Isolamento do DNA robusto e construção de biblioteca de sequenciamento de alto rendimento para espécimes de herbário

* These authors contributed equally
Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Este artigo demonstra um protocolo detalhado para isolamento de DNA e construção de biblioteca de sequenciamento da elevado-produção de material de herbário, incluindo resgate de má qualidade excepcionalmente DNA.

Cite this Article

Copy Citation | Download Citations

Saeidi, S., McKain, M. R., Kellogg, E. A. Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens. J. Vis. Exp. (133), e56837, doi:10.3791/56837 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Herbários são uma fonte inestimável de materiais vegetais que podem ser usados em uma variedade de estudos biológicos. A utilização de espécimes de herbário é associada com um número de desafios, incluindo a qualidade de preservação de amostra, DNA degradado e amostragem destrutiva de espécimes raros. Para utilizar mais eficazmente o material de herbário em projetos de sequenciamento de grande, é necessário um método confiável e escalável de preparação de isolamento e biblioteca de DNA. Este artigo demonstra um protocolo robusto, início-a-ponta para DNA isolamento e elevado-throughput construção da biblioteca de amostras botânicas que não exige modificação para amostras individuais. Este protocolo é adaptado para planta baixa qualidade secada material e leva vantagem de métodos existentes através da otimização de moagem de tecido, modificando a seleção de tamanho de biblioteca e introduzindo um passo opcional reamplification para bibliotecas de baixo rendimento. Reamplification de bibliotecas de DNA de baixo rendimento pode salvar amostras provenientes de espécimes de herbário potencialmente valioso e insubstituível, eliminando a necessidade de amostragem destrutiva adicional e sem a introdução de viés de sequenciamento discernível para comum aplicações filogenéticas. O protocolo foi testado em centenas de espécies de gramíneas, mas é esperado para ser adaptável para o uso em outras linhagens de planta após verificação. Este protocolo pode ser limitado por DNA extremamente degradado, onde não existem fragmentos na faixa de tamanho desejado, e por metabólitos secundários presentes em alguns materiais vegetais que inibem limpo isolamento do DNA. Em geral, este protocolo introduz um método rápido e abrangente que permite o isolamento de DNA e preparação da biblioteca de 24 amostras em menos de 13 h, com apenas 8 h de tempo ativo de hands-on com modificações mínimas.

Introduction

Coleções de herbário são uma fonte potencialmente valiosa de espécies e diversidade genômica para estudos incluindo filogenética1,2,3, genética de populações4,5, conservação Biologia6, espécies invasoras biologia7e de evolução do traço8. A capacidade de obter uma rica diversidade de espécies, populações, localizações geográficas e pontos de tempo destaca o "tesouro"9 que é o herbário. Historicamente, a natureza degradada do herbário-derivada de ADN tem prejudicado projetos baseados em PCR, muitas vezes relegando pesquisadores usando apenas marcadores encontrados em cópia elevada, tais como regiões do genoma do cloroplasto ou do espaçador transcrito interno (ITS) do ribossômico RNA. Qualidade dos espécimes e DNA variam amplamente baseado em métodos de preservação9,10, com quebras de dupla-hélice e fragmentação do calor usado no processo de secagem, sendo as formas mais comuns de danos, criando o so-called 90% DNA de lock-up que tem hipotecada estudos baseados em PCR11. Além de fragmentação, a questão segundo mais prevalente no herbário genómica é contaminação, tais como que derivado de fungos endofíticos13 ou fungos adquiriram após a morte, após a colheita, mas antes de montar no herbário12, embora Este problema pode ser resolvido bioinformatically dado do banco de dados bem fúngico (veja abaixo). Um terceiro e menos comum, o problema é a modificação de sequência a citosina desaminação (C/G→T/A)14, embora estima estar baixa (~ 0,03%) em espécimes de herbário11. Com o advento do sequenciamento de alto rendimento (HTS), a questão da fragmentação pode ser superada com leituras curtas e sequenciamento profundidade12,15, permitindo a aquisição de dados de nível de genômica de numerosos espécimes com baixa qualidade DNA e por vezes mesmo permitindo de sequenciamento do genoma inteiro15.

Amostras de herbário são cada vez mais frequentemente utilizadas e são um componente maior de projetos filogenética16. Um desafio atual da utilização de espécimes de herbário para HTS é consistentemente a obtenção suficiente DNA encalhado dobro, uma condição prévia necessária para protocolos de sequenciamento, de inúmeras espécies em tempo hábil, sem a necessidade de otimizar métodos para indivíduo espécimes. Neste trabalho, um protocolo para extração de DNA e preparação da biblioteca de espécimes de herbário é demonstrado que tira proveito dos métodos existentes e modifica-los para permitir resultados rápidos e replicáveis. Este método permite a completo de processamento de amostra para uma biblioteca de 24 amostras em 13 h, com tempo de hands-on de 8 h, ou 16 h, com tempo de hands-on 9 h, quando a etapa opcional reamplification é necessária. Processamento simultâneo de mais amostras é viável, embora o fator limitante é centrífuga capacidade e habilidade técnica. O protocolo é projetado para exigir apenas típico equipamento de laboratório (thermocycler, centrífuga e suportes magnéticos) em vez de equipamentos especializados, tais como um nebulizador ou sonicador, para a tosquia de DNA.

Qualidade de DNA, tamanho do fragmento e a quantidade estão limitando fatores para a utilização de espécimes de herbário em experimentos de sequenciamento de alto rendimento. Outros métodos para isolar o DNA de herbário e criar bibliotecas de sequenciamento de alta produtividade têm demonstrado a utilidade de usar tão pouco quanto 10 ng de DNA16; no entanto eles exigem experimentalmente determinando o número ideal de PCR ciclos necessários para a preparação de biblioteca. Isso se torna impraticável quando lidar com quantidades extremamente pequenas de duplo viável encalhado DNA (dsDNA), como alguns espécimes de herbário produzem DNA apenas suficiente para uma preparação única biblioteca. O método aqui apresentado usa um único número de ciclos, independentemente da qualidade da amostra, para que nenhum DNA é perdido em passos de otimização de biblioteca. Em vez disso, um passo de reamplification é invocado quando bibliotecas não respeitem os valores mínimos necessários para sequenciamento. Muitas amostras de herbário são raras e possuem pouco material, tornando-se difícil justificar a amostragem destrutiva em muitos casos. Para combater isso, o protocolo apresentado permite dsDNA entrada tamanhos menos de 1.25 ng para o processo de preparação de biblioteca, ampliando o escopo das amostras viáveis para alta produtividade de sequenciamento e minimizando a necessidade de amostragem destrutiva de espécimes.

O protocolo seguinte foi otimizado para gramíneas e testado em centenas de espécies diferentes de amostras de herbário, embora esperamos que o protocolo pode ser aplicado a muitos outros grupos de plantas. Ele inclui uma etapa de recuperação opcional que pode ser usada para salvar a baixa qualidade e/ou espécimes raros. Este protocolo baseado em mais de 200 espécimes de herbário testados, funciona em espécimes com tecido baixa entrada e qualidade, permitindo a preservação de espécimes raros através de amostragem destrutiva mínima. Aqui é mostrado que este protocolo pode fornecer bibliotecas de alta qualidade que podem ser sequenciadas para projetos baseados em phylogenomics.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. antes de iniciar

  1. Fazer fresco cetyl trimetilamónio brometo (CTAB) reserva17 adicionando 20g de CTAB, 10 g de polivinilpirrolidona (PVP) 40, 100,0 mL 1 M Tris pH 8.0, 40 mL de pH 0,5 M de ácido (EDTA) de ácido etilenodiaminotetracético 8.0, 280,0 mL 5 M NaCl e 400,0 mL de água reagente juntos e trazer o volume total de 1 L com grau reagente água. Ajuste o pH para 8,0.
    Nota: Reagentes adicionais podem ser adicionados a CTAB dependendo de compostos secundários individuais dos táxons. Ver Allen et al 18 para obter uma lista completa de reagentes aditivos.
  2. Adicione 10 µ l de β-Mercaptoetanol por 5 mL de tampão CTAB.
    Nota: isso pode ser preparado em lotes de 50 mL e armazenado à temperatura ambiente por 3 – 4 semanas.
    1. Aquece a solução CTAB num banho de água de 65 ° C.
  3. Fica frio, morteiros e macacos em-20 ° C pelo menos 20 min.
  4. 4 conjuntos de 2 x n 2 mL de tubos de rotular (onde n = número de amostras). Colocar 1 jogo dos tubos etiquetados no gelo.
  5. Fica frio isopropanol no gelo ou em um freezer-20 ° C.
  6. Remover contas de imobilização reversível (SPRI) de fase sólida (ver Tabela de materiais) da geladeira e permitir-lhes equilibrar a temperatura ambiente (pelo menos 30 min).
  7. Prepare-se 80% de etanol.
  8. Selecionar amostras botânicas para extração e recuperar ~ 1 cm2ou 10 mg, de tecido por espécime, de preferência material da folha.

2. extração de DNA

  1. MOA ~ 1 cm2 de tecido herbário pré-selecionadas usando macacos e morteiros prechilled. Adicione nitrogênio líquido e areia de 30 – 50 mg esterilizado. Triture até o tecido se transforma em pó fino.
    Nota: 10 mg ou mais tecido é desejável, mas menos também trabalhou em alguns casos. Uma vez que o nitrogênio líquido evapora, adicione mais conforme necessário até que tecido é totalmente moído. Um outro método comum para interromper as células e tecidos é o uso de um batedor do grânulo. No entanto, esse método foi encontrado para não funcionam bem para os espécimes utilizados nesses experimentos.
  2. Transferi o pó congelado para dois tubos de 2 mL (adicionar não mais da metade do volume do tubo). Adicione 600 µ l de solução CTAB quente a cada tubo e misture os tubos completamente por inversão e num Vortex.
    Nota: Desde que a quantidade e a qualidade do material de herbário é muitas vezes baixa, realizar o isolamento do DNA em duas repetições ajuda a obter rendimentos mais elevados.
  3. Incube as amostras em um banho de água de 65 ° C para 1-1.5 h, num Vortex cada 15 min.
  4. Centrifugar as amostras a 10.000 x g, durante 5 min. Transfira o sobrenadante para um novo conjunto de tubos etiquetados (~ 500 µ l). Descarte a pelota usando um procedimento padrão de eliminação não clorados.
  5. Adicionar 4 µ l de RNase-A (10 mg/mL) a cada tubo e misture por inversão ou pipetagem. Incube as amostras a 37 ° C em um banho de água ou bloco térmico por 15 min.
  6. Adicione um volume igual (~ 500 µ l) de uma mistura de álcool isoamílico: fenol: clorofórmio 25:24:1 uma vez que os tubos chegaram a temperatura ambiente. Misture bem, pipetando para cima e para baixo e/ou com inversão. Centrifuga os tubos a 12.000 x g durante 15 min. transferência a camada aquosa (camada superior) para um novo conjunto de tubos etiquetados (~ 400 µ l). Descarte a camada orgânica dentro de um contentor de resíduos clorado.
    Nota: Passo 2.6 pode ser repetido se esperam-se grandes quantidades de compostos secundários em planta.
  7. Adicione um volume igual (~ 400 µ l) de uma mistura de álcool de 24:1. o clorofórmio: isoamílico. Misture bem, pipetando para cima e para baixo e/ou com inversão. Centrifuga os tubos a 12.000 x g durante 15 min. transferência a camada aquosa (camada superior) para um novo conjunto de tubos prechilled, etiquetados (~ 300 µ l). Descarte a camada orgânica dentro de um contentor de resíduos clorado.
  8. Adicione um volume igual (~ 300 µ l) de isopropanol prechilled e 12 µ l de acetato de sódio 2,5 M para cada tubo. Incube as amostras a-20 º C por 30 a 60 min.
    Nota: Os tempos de incubação podem ser estendidos (até incubação durante a noite), mas a qualidade de DNA irá diminuir quanto mais incubam as amostras.
  9. Leve as amostras fora do congelador e centrifugar os tubos a 12.000 x g, durante 15 min. remover e descartar o sobrenadante, suavemente, sem perturbar o sedimento. Lave o pellet por suspensão com etanol a 70% fresco (aproximadamente 300 – 500 µ l). Para cada amostra duplicada, consolide as duas pastilhas individuais em um com acompanhamento de etanol.
    Nota: As amostras devem ser consolidadas em um tubo utilizando etanol primeiro e prossiga. Não é necessário lavar cada amostra com etanol separadamente.
  10. Centrifugar os tubos a 12.000 x g por 10 min. remover e descartar o sobrenadante, suavemente, sem perturbar o sedimento. Ar seco as pelotas.
    Nota: As amostras podem ser secadas mais rápido usando um bloco de calor seco (não exceda 65 ° C). Certifique-se que as amostras não seque em demasiado, como isso pode diminuir o rendimento final do DNA.
  11. Suspenda o DNA isolado em 50 µ l de TE 1x. Armazenar em freezer-20 ° C para armazenamento a longo prazo ou a 4 ° C, para uso na semana seguinte.

3. controle de qualidade (QC)

  1. Execute um gel de agarose para verificação de qualidade.
    1. Prepare um buffer de Tris/borato/EDTA (TBE) 1x, acrescentando 54g Tris base, o ácido bórico 27,5 g e 3,75 g EDTA sal dissódico, trazendo o volume total de 5 L, usando água de grau reagente.
    2. Preparar um gel de agarose 1%, adicionando-se 1 g agarose para 100 mL de 1 x TBE. Microondas a solução até que nenhum agarose é visível. Adicionar 0,01% gel de ácido nucleico mancha (ver Tabela de materiais). Deixe arrefecer o balão até que está quente ao toque. Misture bem por agitação. Despeje uma bandeja de gel de agarose e deixe descansar até que ela se solidifica.
    3. Mix 3 µ l de amostra, 2 µ l de água de grau reagente e 1 µ l de 6 x tintura de carregamento. Carrega as amostras na matriz do gel, observando sua ordem.
    4. Execute os exemplos de 60 – 70 min a 60-70 V. imagem o gel sob luz UV com foco e exposição correta.
      Nota: A presença de uma banda clara de alto peso molecular é um sinal de DNA de alta qualidade, enquanto manchas geralmente indicam a degradação do DNA. A maioria dos espécimes de herbário são degradados.
  2. Executar uma análise de quantificação de dsDNA (consulte tabela de materiais) para determinar a quantidade de double encalhado DNA.
    1. Use 2 µ l de amostra para análise.
      Nota: As diluições não são necessários para a análise de quantificação de material de herbário como eles tendem a ser em quantidades mínimas. Bibliotecas bem sucedidas foram feitas de tão pouco como 1.26 ng dsDNA total desta etapa.

4. o DNA de corte

Nota: Esta é uma versão otimizada de um comercial fragmentase double-stranded protocolo (consulte Tabela de materiais).

  1. Enzima de fragmentação de dsDNA lugar no gelo após a utilização do Vortex para 3 s.
  2. Em um tubo de reação em cadeia (PCR) de polimerase estéril 0,2 mL, mistura 1 – 16 µ l isolado DNA com 2 µ l de tampão de reação de fragmentação de acompanhamento. Trazer o volume total de 18 µ l, adicionando água livre de nuclease. Adicionar 2 µ l da enzima de fragmentação dsDNA e vortex mistura por 3 s.
    Nota: A quantidade de DNA necessária varia dependendo da concentração de DNA (objectivo para 200 total ng no tubo).
  3. Incube as amostras a 37 ° C para 8,5 min. Em seguida, adicione 5 µ l de EDTA 0,5 M para os tubos.
    Nota: Este passo precisa ser executada assim que o período de incubação é sobre a encerrar a reação e impedir a excesso de corte de amostras de DNA.

5. grânulo limpar

  1. Homogeneizar os grânulos SPRI vortexing.
  2. Trazer o volume total do DNA cortado a 50 µ l, adicionando 25 µ l de água livre de nuclease. Adicione µ l 45 de grânulos SPRI temperatura (90% do volume) de 50 µ l de DNA cortado e a mistura completamente pipetando para cima e para baixo.
    Nota: Adicionar contas em 90% do volume total da amostra é feito para remover o menor dos fragmentos de ADN, muitas vezes abaixo de 200 pares de bases.
  3. Deixe as amostras incubam por 5 min. Coloque os tubos num prato magnético e deixe-os descansar por 5 min. cuidadosamente remover e descartar o sobrenadante.
    Nota: Tenha cuidado para não perturbar as contas, pois eles contêm os alvos de DNA desejados.
  4. Adicione 200 µ l de etanol fresco de 80% para os tubos enquanto estava no tribunal magnético. Incubar a temperatura ambiente por 30 s e então cuidadosamente remover e descartar o sobrenadante. Repita este passo uma vez. Ar seco os grânulos por 5 min, enquanto o tubo é a depor magnético com a tampa aberta.
    Nota: Evite ressecamento os grânulos. Isso pode resultar em menor recuperação de ADN.
  5. Retire os tubos do ímã. Eluir o DNA de grânulos em µ l 55 de 0.1 x et e homogeneiza pipetando para cima e para baixo. Incubar a temperatura ambiente por 5 min. tubos de lugar no stand magnético e esperar que a solução para transformar clara (~ 2 min).
  6. Tire 52 µ l do sobrenadante. Execute uma análise de quantificação de DNA em amostras para verificar a recuperação e a concentração inicial que entra na preparação de biblioteca.
    Nota: As bibliotecas foram feitas com total dsDNA, estima-se que menos de 1.25 ng, embora em cada caso reamplification era necessário.

6. Biblioteca preparação

Nota: Esta é uma versão modificada de um kit biblioteca comercialmente disponíveis (ver Tabela de materiais protocolo).

  1. Preparação final
    1. Adicione 3 µ l de endonuclease e fosfato seguindo as enzimas e 7 µ l de amortecedor da reação de acompanhamento de 50 µ l de DNA limpo, cortado. Homogeneiza pipetando para cima e para baixo. Gire os tubos para remover as bolhas.
      Nota: O volume total deve ser de 60 µ l.
    2. Colocar as amostras em um thermocycler com o seguinte programa: 30 min em 30 min a 65 ° C, 20 ° C, em seguida, mantenha a 4 ° C.
      Nota: A tampa aquecida foi definida como ≥75 ° C
  2. Adaptador de ligadura
    1. Diluir o adaptador dobra de 25 – 50 (trabalhando a concentração de adaptador de 0,6-0,3 µM). Adicione 30 µ l do mix de mestre da ligadura, 1 µ l de potenciador da ligadura e 2,5 µ l de adaptador para sequenciamento de leitura curto de alta produtividade para os tubos.
      Nota: O volume total deve ser 93,5 µ l.
    2. Homogeneiza pipetando para cima e para baixo. Gire os tubos para remover as bolhas. Incube os tubos a 20 ° C por 15 min.
    3. Adicione 3 µ l da mistura comercial de uracil DNA glycosylase (UDG) e o DNA glycosylase-liase Endonuclease VIII (ver Tabela de materiais) para os tubos. Certifique-se de que o volume total é 96,5 µ l. homogeneizar e incubar a 37 ° C por 15 min, usando um thermocycler.
      Nota: A tampa deve ser definida como ≥47 ° C. A versão original do protocolo comercial tem seleção de tamanho após a etapa de ligadura do adaptador, seguida de uma limpeza do grânulo como etapa final. Este protocolo, que alcança rendimentos mais elevados, alterna a ordem dessas etapas e implementa seleção de tamanho como uma etapa final.
  3. Limpeza para remover as enzimas e pequenos fragmentos
    1. Homogeneizar os grânulos magnéticos vortexing.
    2. Adicione µ l 78 de grânulos magnéticos de SPRI (80% do volume) e homogeneiza pipetando para cima e para baixo.
      Nota: Adicionar contas em 80% do volume total da amostra é feito para remover os fragmentos de DNA menores, que muitas vezes são inferiores a 250 pares de bases. A remoção mais rigorosa de pequenos fragmentos de DNA é (i) remover adaptadores excedentes e (ii) enfatizam a amplificação de fragmentos maiores nas etapas a seguir.
    3. Deixe que as amostras incubam durante 5 min. Coloque os tubos num prato magnético 5 min. Retire cuidadosamente e descartar o sobrenadante que contém o DNA fora do intervalo do tamanho desejado.
      Nota: Tenha cuidado para não perturbar os grânulos que contêm os alvos de DNA desejados.
    4. Adicione 200 µ l de etanol fresco de 80% para os tubos enquanto estava no tribunal magnético. Incubar a temperatura ambiente por 30 s e então cuidadosamente remover e descartar o sobrenadante. Repita este passo uma vez. Ar seco os grânulos por 5 min, enquanto o tubo é a depor magnético com a tampa aberta.
      Nota: Evite sobre os grânulos de secagem. Isso pode resultar em menor recuperação de ADN.
    5. Retire os tubos do ímã. Eluir o alvo do DNA da missanga adicionando 17 µ l de 0.1 x et e homogeneiza pipetando para cima e para baixo.
    6. Incubar a temperatura ambiente por 5 min. tubos de lugar no stand magnético e esperar que a solução para transformar clara (~ 2 min).
    7. Tire 15 µ l do sobrenadante.
  4. Amplificação por PCR
    1. Adicione 25 µ l de mistura mestre de PCR de alta fidelidade, 5 µ l do elevado-throughput curta leitura biblioteca prep 5' da primeira demão de sequenciamento e 5 µ l de sequenciamento de leitura curto elevado-throughput biblioteca prep 3' primer, a 15 µ l do DNA limpo adaptador-ligados.
      Nota: O volume Total deve ser 50 µ l.
    2. Misture bem por num Vortex. Colocar as amostras em um thermocycler usando as configurações encontradas na tabela 1: configuração de amplificação Thermocycler.
      Nota: Um grande número de ciclos é necessária devido a baixa quantidade de DNA de entrada.
Etapa do ciclo Temp. Tempo Ciclos de
Desnaturação inicial 98 ° C 30 s 1
Desnaturação 98 ° C 10 s 12
Recozimento/extensão 65 ° C 75 s 12
Extensão final 65 ° C 5 min 1
Segure 4 ° C

Tabela 1: protocolo de PCR desnaturação, recozimento e extensão de tempos e temperaturas. Temperatura e tempos foram otimizados para os reagentes apresentados no presente protocolo. Se os reagentes são alterados, temperaturas e tempos devem ser otimizados novamente.

  1. Seleção de tamanho para o tamanho desejado da biblioteca
    Nota: Este passo do grânulo irá remover fragmentos acima e abaixo da faixa alvo.
    1. Homogeneizar os grânulos SPRI vortexing.
    2. Adicione 25 µ l (50% do volume) dos grânulos magnético de temperatura ambiente e homogeneizar pipetando para cima e para baixo. Deixe as amostras incubam por 5 min. Coloque os tubos num prato magnético e deixe-os descansar por 5 min. cuidadosamente remover e transferir o sobrenadante para um novo conjunto de tubos etiquetados.
      Nota: Este volume pode ser ajustado com base no tamanho da biblioteca desejada. O sobrenadante contém fragmentos do ADN do tamanho desejado. Na primeira incubação de grânulo, os grânulos são vinculativas fragmentos maiores de biblioteca. Estes são removidos para focalizar aqueles na faixa de 400-600 pares de base. O sobrenadante contém fragmentos menores.
    3. Adicione 6 µ l de grânulos SPRI de temperatura para o sobrenadante e misture completamente pipetando para cima e para baixo. Deixe que as amostras incubam por 5 min. Coloque os tubos num prato magnético e deixe-os descansar por 5 min.
      Nota: Este volume pode ser ajustado com base no tamanho da biblioteca desejada nos termos passo 6.5.2.
    4. Cuidadosamente, remover e descartar o sobrenadante.
      Nota: Tenha cuidado para não perturbar os grânulos que contêm o DNA desejado. Na segunda incubação do grânulo, os grânulos são vinculativas para os fragmentos que deixou após a remoção inicial do DNA maior fragmentos. Este conjunto de fragmentos é geralmente na faixa de tamanho desejado.
    5. Adicione 200 µ l de etanol fresco de 80% para os tubos enquanto estava no tribunal magnético. Incubar a temperatura ambiente por 30 s, então cuidadosamente remover e descartar o sobrenadante. Repita. Ar seco os grânulos por 5 min, enquanto o tubo é a depor magnético com a tampa aberta.
      Nota: Evite ressecamento os grânulos. Isso pode resultar em menor recuperação de ADN.
    6. Retire os tubos do ímã. Eluir o alvo do DNA de grânulos em µ l 33 de 0.1 x et e homogeneiza pipetando para cima e para baixo.
    7. Incubar a temperatura ambiente por 5 min. tubos de lugar no stand magnético e esperar que a solução para transformar clara (~ 2 min). Retire 30 µ l do sobrenadante e transferência para tubos de 2 mL (ver Tabela de materiais) para armazenamento.
      Nota: As bibliotecas podem ser mantidas a-20 ˚ c para armazenamento a longo prazo.
  2. Controle de qualidade
    1. Faça um teste de controle de qualidade sobre as bibliotecas de DNA. Consulte os passos 3.1 e 3.2.
      Nota: Para bibliotecas de DNA, execute o gel para ~ 45 min em 96 V.
  3. Reamplification biblioteca: opcional, se a quantidade de biblioteca não é suficiente.
    Nota: Amostras com concentrações de biblioteca abaixo de 10 nM pode ser reamplified usando as seguintes etapas. Reamplification de bibliotecas de baixa concentração pode alcançar resultados praticáveis para sequenciamento, mas reamplification pode causar uma mudança modesta na diversidade de composição base, embora se reuniram dados (tabela 3) sugerem que isso é insignificante para determinadas métricas .
    1. Dilua os primers universal reamplification 10-fold usando 0.1 x TE.
    2. Adicione 25 µ l de mistura mestre de PCR de alta fidelidade, 5 µ l de primer reamplification universal diluído 1 (AATGATACGGCGACCACCGA) e 5 µ l de primer reamplification universal diluído (CAAGCAGAAGACGGCATACGA) de 2 a 15 µ l de bibliotecas de baixa concentração. Nota: O volume Total deve ser de 50 µ l.
    3. Misture bem por num Vortex. Colocar as amostras em um thermocycler usando as configurações encontradas na tabela 1: configuração de amplificação Thermocycler
      Nota: O grande número de ciclos é necessária devido à baixa quantidade de DNA de entrada.
    4. Limpeza do grânulo
    5. Homogeneizar os grânulos SPRI vortexing. Adicionar 45 µ l de grânulos SPRI temperatura (90% do volume) e homogeneiza pipetando para cima e para baixo.
    6. Deixe as amostras incubar durante 5 min. Coloque os tubos num prato magnético por 5 min.
    7. Retire cuidadosamente e descartar o sobrenadante que contém o DNA indesejado.
      Nota: Tenha cuidado para não perturbar os grânulos que contêm os alvos de DNA desejados.
    8. Adicione 200 µ l de etanol fresco de 80% para os tubos enquanto estava no tribunal magnético. Incubar a temperatura ambiente por 30 s e então cuidadosamente remover e descartar o sobrenadante. Repita este passo uma vez.
    9. Ar seco os grânulos por 5 min, enquanto o tubo é a depor magnético com a tampa aberta.
      Nota: Evite ressecamento os grânulos. Isso pode resultar em menor recuperação do alvo de DNA.
    10. Retire os tubos do ímã. Eluir o alvo do DNA de grânulos em µ l 33 de 0.1 x et e homogeneiza pipetando para cima e para baixo.
    11. Incubar a temperatura ambiente por 5 min. tubos de lugar no stand magnético e esperar que a solução para transformar clara (~ 2 min).
    12. Retire 30 µ l do sobrenadante. As bibliotecas podem ser armazenadas a-20 ° C para armazenamento a longo prazo.
  4. Controle de qualidade
    1. Faça um teste de controle de qualidade sobre as bibliotecas de DNA. Consulte os passos 3.1 e 3.2. Para bibliotecas de DNA, funcione o gel para ~ 45 min em 96 V.
      Nota: Se uma dupla banda é vista no gel, esta é provavelmente uma consequência do esgotamento da primeira demão da etapa reamplification. As bandas podem ser removidas por 6,9 de repetição, mas usando apenas um ciclo do programa de PCR descrita na tabela 1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Isolamento de DNA e o rendimento Final da biblioteca
Neste estudo, demonstrou-se a eficácia do protocolo para o isolamento do DNA de herbário e a recuperação das bibliotecas de sequenciamento de alta qualidade usando 50 amostras diferentes com os mais antigos de 1920 e o mais novo a partir de 2012 (tabela 2). Para cada amostra, cerca de 10 mg de tecido foliar foi usado para isolamento de DNA. Tecido de folha verde foi favorecido, se disponível, e não tecido, com evidente contaminação fúngica foi selecionado. Isolamentos de sucesso podem ser feitos usando tecido amarelo ou marrom, embora o rendimento deve ser esperado para ser menor. Duplo total encalhado DNA (dsDNA) do isolamento inicial variou de 3,56 ng para 2.610 ng. Como esperado, DNA obtido a partir de espécimes de herbário foi altamente degradada (figura 1A, suplementar , Figura 1). Uma parte desses isolamentos foram usados para a tosquia enzimática (GN 1.26 – 464). Apesar de herbário DNA já é cortado através do processo de preservação, otimização do protocolo requer tosquia adicionais para melhorar o rendimento global de biblioteca. A recuperação total do dsDNA pós-corte variou de < 1 a 51% da entrada dsDNA, resultando em um mínimo de menos de 1.25 ng de DNA de partida para a preparação de biblioteca e um máximo de 328 ng. A perda extrema em algumas amostras de DNA pode ser atribuída ao tamanho já pequeno fragmento de grande parte do DNA antes da enzimática corte (figura 1A, suplementar a Figura 1). O uso de uma limpeza de grânulo de 90% do volume no ADN distorcida propositadamente removido os menores fragmentos de DNA para enriquecer para tamanhos maiores, mais desejável do fragmento. Estes pequenos fragmentos foram especialmente vistos em amostras TK463, TK657 e TK694, como indicado por um sinal intenso na marca de 100 pares de base (figura 1A).

A quantidade total da seleção biblioteca post tamanho variou de 1.425 ng para 942.5 ng (tabela 2, suplementar a tabela 1). A preparação inicial de extração e biblioteca de 23 das amostras, não deu uma quantidade adequada de biblioteca (< 10 nM; Tabela 2, suplementar a tabela 1), então estas amostras foram submetidas às etapas de recuperação e reamplification do protocolo, resultando em um x 14 – 680 aumentar na biblioteca total (tabela 2, suplementar a tabela 1). Bibliotecas finais resultaram em uma banda entre 350 e 500 pares de base (figura 1B, suplementar a Figura 2). Às vezes, uma segunda banda que era maior que o tamanho esperado biblioteca foi vista (figura 1B, suplementar a Figura 2). Isto ocorreu quando a reamplification PCR exausto cartilhas disponíveis e começou o recozimento adaptadores biblioteca de fragmentos de DNA não-homólogos. Isso cria uma molécula onde as extremidades (os adaptadores de rede) foram devidamente recozimento, mas a inserção de DNA não. Esta molécula "bubbled" apareceu maior em um gel, enquanto se movia mais lentamente através da matriz do gel. Esses erros de recozimento foram fixados por preparando outra reação de reamplification da biblioteca já reamplified e executá-lo para um único ciclo. Este ciclo único fornecido cartilhas para recozimento adequada e amplificação, removendo a segunda banda (Supplemental Figura 3).

Reamplification de bibliotecas facilitou as concentrações finais de biblioteca de pelo menos 10 nM. Essas concentrações permitidas bibliotecas ser diluído para igual a molaridade e agrupado em igualdade de representação, ajudando a anular questões que teria surgido com a qualidade da amostra desiguais e sequenciamento de rendimento de biblioteca. Se o objetivo do projeto é o genoma do cloroplasto sequenciamento, então a quantidade total de sequenciamento necessário variará como diferentes linhagens e tecidos diferem quanto a porcentagem total de leituras que se originam de DNA de cloroplasto19. Normalmente, 50 – 100 x cobertura projetada do genoma do cloroplasto é suficiente para a montagem e sequenciamento é executado pode ser agrupado para incluir até 70 indivíduos, dependendo da espécie e método de sequenciamento.

Teste de contaminação, viés e variação causada por Reamplification
Uma notável preocupação para sequenciamento de HTS é a introdução de viés em bibliotecas através de extensa PCR amplificação20. Para testar os efeitos de reamplification e identificar potenciais aplicações em comum filogenéticas viés de material de herbário, comparamos uma biblioteca com êxito sequenciada (TK686) com a mesma biblioteca diluída 1:5 e reamplified (designado TK686-R). Ambos os TK686 e TK686-R foram sequenciados em um Illumina HiSeq4000 no centro de biotecnologia da Universidade de Illinois Roy J. Carver e o recurso de suporte de tecnologia do Michigan estado Universidade pesquisa, respectivamente, usar 150 pares de base final emparelhados lê (consulte Tabela 3 para obter detalhes de sequenciamento). -Primas leituras tenham sido depositadas em NCBI SRA (SRP128083). Leituras foram limpos usando Trimmomatic v.0.3621 , incluindo filtragem de adaptador usando NEB adaptador sequência, qualidade de filtragem para uma pontuação média de PQV de 20 para um par de base 10, deslizando a janela, e um mínimo corte tamanho de 40 pares de bases. Como um dos principais problemas com espécimes de herbário é contaminação fúngica, contaminação foi estimada pelo mapeamento leituras contra uma porção do JGI MycoCosm genoma fúngico de banco de dados22 (312 genomas nucleares e 79 genomas mitocondriais) usando o bowtie2 v . 2.2.923 usando o parâmetro "muito sensível-local" definido. TK686 e TK686-R bibliotecas eram indistinguíveis na contaminação fúngica nuclear (9,24% e 9.68%, respectivamente) e contaminação fúngica mitocondrial (0,94% e 0,8%) (Tabela 3). Que este é apenas um exemplo, ela sugere que a contaminação fúngica das amostras de herbário não é insignificante e deve ser removida antes de utilizar dados de sequência de herbário-derivado. O banco de dados e comandos usados para identificar e remover a contaminação fúngica podem ser encontrados no repositório GitHub de M. R. McKain herbário genómica24.

Sequenciamento de genoma do cloroplasto é comumente utilizado para análises filogenéticas, e espécimes de herbário são cada vez mais usados como material de fonte12. A fim de testar a fidelidade do reamplification na Assembleia de genoma do cloroplasto, genomas de cloroplasto para TK686 e TK686-R foram montadas com Fast-Plast v.1.2.525 sob as configurações padrão com o índice de bowtie definido como Poales. Obteve-se um genoma completo do cloroplasto para o TK686-R, mas o genoma do cloroplasto TK686 foi montado em sete contigs devido a baixa profundidade de leitura. Os TK686 contigs foram montados manualmente seguindo McKain et al 26 totalmente montados cloroplasto genomas foram alinhadas uns aos outros em um software de alinhamento baseado em GUI (ver Tabela de materiais) e a variação entre módulos (assemblies) foi avaliada. Um total de 12 SNPs e um indel foram identificados entre os conjuntos de cloroplasto de TK686 e TK686-R. Para cada variante, a cobertura foi avaliada em leitura de moda de TK686 e TK686-R. Em todos os casos, a variante mais comum era a mesma entre as duas bibliotecas. TK686 demonstrou um T→C, um G→A, um G→T, um G→-, um C→A, um T→A e quatro variantes C→A. Cinco dessas variantes ocorreu dentro de uma sequência de homopolímero, sugerindo que sua incorporação do assembly pode ter sido o resultado de erro de sequenciamento e baixa cobertura global. Os outros podem ter sido o resultado de variação de haplótipo do cloroplasto, erro de sequenciamento ou desaminação citosina, ou alguma combinação destes fatores. TK686-R teve um C→T, um G→T e um A→G. As variantes C→T e G→T foram encontradas em um homopolímero como acima. Em última análise, identificaram-se genomas idênticos cloroplasto completa de ambos os conjuntos de leitura. Um genoma único cloroplasto de TK686 foi anotado usando verdejante21 e em comparação com outros membros da tribo Andropogoneae. Todos os recursos padrão do cloroplasto foram anotados: 84 genes codificação de proteína, 38 tRNAs e 8 rRNAs. O genoma do cloroplasto completa está disponível do GenBank (MF170217) e verdejante27.

Potencial viés da reamplification das bibliotecas também foi determinada através da estimativa da % GC e o conteúdo total estimado transposon. Percentual GC foi estimada utilizando um script personalizado24. Diferenças de conteúdo GC das duas amostras foram negligenciáveis, com 49,7% GC em TK686 e 51,2% GC em TK686-R. Composição de Transposon foi estimada usando Transposome28. Para ambas as bibliotecas, 100.000 leituras foram aleatoriamente subsampled composição transposon foi estimada usando uma identidade por cento de 90, uma cobertura de fração de 0,55, um tamanho do cluster de 100 e a referência de repetição RepBase 21,10 grama conjunto29. Isso foi repetido 100 vezes para executar inicialização na estimativa de transposon partir esses conjuntos de dados. Percentagens do total do genoma para principais subfamílias de transposões foram extraídas de saída de Transposome, e a média e o desvio padrão desses para as 100 repetições foram estimados. Todos os scripts usados para gerar essas saídas podem ser encontrados no repositório Github de M. R. de McKain Transposons30, e todos os resultados tenham sido depositados em dríade (doi:10.5061/dryad.r8t2m). Usando as duas subfamílias mais prevalentes de transposon como indicadores (terminal longoCopia e cigano repetir retrotransposons), os resultados eram quase idênticos com Copia em 33,52 ± 4,00% e 31,68 ± 2,94% e cigano a 24.83 ± 2,72% e 24,00 ± 2,35% em TK686 e TK686-R, respectivamente (tabela 3). Os resultados dos testes sugerem que a etapa de reamplification do presente protocolo não criar preconceito de sequenciamento significativo para métricas de genoma de alto nível. No entanto, deve notar-se que este exemplo único não pode ser plenamente representativo de todas as bibliotecas de reamplified. Este teste simples demonstra que a etapa de reamplification não era inerentemente polarização métricas do genoma em TK686/TK686-R. Viés introduzido não afetaria a montagem de um genoma do cloroplasto dado cobertura suficiente de sequenciamento, mas é recomendável que as experiências, conforme apresentado neste estudo com TK686/TK686-R, são realizadas em linhagens de destino para verificar se o preconceito não é ocorrendo durante estudos investigando a diversidade de elemento transponíveis.

Figure 1
Figura 1: imagens de gel de Agarose da) isolamento de DNA e bibliotecas de sequenciamento B) final de dez espécimes de herbário. Para cada raia, utilizou-se a 3 µ l de DNA ou biblioteca. (A) DNA foi degradada em todos os isolamentos de herbário, como visto pela mancha geral. (B) bibliotecas de sequenciamento Final retratam uma banda principal de 300-500 pares de bases com uma distribuição mais ampla de 200-1.000 pares de bases; o último é mais prevalente em bibliotecas de reamplified. Pistas para ambos (A) e (B) foram identificados pela amostra e pode ser comparado com os resultados na tabela 2. Tamanho da escada foi retratado em pares de bases (bp). Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2 : Trama circular de Schizachyrium scoparium Genoma do cloroplasto (TK686) com anotação. O genoma totalmente montado de sequenciamento de espingarda de DNA derivado de herbário exibiu um comprimento total de 139.296 pares de bases (bp), uma região de grande cópia única (LSC) de 81.401 bp, uma região de repetição invertida (IR) de 22.669 bp e uma região pequena de cópia única (CCD) de 12.557 BP. Todos padrão genes codificantes de proteínas, os tRNAs e rRNAs por membros da tribo Andropogoneae foram identificados na anotação. Clique aqui para ver uma versão maior desta figura.

Tabela 2: Resultados de preparação extração e biblioteca de DNA para dez amostras de herbário e quatro bibliotecas reamplified. O total ADN encalhado dobro em diversas etapas no protocolo demonstrada qualidade como variável pode ser, especialmente quando filtrada para o tamanho. Clique aqui para baixar esta tabela.

Tabela 3: estatísticas de sequenciamento para TK686 e o TK686R reamplified. Reamplification não afeta a incidência global de contaminação fúngica do genoma, estimativa de conteúdo GC, estimativa de composição do transposon ou a capacidade de montar genomas toda cloroplasto. Clique aqui para baixar esta tabela.

Suplementar tabela 1: extração e biblioteca preparação de DNA para 40 amostras de herbário adicionais, incluindo vinte bibliotecas reamplified. Total ADN encalhado dobro em diversas etapas no protocolo demonstrada qualidade como variável pode ser, especialmente quando filtrada para o tamanho. Clique aqui para baixar esta tabela.

Suplementar Figura 1: imagens de gel de Agarose de quarenta isolamentos adicionais do DNA de amostras botânicas. Ambos (A) e (B) retratam os isolamentos de DNA separados vinte e demonstrar a degradação característica de DNA derivado de herbário. Para cada raia, utilizou-se a 3 µ l de DNA. Pistas para ambos (A) e (B) foram identificados pela amostra e pode ser comparado com os resultados no quadro suplementar 1. Tamanho da escada é retratado em pares de bases (bp). Branco manchas na imagem são devido a artefactos no tonalizador de gel que não pôde ser removido com a limpeza. Clique aqui para baixar esta figura.

Suplementar Figura 2: imagens de gel de Agarose de quarenta bibliotecas adicionais de sequenciamento de DNA derivado de herbário. Para cada raia, utilizou-se a 3 µ l de biblioteca. Bibliotecas final sequenciamento são encontradas em ambos os (A) e (B) com um tamanho médio de 300-500 pares de bases. Bandas secundárias vistas em algumas amostras amplificadas sugerem "borbulhando" das bibliotecas. Pistas para ambos (A) e (B) são identificados por amostra e pode ser comparado com os resultados no quadro suplementar 1. Tamanho da escada é retratado em pares de bases (bp). Clique aqui para baixar esta figura.

Suplementar Figura 3: imagem de gel de Agarose de remoção de banda secundário com um passo PCR de ciclo único adicionais. Clique aqui para baixar esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

O protocolo aqui apresentado é um método abrangente e robusto para isolamento de DNA e sequenciamento de preparação da biblioteca de amostras de planta seca. A consistência do método e necessidade mínima de alterá-lo baseado em amostra qualidade fazer escalável para projetos de sequenciamento de grande baseada no herbário. A inclusão de uma etapa opcional reamplification para baixo rendimento bibliotecas permite a inclusão de baixa qualidade, baixa quantidade, rara ou historicamente importantes amostras que não seriam apropriadas para o sequenciamento.

Importância do rendimento do ADN inicial
Herbário-derivada de ADN é frequentemente degradada em consequência da preservação espécime inicial11, com DNA de espécimes menos de 300 anos velho sendo tão degradado como DNA isolado de ossos de animais que são várias centenas de milhares de anos de idade31 , 32. consequentemente, otimização do rendimento inicial do ADN é vital na obtenção suficiente dsDNA de alta qualidade para a preparação de biblioteca de sequenciamento de sucesso. Para as espécies de grama, um rendimento ideal é conseguido através do uso combinado de areia esterilizada e nitrogênio líquido na moagem inicial passo, proporcionando uma mais profunda destruição das paredes celulares e liberação de ácidos nucleicos. Essa abordagem aumenta tanto desejável maior dsDNA e fragmentos menores indesejáveis (Figura 1, figura suplementar 1, tabela 2, suplementar a tabela 1). Etapas de limpeza subsequente do grânulo isolar e enriquecem por fragmentos de um tamanho adequado para sequenciamento (300-500 pares de bases), reduzindo a recuperação, mas também enriquecedor para mais fragmentos (tabela 2, suplementar a tabela 1). Alterações para os passos iniciais de isolamento de DNA podem ser necessárias com base na linhagem sendo amostrada para reduzir os efeitos dos metabólitos secundários em processamento a jusante18.

Otimização de adaptadores de biblioteca
A concentração de adaptadores utilizados para ligadura tem um efeito direto sobre a quantidade de dímero de adaptador em bibliotecas acabadas. Dímeros de adaptador resultam de ligadura auto adaptador quando houver amostra insuficiente e contaminam o sequenciamento execuções33. A relativamente baixa dsDNA total disponível a partir de espécimes de herbário exige diluição de adaptadores antes da ligadura. Adaptadores podem ser diluídas 50-fold resultantes da concentração das ações de 15 µM (consulte a Seção de protocolo) facilitar preparação de biblioteca de alta produtividade sem a necessidade de individualmente medir e diluir o adaptador para cada amostra (tabela 2, tabela suplementar de 1). embora a saturação de adaptadores poderia, em princípio, diminuir rendimento global biblioteca, é improvável que espécimes de herbário cederá dsDNA em tal excesso de adaptador.

Variação no grânulo de etapas de limpeza para rendimentos mais elevados
Seleção de tamanho na preparação das bibliotecas de sequenciamento é feita geralmente após a ligadura do adaptador, permitindo a amplificação de fragmentos principalmente dentro da escala do tamanho desejado; Isto é feito através da remoção de fragmentos maiores e menores que o tamanho do alvo. A baixa quantidade de dsDNA herbário-derivado para a preparação de biblioteca é agravada após a seleção de tamanho neste passo, resultando em baixa improdutivo dsDNA total e, finalmente, baixo rendimento na biblioteca final. Conduzindo um passo do grânulo-limpeza padrão usando contas de volume 90% depois da ligadura, mais dsDNA total permanece para enriquecimento na etapa de amplificação. Extremamente pequenos fragmentos de DNA são removidos preferencialmente usando 90% volume grânulos. Seleção de tamanho é realizada na etapa final na biblioteca de amplificado, o que garante o enriquecimento de tamanhos do fragmento desejado. Volumes totais de grânulos podem ser ajustados para selecionar o intervalo desejado, embora os volumes de duas etapas de 25 µ l e 6 µ l dos grânulos são otimizados para recuperar bibliotecas de inserções de 400-500 pares de base no âmbito do presente protocolo (figura 1B, complementar a Figura 2).

Resgate de amostra através de Reamplification de bibliotecas
Apesar das melhores práticas de isolamento de DNA e preparação de biblioteca, concentrações finais de bibliotecas de sequenciamento podem ser inadequadas para sequenciamento ainda mais. A natureza destrutiva da amostragem e muitas vezes limitado material descartável de espécimes de herbário não permite sempre repetindo o isolamento do DNA. Por amplificar a biblioteca até 12 ciclos adicionais de PCR, mesmo extremamente pobres bibliotecas podem ser salvos. Um par de primer padrão é usado para a amplificação, que é compatível com protocolos de qualquer biblioteca indexada dual ou single. A principal preocupação da reamplification é a introdução de viés, muitas vezes através da redução em porções de GC-ricos do genoma20. Usando um polymerase de alta-fidelidade (ver Tabela de materiais), estes potenciais vieses potencialmente são evitados. Isso é demonstrado através da variação mínima de conteúdo GC das bibliotecas sequenciados TK686 e TK686-R (tabela 3). Como uma segunda verificação, o conteúdo de transposon de TK686 e de TK686-R foi estimado e não mostrou nenhuma diferença discernível (tabela 3). Finalmente, o genoma do cloroplasto toda esta adesão foi montado a partir de TK686 e TK686-R, que resultou em sequências idênticas após uma inspeção rigorosa de variação de SNP entre os dois assemblies (Figura 2, tabela 3). Estes testes sugerem esse padrão genômica métricas, tais como conteúdo GC e composição de transposon e a capacidade de montar genomas completos cloroplasto, não podem ser afetados por reamplification. Isto abre a possibilidade de incorporando herbário espécimes pensado para ser demasiado degradados ou falta de material para estudos filogenéticas sem a preocupação de viés introduzido através do PCR. Essas bibliotecas reamplified também podem ser usadas para captura de sequência34, embora seja necessário testar se chamando de SNP é tendencioso. É recomendado que testes de pequena escala de preconceito sejam conduzidos com cada projeto para verificar que o preconceito não seja introduzido na bibliotecas de sequenciamento.

Limitações e possíveis modificações
Mesmo que este protocolo já trabalhou em centenas de espécimes de herbário, mal preservados os tecidos ainda podem falhar em qualquer etapa. É, no entanto, extremamente raro bibliotecas falhar de tecidos com sucesso extrações de DNA, especialmente depois do resgate da biblioteca através de reamplification. As etapas de seleção de tamanho podem ser modificadas para diferentes tamanhos de fragmentos de destino ou para reduzir a grande variedade de fragmentos visto em algumas bibliotecas finais. Como com todos os protocolos de extração vegetal, as etapas podem ser necessários para remover a linhagem-específicos compostos secundários que podem impedir o protocolo geral. Conforme apresentado, este protocolo fornece um método padrão para a preparação de biblioteca isolamento e elevado-throughput DNA para espécimes de herbário de grama e através da verificação e experimentação, é provável que seja alteráveis para outras linhagens da planta.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores declaram que eles têm não tem interesses concorrente.

Acknowledgments

Agradecemos a Taylor AuBuchon-Elder, Jordan Teisher e Kristina Zudock para assistência em espécimes de herbário de amostragem e o jardim botânico de Missouri para o acesso aos espécimes de herbário para amostragem destrutiva. Este trabalho foi apoio por um subsídio da Fundação Nacional de ciência (DEB-1457748).

Materials

Name Company Catalog Number Comments
Veriti Thermal Cycler Applied Biosystems 4452300 96 well 
Gel Imaging System Azure Biosystems c300
Microfuge 20 Series Beckman Coulter B30137
Digital Dry Bath Benchmark Scientific BSH1001
Electrophoresis System EasyCast B2
PURELAB flex 2 (Ultra pure water) ELGA  89204-092
DNA LoBind Tube  Eppendorf 30108078 2 ml
Mini centrifuge Fisher Scientific 12-006-901
Vortex-Genie 2 Fisher Scientific 12-812
Mortar Fisher Scientific S02591 porcelain
Pestle fisher Scientific S02595 porcelain
Centrifuge tubes fisher Scientific 21-403-161
Microwave Kenmore 405.7309231
Qubit Assay Tubes Invitrogen Q32856
0.2 ml Strip tube and Cap for PCR VWR 20170-004
Qubit 2.0 Fluorometer Invitrogen Q32866
Balance Mettler Toledo PM2000
Liquid Nitrogen Short-term Storage Nalgene F9401
Magnetic-Ring Stand  ThermoFisher Scientific  AM10050 96 well 
Water Bath VWR 89032-210
Hot Plate Stirrers VWR 97042-754
Liquid Nitrogen Airgas UN1977
1 X TE Buffer Ambion AM9849 pH 8.0
CTAB AMRESCO 0833-500G
2-MERCAPTOETHANOL AMRESCO 0482-200ML
Ribonuclease A AMRESCO E866-5ML 10 mg/ml solution
Agencourt AMPure XP Beckman Coulter A63882
Sodium Chloride bio WORLD 705744
Isopropyl Alcohol bio WORLD 40970004-1
Nuclease Free water bio WORLD 42300012-2
Isoamyl Alcohol Fisher Scientific A393-500
Sodium Acetate Trihydrate Fisher Scientific s608-500
LE Agarose GeneMate E-3120-500
100bp PLUS DNA Ladder Gold Biotechnology D003-500
EDTA, Disodium Salt IBI Scientific IB70182
Qubit dsDNA HS Assay Kit Life Technologies Q32854
TRIS MP Biomedicals 103133 ultra pure
Gel Loading Dye Purple (6 X) New England BioLabs B7024S
NEBNext dsDNA Fragmentase New England BioLabs M0348L
NEBNext Ultra II DNA Library Prep Kit for Illumina  New England BioLabs E7645L
NEBNext Multiplex Oligos for Illumina New England BioLabs E7600S Dual Index Primers Set 1
NEBNext Q5 Hot Start HiFi PCR Master Mix New England BioLabs M0543L
Mag-Bind RXNPure Plus Omega bio-tek M1386-02
GelRed 10000 X Pheonix Research 41003-1
Phenol solution SIGMA Life Science P4557-400ml
PVP40 SIGMA-Aldrich PVP40-50G
Chloroform VWR EM8.22265.2500
Ethanol Koptec V1016 200 Proof
Silica sand VWR 14808-60-7
Reamplification primers Integrated DNA Technologies see text
Sequencher v.5.0.1 GeneCodes

DOWNLOAD MATERIALS LIST

References

  1. Savolainen, V., Cuénoud, P., Spichiger, R., Martinez, M. D. P., Crèvecoeur, M., Manen, J. F. The use of herbarium specimens in DNA phylogenetics: Evaluation and improvement. Plant Syst Evo. 197, (1-4), 87-98 (1995).
  2. Zedane, L., Hong-Wa, C., Murienne, J., Jeziorski, C., Baldwin, B. G., Besnard, G. Museomics illuminate the history of an extinct, paleoendemic plant lineage (Hesperelaea, Oleaceae) known from an 1875 collection from Guadalupe Island, Mexico. Bio J Linn Soc. 117, (1), 44-57 (2016).
  3. Teisher, J. K., McKain, M. R., Schaal, B. A., Kellogg, E. A. Polyphyly of Arundinoideae (Poaceae) and Evolution of the Twisted Geniculate Lemma Awn. Ann Bot. (2017).
  4. Cozzolino, S., Cafasso, D., Pellegrino, G., Musacchio, A., Widmer, A. Genetic variation in time and space: the use of herbarium specimens to reconstruct patterns of genetic variation in the endangered orchid Anacamptis palustris. Conserv Gen. 8, (3), 629-639 (2007).
  5. Wandeler, P., Hoeck, P. E. A., Keller, L. F. Back to the future: museum specimens in population genetics. Tre Eco & Evo. 22, (12), 634-642 (2007).
  6. Rivers, M. C., Taylor, L., Brummitt, N. A., Meagher, T. R., Roberts, D. L., Lughadha, E. N. How many herbarium specimens are needed to detect threatened species? Bio Conserv. 144, (10), 2541-2547 (2011).
  7. Saltonstall, K. Cryptic invasion by a non-native genotype of the common reed, Phragmites australis, into North America. PNAS USA. 99, (4), 2445-2449 (2002).
  8. Besnard, G., et al. From museums to genomics: old herbarium specimens shed light on a C3 to C4 transition. J Exp Bot. 65, (22), 6711-6721 (2014).
  9. Särkinen, T., Staats, M., Richardson, J. E., Cowan, R. S., Bakker, F. T. How to open the treasure chest? Optimising DNA extraction from herbarium specimens. PLoS ONE. 7, (8), e43808 (2012).
  10. Harris, S. A. DNA analysis of tropical plant species: An assessment of different drying methods. Plant Syst Evo. 188, (1-2), 57-64 (1994).
  11. Staats, M., et al. DNA damage in plant herbarium tissue. PLoS ONE. 6, (12), e28448 (2011).
  12. Bakker, F. T., et al. Herbarium genomics: plastome sequence assembly from a range of herbarium specimens using an Iterative Organelle Genome Assembly pipeline. Bio J of the Linn Soc. 117, (1), 33-43 (2016).
  13. Camacho, F. J., Gernandt, D. S., Liston, A., Stone, J. K., Klein, A. S. Endophytic fungal DNA, the source of contamination in spruce needle DNA. Mol Eco. 6, (10), 983-987 (1997).
  14. Hofreiter, M., Jaenicke, V., Serre, D., Von Haeseler, A., Pääbo, S. DNA sequences from multiple amplifications reveal artifacts induced by cytosine deamination in ancient DNA. Nucl Acids Res. 29, (23), 4793-4799 (2001).
  15. Staats, M., et al. Genomic treasure troves: Complete genome sequencing of herbarium and insect museum specimens. PLoS ONE. 8, (7), e69189 (2013).
  16. Bakker, F. T. Herbarium genomics: skimming and plastomics from archival specimens. Webbia. 72, (1), 35-45 (2017).
  17. Doyle, J. J., Doyle, J. L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bul. 19, 11-15 (1987).
  18. Allen, G. C., Flores-Vergara, M. A., Krasynanski, S., Kumar, S., Thompson, W. F. A modified protocol for rapid DNA isolation from plant tissue using cetryltrimethylammonium bromide. Nat Prot. 1, 2320-2325 (2006).
  19. Twyford, A. D., Ness, R. D. Strategies for complete plastid genome seqeuncing. Mol Eco Resour. (2016).
  20. Aird, D., et al. Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries. Genome Bio. 12, (2), R18 (2011).
  21. Bolger, A. M., Lohse, M., Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinf. 30, 2114-2120 (2014).
  22. Grigoriev, I. V., et al. MycoCosm portal: gearing up for 1000 fungal genomes. Nucl Acids Res. 42, (1), D699-D704 (2014).
  23. Langmead, B., Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat Meth. 9, (4), 357-359 (2012).
  24. McKain, M. R. Herbarium Genomics. Github Repository https://github.com/mrmckain/ (2017).
  25. McKain, M. R., Wilson, M. A. Fast-Plast: Rapid de novo assembly and finishing for whole chloroplast genomes. Github Repository https://github.com/mrmckain/ (2017).
  26. McKain, M. R., McNeal, J. R., Kellar, P. R., Eguiarte, L. E., Pires, J. C., Leebens-Mack, J. Timing of rapid diversification and convergent origins of active pollination within Agavoideae (Asparagaceae). Am J Bot. 103, (10), 1717-1729 (2016).
  27. McKain, M. R., Hartsock, R. H., Wohl, M. M., Kellogg, E. A. Verdant: automated annotation, alignment, and phylogenetic analysis of whole chloroplast genomes. Bioinf. (2016).
  28. Staton, S. E., Burke, J. M. Transposome: A toolkit for annotation of transposable element families from unassembled sequence reads. Bioinf. 31, (11), 1827-1829 (2015).
  29. Bao, W., Kojima, K. K., Kohany, O. Repbase Update, a database of repetitive elements in eukaryotic genomes. Mobile DNA. 6, (1), 11 (2015).
  30. McKain, M. R. Transposons. Github Repository https://github.com/mrmckain/ (2017).
  31. Weiß, C. L., et al. Temporal patterns of damage and decay kinetics of DNA retrieved from plant herbarium specimens. Royal Soc Open Sci. 3, (6), 160239 (2016).
  32. Sawyer, S., Krause, J., Guschanski, K., Savolainen, V., Pääbo, S. Temporal patterns of nucleotide misincorporations and DNA fragmentation in ancient DNA. PLoS ONE. 7, (3), e34131 (2012).
  33. Head, S. R., et al. Library construction for next-generation sequencing: overviews and challenges. BioTechniques. 56, (2), 61-64 (2014).
  34. Grover, C. E., Salmon, A., Wendel, J. F. Targeted sequence capture as a powerful tool for evolutionary analysis. Am J Bot. 99, 312-319 (2012).

Comments

1 Comment

  1. Thanks for this video!

    Reply
    Posted by: Anony m.
    August 25, 2018 - 10:13 AM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics