de células CD4 T purificadas por ml). La transferencia de células a un tubo estéril de 5 ml de fondo redondo, u otro tubo estéril que se adapta fácilmente a una jeringa de 1 ml, equipado con un 27,5 G mm aguja x 13.
  2. Antes de la inyección, a un lado una pequeña muestra de células del donante desde el paso 5.1 a 4 ° C para la tinción de flujo para determinar el porcentaje de células T CD4 dentro de las muestras de los donantes. Tinción de estas muestras como se describe en el Paso 8 usando el panel de anticuerpos mínimo (Tabla 2).
    NOTA: Si las células de diferentes cepas de ratón se utilizan como donantes separados, esto es una consideración importante, y si porcentajes de células T CD4 varían sustancialmente, purficación puede ser requerida.
  3. Mezclar suavemente las células, pero a fondo. Esto se puede hacer pipeteando las células arriba y hacia abajo utilizando una jeringa de 1 ml sin aguja. Después de mezclar, dibujar células en la jeringa de 1 ml. Adjuntar aguja después de la eliminación de las burbujas de aire. Mantener la aguja de la jeringa mientras cebado ayuda a mantener la viabilidad celular.
  4. Inyectar 250 l por ratón (que es igual a 30 millones de linfocitos, o 7,5 millones de células CD4 T purificadas por ratón) por vía intraperitoneal, como se describe en 21.
    NOTA: En los experimentos que se muestran aquí y en nuestro trabajo previo 11, cada ratón se inyecta con 30 millones de linfocitos totales de BM12, los cuales los donantes, en lugar de los 100 millones de esplenocitos totales utilizados tradicionalmente. En los datos no publicados de nuestro laboratorio, no se observaron diferencias en el suero anti-dsDNA a los 14 días después de las inyecciones de 30 o 100 millones de linfocitos por ratón. Si bien esto reduce significativamente el número de ratones necesarios para los experimentos, el desarrollo de nefritis ingenioh este número de células no ha sido evaluada.

6. Determinar eficiencia de injerto

NOTA 1: En esta sección se describe cómo determinar el grado de injerto de células del donante en el receptor en el día 3 con el fin de identificar cualquier ratones que pueden haber recibido inyecciones subóptimos (por ejemplo, el injerto en un ratón es <10% de la observada en todos los otros ratones del mismo grupo). Estos datos también pueden ayudar a determinar si las células de una cepa de ratón modificado genéticamente son rechazados en los puntos de tiempo posteriores (para más detalles, véase la sección de resultados representativos, Figura 6).

NOTA 2: Esta sección sólo es posible si los donantes y los receptores son de los ratones en diversos fondos congénicos, por ejemplo, cuando se utilizan donantes CD45.1 BM12, los cuales y CD45.2 C57BL / 6 destinatarios, o cuando las células del donante se etiquetan con un tinte de células de seguimiento. Es importante destacar que, a los 3 días después de la inyección, las células T CD4 han experimentado una expansión mínima (SEe la sección representativa resultados, la figura 4), ​​por lo que las diferencias observadas en el grado de injerto son debido a la variabilidad en las inyecciones, no de expansión.

  1. Anestesiar ratones con 4% de isoflurano o cualquier otro método aprobado por el IACUC. Pon a prueba los reflejos del pie trasero para asegurar ratón se anestesiados adecuadamente antes de proceder a la extracción de sangre.
  2. Cosecha 100-200 l de sangre usando un método aprobado por el IACUC, como la punción retro-orbital como en 22. Recoger la sangre en tubos de microcentrífuga de 0,5 ml individuales que contienen un anti-coagulante, tales como los tubos de recogida de plasma que se hace referencia en la tabla de materiales, que contienen EDTA dipotásico liofilizado. Después de la extracción de sangre, aplique una leve presión sobre el ojo del ratón usando una toalla o gasa estéril para asegurar el sangrado se detenga, a continuación, coloque el ratón de nuevo en su jaula donde permanecerá hasta la cosecha final de tejido (Paso 7).
    NOTA: No deje sin vigilancia hasta que los ratones ratones han recuperado el conocimiento suficiente paramantener decúbito ventral, y no vuelva a ratones para la compañía de los demás hasta que se recupere totalmente.
  3. Llevar el volumen de sangre a 500 l con 21 ° C PBS y transferir al tubo de microcentrífuga cónica inferior, entonces subyacer lentamente 200 l de solución de separación de células de alta densidad C 21 ° con un 200 l pipeta, teniendo cuidado de minimizar la mezcla entre las dos fases ( véase la Tabla de Materiales para las soluciones recomendadas). Células centrifugar a 700 xg durante 20 minutos a 20-25 ° C con freno centrífuga ajustado en baja.
  4. Quite la capa superior que contiene linfocitos con una pipeta de 1 ml y la transferencia a un nuevo tubo de microcentrífuga que contiene 800 l medio completo frío. Vórtice suavemente para mezclar las células. Las células se centrifuga a 700 g durante 5 min a 4 ° C y el sobrenadante decante.
  5. Resuspender las células en 200 l de medios de comunicación completa, transferencia a una placa de 96 pocillos de fondo en U, y las manchas de citometría de flujo como se describe en el Paso 8 utilizando un panel de anticuerpos mínimo (Tabla 2) para determinar tél abundancia relativa del injerto de células T CD4 como un porcentaje de PBMCs.

7. final del tejido de la cosecha

NOTA: Los experimentos descritos en la sección de resultados se cosecharon 14 días después de la inyección de las células del donante (o en algunos casos menos de tiempo), ya que se centran en el desarrollo inicial de las células TFH y células plasmáticas; sin embargo, ya que este modelo es un modelo de EICH crónica del LES, la enfermedad se puede controlar a tantos puntos de tiempo posteriores. El marco de tiempo óptimo dependerá de la pregunta de investigación planteada en cada experimento individual.

  1. En un punto de tiempo predeterminado después de la inyección de BM12, los cuales las células del donante (paso 5.4), sacrificar los ratones usando un método de eutanasia aprobado por la IACUC. Se recomienda asfixia con CO 2 seguido por desangramiento. La dislocación cervical puede funcionar como un método secundario de la eutanasia, pero esto puede reducir el rendimiento de extracción de sangre.
  2. Moje el abdomen del ratón ligeramente con una botella de spray que contiene 70%etanol. Haga una incisión pequeña, superficial con tijeras quirúrgicas aproximadamente 1 cm por encima de los genitales. Tirar hacia atrás la piel del abdomen hacia el esternón, teniendo cuidado de mantener intacta la fascia peritoneal.
    NOTA: los ratones enfermos suelen presentar 0,5-3 ml ascitis en el día 14, que, a pesar de que aún no ha sido bien caracterizado, pueden ser medidos y analizados como un parámetro de la enfermedad adicional.
  3. Coloque una jeringa de 5 ml con una aguja de 18 G. Inserte la aguja en el cuadrante inferior derecho del abdomen con la aguja dirigida hacia la cabeza del animal y al 15 ° ángulo con el plano de la fascia. Coloque la punta de la aguja cerca del ciego para ayudar a prevenir que la aguja se obstruya con intestino mientras se aspira ascitis.
  4. Gire cuidadosamente el ratón sobre su lado, a continuación, dibuje lentamente ascitis en la jeringa. Una vez ascitis se ha recuperado, retire la jeringa y registrar el volumen aspirado, en base a los indicadores volumétricos en el lado de la syriENS.
  5. Ascitis descarga en un tubo de fondo redondo de 5 ml y almacenar en hielo para su posterior procesamiento.
  6. Cosecha de sangre a través de sorteo de la vena cava inferior (VCI) esencialmente como en el 22. El uso de pinzas embotadas, mover suavemente los intestinos hacia el lado izquierdo del ratón, el descubrimiento de la IVC. Inserte una aguja 27.5 G montado en una jeringa de 1 ml en la vena cava inferior y dibujar lentamente 400-500 l de sangre.
  7. Para minimizar la hemólisis, inyectar lentamente sangre en un tubo de microcentrífuga de 0,5 ml de suero o recogida de plasma. Para el análisis de suero después de ANA por ELISA, mantener la sangre en el hielo.
  8. Diseccionar y obtener tejidos pertinentes adicional (bazo y, si se desea, los ganglios linfáticos y en los riñones, en particular si la recogida en posteriores momentos de la hora y la glomerulonefritis se marcarán). Retirar el bazo colocando suavemente los intestinos de vuelta hacia el lado derecho del animal, y tirando del páncreas, que es el tejido conectivo primario del bazo.
  9. Retire el páncreas restante, entonces sopesarbazos en una balanza de alta precisión inmediatamente después de la disección, como esplenomegalia bruto es un parámetro comúnmente reportados en modelos de ratón de LES. Coloque los tejidos linfoides en individuales tubos de 1,5 ml con 1 ml llenas medio completo en hielo. Fijar riñones en 10% de formalina tamponada neutra o broche congelar los riñones para histología más tarde como en 23.
  10. Centrifugar la sangre dentro de 2 horas de la recolección durante 3 min. a 10.000 xg (4 ° C). Retire el suero y se almacena a -80 ° C para su posterior análisis de ANA por ELISA. Consulte los informes anteriores para los protocolos de ANA ELISA detallados 24,25. Suero tienda en múltiples 10-20 alícuotas para minimizar los ciclos de congelación / descongelación, y permitir que un mayor número de ensayos futuros.
  11. Centrifugar ascitis 400 xg durante 5 min. Eliminar el sobrenadante con una pipeta de 1 ml y en varias alícuota 0,5 ml tubos. Congelar sobrenadante a -80 ° C para los análisis posteriores de los anticuerpos anti-nucleares (ANA) u otros mediadores inflamatorios solubles.
  12. Fract celular Resuspender ION en aproximadamente 1 ml de medio completo y la transferencia de 200 l a una placa de 96 pocillos de fondo en U para la tinción de flujo (como en el paso 8).
  13. Mash cada bazo a través de 70 micras coladores de células en tubos separados y enjuague con medio completo. Resuspender esplenocitos con 1 ml de tampón de lisis RBC fría durante 1 min. y mezclar suavemente por balanceo. Llevar el volumen a 10 ml con medio completo frío y centrifugar durante 5 min a 400 xg y decantar el sobrenadante.
  14. Resuspender el sedimento celular en 5 ml de medio completo y recuento usando un hemocitómetro. Ajuste el volumen de tal manera que 200 l de medio completo contiene 1-3 millones de células. Comience la tinción para citometría de flujo (Paso 8) usando un panel extendido (Tabla 2) para cuantificar los donantes de células T CD4 y el receptor B diferenciación celular y la expansión.
    NOTA: Dependiendo de lo láser, combinaciones de tubo fotomultiplicador (PMT), y el conjunto de filtros están disponibles, que separa el panel de análisis de células T y B en múltiples paneles puede ser necesario.
ve_title "> 8. Flujo de tinción

  1. Transferencia de 1-3 millones de esplenocitos en 200 l en medio completo individuales tubos de 5 ml de fondo redondo, o en pocillos separados de una placa de 96 pocillos de fondo en U.
    NOTA: El uso de una placa de 96 pocillos es una forma eficaz para teñir múltiples muestras, pero tenga cuidado a la placa muestras en todos los demás y con el fin de prevenir la contaminación cruzada. Una placa de 96 pocillos en consecuencia puede almacenar 24 muestras.
  2. Placa Centrifugar a 500 xg durante 3 min., Entonces sobrenadante película de placa en su caso (riesgo biológico) contenedor.
  3. Resuspender los sedimentos celulares con 100 l de tampón de flujo (1% de FBS en PBS) que contienen un colorante de viabilidad se puede fijar a una concentración recomendada por el fabricante y purificado anti-CD16 / anti-CD32 cóctel de anticuerpos a 1 mg / ml. Incubar durante 10 minutos a 20-25 ° C, a continuación, añadir 100 l medio completo frío para saciar tinte viabilidad.
    NOTA: Los esplenocitos de los ratones enfermos por lo general contienen relativamente alto número de células muertas o moribundas;Por lo tanto, se recomienda la inclusión de un colorante de viabilidad para evitar el etiquetado de anticuerpos no específica de las células que mueren, dando como resultado, datos más fiables más limpios. Del mismo modo, el cóctel anti-CD16 / anti-CD32 se incluye para bloquear el anticuerpo marcado fluorescentemente unión no específica por los receptores Fc.
  4. Placa Centrifugar a 500 xg durante 3 min., Entonces sobrenadante película de la placa en un contenedor de riesgo biológico. Resuspender las células en 200 l de tampón de flujo. Placa Centrifugar a 500 xg durante 3 min., Entonces sobrenadante película de la placa en un contenedor de riesgo biológico.
  5. Resuspender las células en tampón de flujo de 50 l de cóctel que contiene anticuerpo (Tabla 2). Incubar durante 20 minutos a 4 ° C, a continuación, añadir 150 l buffer de flujo. Repita el paso de lavado 8.4.
  6. Resuspender las células con 100 l 2% de paraformaldehído en PBS. Incubar durante 30 minutos a 4 ° C, a continuación, añadir tampón flujo l 100. Placa Centrifugar a 500 xg durante 3 min., Entonces sobrenadante película de la placa en un contenedor de riesgo biológico.
  7. Resuspend en 200 l de tampón de flujo, transferir a fluir insertos de tubo o tubos de flujo estándar, agregue un búfer flujo 100-200 l adicional, y se almacena a 4 ° C en la oscuridad hasta la adquisición en citómetro de flujo.
  8. Adquirir en un citómetro de flujo equipado con los rayos láser y PMT apropiadas para los paneles de anticuerpos elegidos dentro de varios días de tinción. Record anchura de dispersión hacia adelante y / o la altura además que transmitan la zona de dispersión, área de dispersión lateral, y el área de los parámetros fluorescentes utilizados. Para obtener resultados fiables, adquirir ≥ 1000 células del donante en cada muestra WT, o un número equivalente de linfocitos totales en los ratones manipulados genéticamente modificados o de otro tipo que muestran una mínima expansión de las células del donante, donde la recolección de tantos eventos puede no ser factible.
    NOTA: La citometría de flujo análisis se describen en detalle en la sección de resultados representativo (Figuras 3 - 6).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Ratones enfermos desarrollan esplenomegalia en tan sólo 14 días, exhibiendo bazos 2-3 veces el tamaño de ratones sanos en términos de masa y celularidad (Figura 2).

Los esplenocitos se secuencialmente cerrada en dispersión de la luz (FSC-A por SSC-A), la eliminación de dobletes (FSC-W o -H por FSC-A), células viables (bajo tinción de colorante de viabilidad) y CD4 + TCRβ + (Figura 3A). Las células donantes se distinguen de las células receptoras con base en CD45.1 y CD45.2 (Figura 3B, abajo a la izquierda). Las células donantes adoptan predominantemente un ayudante T folicular (Tfh) fenotipo de células, tal como se caracteriza por la regulación al alza de PD-1, CXCR5, Bcl-6, y ICOS (Figura 3B, C). Una parte de la población de células CD4 receptor T también se diferencia en Tfh (Figura 3B, parte inferior derecha). Después de una mortandad inicial y / o migración de células transferidas, la expansión del donante derivado Tfh es logarítmica, reaching 10-20 millones de células en el bazo de los ratones 14 días después de la inyección (Figura 3D).

CFSE-etiquetado de los linfocitos transferidos demostró que los donantes de células T CD4 se diferencian en Tfh temprana después de la activación; esencialmente todas las células divididas observaron en los días 3, 7 y 14 upregulated CXCR5 y PD-1 (Figura 4). Los perfiles de picos proliferación también sugieren que un porcentaje relativamente bajo de donantes células T CD4 se sometió a alloactivation y la división. Por día 14, la mayor parte de las células del donante detectables son los que han dividido más allá del número máximo de divisiones mensurables mediante CFSE.

La expansión de los donantes derivados de Tfh está acompañado por una acumulación correspondiente de las células B GC endógeno y células plasmáticas (Figura 5A). La acumulación de células plasmáticas en el bazo se retrasa en comparación con la de Tfh, que no presenta aumento con respecto a los animales no tratados previamente en los días 3 o 7 (Figura 5B). Accordingly, los anticuerpos anti-nucleares no son fácilmente detectables antes del día 9 (datos no presentados), pero se pueden cuantificar de forma fiable en día 14 11.

Mediante el uso de marcadores congénicos, hemos observado rechazo de las células del donante en múltiples cepas. Mientras que esto es un problema común cuando los ratones no están suficientemente backcrossed a la C57BL / 6 de fondo, también se observó rechazo cuando las células BM12 se transfirieron a ratones B6.PL- Thy1 a / ​​CyJ (CD90.1) que se consideran generalmente para ser totalmente backcrossed. Por lo tanto, los ratones son rutinariamente en día ~ 3 por muestras de sangre de tinción de flujo para evaluar la eficiencia del injerto inicial de células CD4 T; sabemos por experimentos de proliferación CFSE que injertan las células se han expandido muy poco en este punto de tiempo temprano. Estos resultados se comparan con los resultados obtenidos de la cosecha día 14. En un caso ejemplo de rechazo, 30 millones de CD45.1 + linfocitos BM12, los cuales fueron trasladados en Cardif - / - Ratones que habían sido backcrossed a ratones C57BL / 6 durante 12 generaciones. En el día 5, todos los ratones muestran injerto equivalente (2-3% de las células T CD4 circulantes), pero el día 14, BM12, los cuales las células del donante fueron completamente eliminados del receptor modificado genéticamente (Figura 6).

Figura 2
Figura 2. cinética de crecimiento del bazo después de la inyección de los linfocitos BM12, los cuales. Bazos se pesaron en una balanza de alta precisión directamente después de la escisión (izquierda). Los números de células vivas se determinó por recuento con un hemocitómetro usando azul de tripano para excluir las células muertas (derecha). Los resultados se representan como media ± SEM, n = 9, 4, 3, y 6, respectivamente. Haga clic aquí para ver una versión más grande de esta figura.

jpg "/>
Figura 3. Análisis de la expansión de células T helper folicular en el modelo BM12 de SLE. CD45.1 + linfocitos BM12, los cuales se transfirieron a ratones C57BL / 6 destinatarios y bazos se analizaron 14 días después. (A) Estrategia gating Representante mostrando "linfocitos" (primer panel), "células individuales" (segundo panel), "células vivas" (tercer panel), y "células T CD4" (cuarto panel). (B) Las células donantes se distinguen de los receptores células T CD4 por CD45.1 y tinción CD45.2 y se analizaron para la expresión de PD-1 y CXCR5. Las células (C) donantes adoptan Tfh fenotipo, como se indica por la regulación al alza de varias proteínas comúnmente asociados con la Tfh. (D) Los resultados típicos que muestran la expansión de los donantes derivados Tfh (definido como PD-1 + células vivas CXCR5 + CD4 + CD45.1 +) en los días 3, 7 y 14 post transferencia. Los resultados se representan unas media ± SEM, n = 5, 4, 3, y 6, respectivamente. Haga clic aquí para ver una versión más grande de esta figura.

Figura 4
Figura 4. PD-1 y CXCR5 son upregulated en células en división. BM12 células fueron marcadas con CFSE antes de la inyección en ratones C57BL / 6 destinatarios. Parcelas de flujo representativos se muestran para los donantes de células T CD4 a los 3, 7 y 14 días después de la inyección. Por favor haga clic aquí para ver una versión más grande de esta figura.

Figura 5
Figura 5. La expansión de las células plasmáticas del bazo y las células B GC. (A) parcelas de flujo representativos de bazos de ratones no tratados previamente, o los delos ratones 14 días después CD45.1 + BM12 transferencia. Las células plasmáticas son definidos como CD138 + CD19 células vivas bajas (paneles superiores). GC células B son un subconjunto de células B CD19 +, que expresan (paneles inferiores) GL-7 y Fas. De datos (B) Quantitave que muestra la acumulación de células plasmáticas esplénicos con el tiempo. Los resultados se representan como media ± SEM, n = 5, 4, 3, y 6, respectivamente. Haga clic aquí para ver una versión más grande de esta figura.

Figura 6
Injertos Figura 6. BM12 son rechazadas por algunos ratones receptores modificados genéticamente. CD45.1 + linfocitos BM12, los cuales fueron trasladados en cualquiera de los ratones genéticamente modificados (paneles superiores) o / 6 (paneles inferiores) ratones receptores C57BL. Los ratones se sangraron a los 5 días después de la inyección y se evaluaron para la eficiencia del injerto. Esplenocitos de los mismos ratones se analizaron 14 días después. Por favor haga clic aquí para ver una versión más grande de esta figura.

Nombre Primer Secuencia (5 '- 3') El recocido de temperatura
Bm12F CGTGGTCCCCGCTGTCCCCC * 65 ° C
Bm12R GGGCAGAGGGCAGAGGTGAG
Segmento Número de ciclos La temperatura Duración
1 1 95 ° C 2 minutos.
2 40 95 ° C 15 seg.
* 65 a 0,5 ° C / paso 15 seg.
72 ° C 45 seg.
3 1 72 ° C 10 minutos.

Tabla 1:. Los cebadores y condiciones de termociclado para el genotipado BM12 Las condiciones óptimas de termociclado dependerá de los reactivos exactas y los instrumentos utilizados. Estas condiciones se han optimizado para un termociclador capaz de cambiar la temperatura de recocido a cada paso, aunque el protocolo también puede funcionar utilizando una temperatura de recocido estático.

Tabla 2
Tabla 2:. Paneles de anticuerpos para esplénica Tfh, GC B y la identificación de células plasmáticas por citometría de flujo Presentado son paneles que hemos utilizado con éxitopara evaluar la eficiencia de injerto en el día 3 (izquierda) y el análisis de células T y B en el día 14 después de la inyección de células BM12 (centro). Estos han sido optimizados para un LSRII con 5 láseres (355, 405, 488, 561, y 640 nm). Se enumeran los conjuntos de filtros recomendados para cada fluorocromo (derecha), aunque éstos pueden no ser la mejor opción para cada máquina. Dependiendo de lo láser, PMT y combinaciones de conjunto de filtros están disponibles, que separa el panel de análisis de células T y B en múltiples paneles puede ser necesario.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

El modelo inducible BM12 es una manera relativamente fácil y eficiente para estudiar los procesos celulares y moleculares de la LES. La activación crónica de las células T CD4 adoptivamente transferidas dirigidas contra antígenos propios conduce a la acumulación de Tfh, las células B GC, y las células plasmáticas que puede ser medida por citometría de flujo, tal como se describe aquí. Futuros estudios que utilizan este modelo de forma rápida y sencilla puede interrogar al papel de los genes candidatos y nuevas terapias en los procesos de los centros germinales autoinmunes que se asemejan a los que se producen en los pacientes con LES, y en última instancia rigen la acumulación patológica de autoanticuerpos. Además, el análisis de citometría de flujo descrito aquí puede ser usado para estudiar modelos de ratón adicionales que implican el desarrollo de inmunoglobulinas incluyendo, pero no limitado a la autoinmunidad, infección y alergia.

Como todos los modelos animales de enfermedades humanas, este modelo también tiene sus limitaciones. Dada la velocidad con la que desa enfermedadops y su magnitud, no todos los genes implicados en el desarrollo de SLE es probable que sean necesarias para la patogenicidad en este modelo. Además, se debe tener cuidado para descartar el rechazo del injerto cuando los datos sugieren una mínima expansión de Tfh en receptores genéticamente modificados. Congenic marcadores deben utilizarse para confirmar la presencia de células del donante en la cosecha sobre todo porque las células receptoras también pueden diferenciarse en Tfh (Figura 3B), que de otro modo podría enmascarar la ausencia de células del donante. Utilizando marcadores congénicos, se observó la eliminación completa de las células del donante que, evidentemente albergaban antígenos de rechazo por día 14 (Figura 6). Hemos utilizado con éxito CD45.1 + BM12, los cuales y CD45.2 + BM12, los cuales los ratones como donantes, y CD45.1 + BoyJ (B6.SJL- PTPRC un PEPC b / BoyJ) y CD45.2 + ratones C57BL / 6 como destinatarios (Figuras 3, 6, 7, y datos no publicados). Sin embargo, de tipo salvaje congenicCD90.1 + células de la B6.PL- Thy1 una cepa de ratón / CyJ no injertan así, ni + BM12, los cuales las células CD90.2 injerto bien en un CD90.1 + receptores (datos no publicados), un fenómeno que, evidentemente, no es única de este modelo 26.

Cualquiera de C57BL / 6 o BM12, los cuales los ratones pueden servir como el donante o el receptor, como se informó inicialmente por Morris et al. 9 Sin embargo, en nuestro laboratorio nos encontramos con la transferencia de células BM12, los cuales en ratones B6 produce la expansión más coherente de las células T y células B poblaciones en día 14. Además, donantes y receptores ratones de diferentes grupos deben ser de género y de la misma edad. Aunque los experimentos reportados en la primera descripción del modelo BM12 no encontraron diferencias significativas en ningún parámetro de la enfermedad entre hombres → masculinos y femeninos → transferencias femeninos 9, macho → transferencias femeninos no se aconseja, como antígeno masculino (HY) expresados ​​por las células T CD4 transferidos puede inducir REJE injertocción en los receptores de las mujeres 27.

Al elegir anticuerpos y fluorocromos para los marcadores congénicos, cabe señalar que las células donantes se convierten en positivas para el marcador de congenic receptor en diversos grados, de manera que una CD45.2 - puerta no constituiría todo el CD45.1 + injerto. El fenómeno se ilustra claramente en una comparación de expresión CD45.2 por receptores de células T CD4 (Figura 7) CD45.1 + ingenuo, CD45.1 + donantes y CD45.2 +. Notablemente, las células del donante también parecen regular positivamente la expresión de su propio marcador congenic, comparado con los controles no tratados (Figura 7). Resultados similares también se observan con CD45.2 + BM12 transferencia en ratones CD45.1 + BoyJ (datos no mostrados). Presumiblemente, la adquisición de los resultados de CD45 receptor de trogocitosis 28 por células T CD4 activados siguiente repitió interacciones con las células B destinatario. De hecho, el modo de BM12l puede resultar una herramienta útil en el estudio del proceso de trogocitosis in vivo.

Figura 7
Figura 7. Las células donantes adquieren receptor CD45 marcador congenic. CD45.1 + linfocitos BM12, los cuales fueron trasladados en CD45.2 + C57BL / 6 destinatarios. Donante, el receptor, e ingenuo (CD45.1 +) las células T CD4 son evaluados para CD45.1 y expresión CD45.2 14 días después de la transferencia. Haga clic aquí para ver una versión más grande de esta figura.

Se ha demostrado que la transferencia de células T CD4 BM12 purificados en ratones C57BL / 7 ratones es suficiente para iniciar la enfermedad 29; Sin embargo, la enfermedad equivalente se desarrolla cuando se transfieren los linfocitos enteros, y la purificación no se requiere necesariamente para estudiar la dependencia de la enfermedad en T ce-ll intrínseca expresión génica. Eisenberg y sus colegas, demostraron claramente que la célula productora de anticuerpos en el modelo BM12 es casi exclusivamente de origen receptor 30. Además, el requisito de receptores de células T CD4 10 se limita a la 'crianza' de las células B durante su desarrollo, que puede ser compensado por la adición exógena de IL-4 31, aunque nuestros datos indican que células T del receptor pueden participar tanto en la respuesta del centro germinal, como algunos de ellos lo hacen desarrollar un fenotipo Tfh (Figura 3B, abajo a la derecha).

Una decisión crítica que debe hacerse para cada experimento BM12 es cuándo cosechar tejidos para análisis. Por supuesto, la decisión depende de exactamente qué factores son importantes para el estudio actual, el cual puede variar. Los experimentos descritos aquí toman hasta 14 días, ya que se centran en el desarrollo inicial de las células TFH y células plasmáticas; sin embargo, ya que este modelo es una enfermedad crónicaModelo GVHD de SLE, enfermedad se puede controlar mucho más tiempo. De hecho, ciertas características clínicas del LES, incluyendo glomerulonefritis, desarrollar más tarde. La proteinuria se ha detectado tan pronto como 2 semanas después de la inyección, pero alcanza niveles máximos a las 4-8 semanas después de la inyección 10,31. Además, la citometría de flujo análisis descritos aquí han sido optimizados para experimentos que duran 2 semanas. Nos encontramos con un número considerable de células GC B y células plasmáticas en este punto en el tiempo; aunque, con el tiempo adicional, un gran porcentaje de células plasmáticas secretoras de ANA puede residir en la médula ósea 32. Por otra parte, las células plasmáticas identificadas por este panel tinción flujo probable también incluyen plasmablastos-con el fin de distinguir entre estos dos tipos de células, se necesitarían anticuerpos adicionales. Expansión Tfh presumiblemente alcanza un pico en algún momento después de la ventana de 14 días en los que nos hemos centrado. Sin embargo, hasta donde sabemos, ningún estudio ha reportado BM12 número de células de donantes más allá de 2 semanas, o el usod marcadores congénicos para rastrear células adoptiva transferidos.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
B6.SJL-Ptprca Pepcb/BoyJ The Jackson Laboratory 001162 CD45.1+ BoyJ mouse strain
B6(C)-H2-Ab1bm12/KhEgJ The Jackson Laboratory 001162 Bm12 mouse strain
FastDigest PsuI Life Technologies FD1554 Restriction digest enzyme for genotyping
1X RBC Lysis Buffer eBioscience 00-4333-57
IMDM GE Healthcare SH30228.01
Plasma Separation Tube (PST) BD 365974 Blood collection tube with Dipotassium EDTA
Serum Separation Tube (SST) BD 365967 Blood collection tube with Clot activator / SST Gel
Ficoll GE Healthcare 17-1440-02  High density cell separation solution
Lympholyte-M Cedarlane CL5030 High density cell separation solution
GL-7-biotin eBioscience 13-5902-82 
Streptavidin-BUV395 BD 564176
CD138-BV421 BioLegend 142508
CD4-BV510 BioLegend 100559
TCRβ-BV605 BD 562840
CD45.1-BV711 BioLegend 110739
CD45.2-FITC BioLegend 109806
PD-1-PE BioLegend 135206
CD19-PerCP BioLegend 115532
Fas-PE-Cy7 BD 557653
CXCR5-APC BioLegend 145506
Fixable Viability Dye ef780 eBioscience 65-0865-18
CD4-BV421 BioLegend 100443
1.2 ml FACS tube inserts, racked USA Scientific 1412-1400
BD Falcon™ Round-Bottom Tubes BD 352017

DOWNLOAD MATERIALS LIST

References

  1. Helmick, C. G., Felson, D. T., et al. Part I. Arthritis Rheum. Estimates of the prevalence of arthritis and other rheumatic conditions in the United States. 58, 15-25 (2008).
  2. Lupus Foundation of America Web Site. Available from: http://www.lupus.org/answers/entry/what-is-lupus (2015).
  3. Somers, E. C., Marder, W., et al. Population-based incidence and prevalence of systemic lupus erythematosus: The Michigan lupus epidemiology and surveillance program. Arthritis and Rheumatol. 66, 369-378 (2014).
  4. Perry, D., Sang, A., Yin, Y., Zheng, Y. -Y., Morel, L. Murine models of systemic lupus erythematosus. J Biomed Biotechnol. 2011, 271694 (2011).
  5. Lindholm, L., Rydberg, L., Strannegård, O. Development of host plasma cells during graft-versus-host reactions in mice. Eur J Immunol. 3, (8), 511-515 (1973).
  6. Fialkow, P. J., Gilchrist, C., Allison, A. C. Autoimmunity in chronic graft-versus-host disease. Clin Exp Immunol. 13, 479-486 (1973).
  7. Streilein, J. W., Stone, M. J., Duncan, W. R. Studies on the Specificity of Autoantibodies Produced in Systemic Graft-vs-Host Disease. J Immunol. 114, (1), 255-260 (1975).
  8. Gleichmann, E., Gleichmann, H. Diseases caused by reactions of T lymphocytes to in compatible structures of the major histocompatibility complex. I. Autoimmune hemolytic anemia. Eur J Immunol. 6, (12), 899 (1976).
  9. Morris, S., Cohen, P. L., Eisenberg, R. Experimental induction of systemic lupus erythematosus by recognition of foreign Ia. Clin Immunol Immunopathol. 57, (2), 263-273 (1990).
  10. Chen, F., Maldonado, M., Madaio, M., Eisenberg, R. The Role of Host (Endogenous) T Cells in Chronic Graft-Versus-Host Autoimmune Disease. J Immunol. 161, (11), 5880-5885 (1998).
  11. Klarquist, J., Hennies, C. M., Lehn, M. A., Reboulet, R. A., Feau, S., Janssen, E. M. STING-Mediated DNA Sensing Promotes Antitumor and Autoimmune Responses to Dying Cells. J Immunol. 193, 6124-6134 (2014).
  12. Petri, M., Orbai, A. -M., et al. Derivation and validation of systemic lupus international collaborating clinics classification criteria for systemic lupus erythematosus. Arthritis Rheum. 64, (8), 2677-2686 (2012).
  13. Zangala, T. Isolation of genomic DNA from mouse tails. J Vis Exp. (6), e246 (2007).
  14. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J Vis Exp. (63), e3998 (2012).
  15. Product information: Thermo Scientific FastDigest PsuI. Thermo Scientific. Available from: https://tools.lifetechnologies.com/content/sfs/manuals/MAN0012567_FastDigest_PsuI_UG.pdf (2012).
  16. Matheu, M. P., Parker, I., Cahalan, M. D. Dissection and 2-photon imaging of peripheral lymph nodes in mice. J Vis Exp. (7), e265 (2007).
  17. Harrell, M. I., Iritani, B. M., Ruddell, A. Lymph node mapping in the mouse. J Immunol Methods. 332, (1-2), 170-174 (2008).
  18. Covelli, V. Chapter 3, Internal examination. Guide to the necroscopy of the mouse. Available from: http://eulep.pdn.cam.ac.uk/Necropsy_of_the_Mouse/index.php?file=Chapter_3.html (2009).
  19. Quah, B. J. C., Parish, C. R. The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation. J Vis Exp. (44), e2259 (2010).
  20. Matheu, M. P., Cahalan, M. D. Isolation of CD4+ T cells from mouse lymph nodes using Miltenyi MACS purification. J Vis Exp. (9), e53319 (2007).
  21. Machholz, E., Mulder, G., Ruiz, C., Corning, B. F., Pritchett-Corning, K. R. Manual Restraint and Common Compound Administration Routes in Mice and Rats. J Vis Exp. (67), e2771 (2012).
  22. Hoff, J. Methods of Blood Collection in the Mouse. Lab Animal. 29, (10), 47-53 (2000).
  23. Cohen, M., Varki, N. M., Jankowski, M. D., Gagneux, P. Using Unfixed, Frozen Tissues to Study Natural Mucin Distribution. J Vis Exp. (67), e3928 (2012).
  24. Cohen, P. L., Maldonado, M. A. Animal models for SLE. Curr Protoc Immunol.. Chapter 15, Unit 15.20 (2003).
  25. Seavey, M. M., Lu, L. D., Stump, K. L. Animal models of systemic lupus erythematosus (SLE) and ex vivo assay design for drug discovery. Curr Protoc Pharmacol. Chapter 5, Unit 5 (2011).
  26. McKenna, K. C., Vicetti Miguel, R. D., Beatty, K. M., Bilonick, R. A. A caveat for T cell transfer studies: generation of cytotoxic anti-Thy1.2 antibodies in Thy1.1 congenic mice given Thy1.2+ tumors or T cells. J Leukoc Biol. 89, (2), 291-300 (2011).
  27. Scott, D. M., Ehrmann, I. E., et al. Identification of a mouse male-specific transplantation antigen H-Y. Nature. 376, 695-698 (1995).
  28. Joly, E., Hudrisier, D. What is trogocytosis and what is its purpose. Nat Immunol. 4, (9), 815 (2003).
  29. Brown, D. R., Calpe, S., et al. Cutting edge: an NK cell-independent role for Slamf4 in controlling humoral autoimmunity. J Immunol. 187, (1), 21-25 (2011).
  30. Morris, S. C., Cheek, R. L., Cohen, P. L., Eisenberg, R. A. Allotype-specific immunoregulation of autoantibody production by host B cells in chronic graft-versus host disease. J Immunol. 144, (3), 916-922 (1990).
  31. Choudhury, A., Cohen, P. L., Eisenberg, R. A. B cells require “nurturing” by CD4 T cells during development in order to respond in chronic graft-versus-host model of systemic lupus erythematosus. Clin Immunol. 136, (1), 105-115 (2010).
  32. Slifka, M. K., Antia, R., Whitmire, J. K., Ahmed, R. Humoral immunity due to long-lived plasma cells. Immunity. 8, (3), 363-372 (1998).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics