Robust DNA isolering och hög genomströmning sekvensering bibliotek konstruktion för herbarieexemplar

* These authors contributed equally
Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Denna artikel visar ett detaljerat protokoll för DNA isolering och hög genomströmning sekvensering bibliotek konstruktion från herbarium material inklusive räddning av exceptionellt dålig kvalitet DNA.

Cite this Article

Copy Citation | Download Citations

Saeidi, S., McKain, M. R., Kellogg, E. A. Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens. J. Vis. Exp. (133), e56837, doi:10.3791/56837 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Herbaria är en ovärderlig källa av växtmaterial som kan användas i en mängd olika biologiska studier. Användning av herbarieexemplar associeras med ett antal utmaningar inklusive prov bevarande kvalitet, försämrat DNA och destruktiva provtagning av sällsynta exemplar. För att mer effektivt använda herbarium material i stora sekvensering projekt, behövs en tillförlitlig och skalbar metod av DNA isolering och bibliotek förberedelser. Detta papper visar ett robust, början till slut protokoll för DNA isolering och hög genomströmning bibliotek konstruktion från herbarieexemplar som inte kräver modifiering för enskilda prover. Detta protokoll är skräddarsydd för låg kvalitet torkade växten material och tar fördel av befintliga metoder genom att optimera vävnad slipning, ändra bibliotek storlek urval och att införa ett valfritt reamplification steg för låg avkastning bibliotek. Reamplification av låg avkastning DNA bibliotek kan rädda prover från oersättliga och potentiellt värdefulla herbarieexemplar förneka behovet av ytterligare destruktiva provtagning och utan att införa urskiljbar sekvensering bias för gemensamma Fylogenetiska tillämpningar. Protokollet har testats på hundratals gräsart, men förväntas vara anpassningsbar för användning i andra växt härstamningar efter kontroll. Detta protokoll kan begränsas genom extremt försämrat DNA, där fragment inte finns i intervallet önskad storlek, och sekundära metaboliter förekommer i vissa växtmaterial som hämmar rena DNA isolering. Övergripande, detta protokoll införs en snabb och omfattande metod som möjliggör för DNA isolering och bibliotek beredning av 24 prover i mindre än 13 h, med endast 8 h aktiv hands-on tid med minimala ändringar.

Introduction

Herbarium samlingar är en potentiellt värdefull källa till både arter och genomic mångfald för studier inklusive fylogenetik1,2,3, populationsgenetik4,5, bevarande biologi6, invasiva arter biologi7och drag evolution8. Möjligheten att få en rik mångfald av arter, populationer, geografiska platser och tidpunkter belyser ”skattkista”9 som är herbarium. Historiskt sett har försämrade beskaffenhet herbarium-derived DNA hindrat PCR-baserat projekt, ofta förvisa forskare att använda endast markörer i hög kopia, såsom regionerna kloroplast genomet eller interna transkriberas distanshylsan (ITS) av den ribosomal RNA. Kvaliteten på proven och DNA variera i stor utsträckning utifrån metoder för bevarande9,10, med dubbelsträngat raster och fragmentering från värmen används i torkningen är de vanligaste formerna av skador, skapar den så kallade 90% DNA lock-up som har pantsatta PCR-baserade studier11. Bortsett från fragmentering är den näst vanligaste frågan i herbarium genomik kontaminering, såsom som härrör från endophytic svampar13 eller svampar förvärvade efter döden efter samlingen men innan montering i herbarium12, dock problemet kan vara löst bioinformatically ges rätt svamp databasen (se nedan). En tredje, och mindre vanligt, problemet är sekvens ändring genom cytosin deaminering (C/G→T/A)14, även om det uppskattas vara låg (~ 0,03%) i herbarium exemplar11. Med tillkomsten av hög genomströmning sekvensering (HTS), kan frågan om fragmentering övervinnas med korta läsningar och sekvensering djup12,15, tillåter genomisk nivå datainsamling från talrika exemplar med låg kvalitet DNA, och ibland även tillåter hela genomet sekvensering15.

Herbarium prover blir oftare används och är en större del av fylogenetiska projekt16. En aktuell utmaning att använda herbarieexemplar för HTS konsekvent erhålla tillräcklig dubbel stranded DNA, en nödvändig förutsättning för sekvensering protokoll, från ett flertal arter i tid, utan att behöva optimera metoder för enskilda exemplaren. I detta papper demonstreras ett protokoll för DNA-extraktion och bibliotek beredning av herbarieexemplar som utnyttjar befintliga metoder och ändrar dem som möjliggör snabba och reproducerbara resultat. Denna metod möjliggör komplett bearbetning från prov till ett bibliotek med 24 prov i 13 h, 8 h hands-on tid, eller 16 h, 9 h hands-on tid, när det valfria reamplification steget krävs. Samtidig bearbetning av flera sampel är genomförbara, men den begränsande faktorn är centrifug kapacitet och tekniska skicklighet. Protokollet syftar till att kräva endast typisk laboratorieutrustning (termocykler, centrifug och magnetiska står) i stället för specialutrustning, såsom en nebulisator eller någon sonikator, för klippning DNA.

DNA kvalitet, fragment storlek och kvantitet är begränsande faktorer för användning av herbarieexemplar i hög genomströmning sekvensering experiment. Andra metoder för att isolera herbarium DNA och skapa hög genomströmning sekvensering bibliotek har visat nyttan av att använda så lite som 10 ng DNA16; men de kräver experimentellt bestämma optimala antalet PCR cykler krävs för bibliotek förberedelse. Detta blir opraktiskt när behandlar ytterst små mängder av livskraftiga dubbel strandsatta DNA (dsDNA), eftersom vissa herbarieexemplar producerar endast tillräckligt med DNA för ett enda bibliotek preparat. Metoden presenteras här använder ett enda antal cykler oavsett provet kvalitet, så ingen DNA är vilse i biblioteket optimering steg. I stället anropas ett reamplification steg när biblioteken inte uppfyller de minimibelopp som behövs för sekvenseringen. Många herbarium prover är sällsynta och besitter lite material vilket gör det svårt att motivera destruktiva provtagning i många fall. För att motverka detta presenterade protokollet tillåter dsDNA ingång storlekar mindre än 1,25 ng i förberedelseprocessen bibliotek, utvidgning av livskraftiga prover för hög genomströmning sekvensering och minimera behovet av destruktiva provtagning av exemplar.

Följande protokoll har optimerats för gräs och testats på hundratals olika arter från herbarium prover, även om vi förväntar oss att protokollet kan tillämpas på många andra växtgrupper. Det innehåller en valfri återhämtning steg som kan användas för att spara låg kvalitet och/eller sällsynta exemplar. Baserat på över tvåhundra herbarieexemplar testade, fungerar detta protokoll på prover med låga vävnad input och kvalitet, vilket möjliggör bevarandet av sällsynta exemplar genom minimal destruktiva provtagning. Här visas det att detta protokoll kan tillhandahålla högkvalitativa bibliotek som kan sekvenseras för phylogenomics-baserade projekt.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. inför Start

  1. Se färska cetyl trimetylammoniumformiat metylbromid (CTAB) buffert17 genom att lägga till 20 g CTAB, 10 g polyvinylpyrrolidon (PVP) 40, 100,0 mL 1 M Tris pH 8,0, 40 mL 0,5 M etylendiamintetraättiksyra (EDTA) syra pH 8,0, 280.0 mL 5 M NaCl och 400,0 mL reagens vatten tillsammans, och föra den totala volymen till 1 L med reagens-grade vatten. Justera pH till 8.0.
    Obs: Ytterligare reagenser kan läggas till CTAB beroende på sekundära föreningar i enskilda taxa. Se Allen et al. 18 en grundlig lista av additiv reagenser.
  2. Tillsätt 10 µL av β-merkaptoetanol per 5 mL CTAB buffert.
    Obs: Detta kan tillagas i partier av 50 mL och förvaras i rumstemperatur i 3 – 4 veckor.
    1. Värme CTAB lösningen i 65 ° C vattenbad.
  3. Chill granatkastare och mortlar i-20 ° C i minst 20 min.
  4. Etikett 4 uppsättningar av 2 x n 2 mL rör (där n = antalet prover). Sätta 1 uppsättning märkt rören på is.
  5. Chill isopropanol på is eller i-20 ° C frys.
  6. Ta bort fasta fasen reversibel immobilisering (SPRI) pärlor (se Tabell av material) från kylen och tillåta dem att temperera vid rumstemperatur (minst 30 min).
  7. Bered 80% etanol.
  8. Välj herbarieexemplar för utvinning och hämta ~ 1 cm2eller 10 mg, vävnad per exemplar, helst blad material.

2. DNA-extraktion

  1. Mala ~ 1 cm2 förvalda herbarium vävnad med hjälp av prechilled granatkastare och mortlar. Lägga till flytande kväve och 30 – 50 mg steriliseras sand. Mala tills vävnaden förvandlas till fint pulver.
    Obs: 10 mg eller mer vävnad är önskvärt, men mindre har också arbetat i vissa fall. När det flytande kvävgasen avdunstar, lägga till mer tills vävnaden mals helt. En annan vanlig metod för att störa celler och vävnader är användningen av en pärla visp. Däremot befanns denna metod inte fungerar bra för de prover som används i dessa experiment.
  2. Över det frysta pulvret till två 2 mL rör (Lägg till mer än hälften av rörets volym). Lägga till 600 µL varma CTAB lösning i varje rör och blanda rören grundligt av inversion och vortexa.
    Obs: Eftersom kvantiteten och kvaliteten av herbarium material är ofta låg, utför DNA isolering i två repetitioner hjälper till att få högre avkastning.
  3. Inkubera proverna i 65 ° C vattenbad för 1-1,5 h, vortexa varje 15 min.
  4. Centrifugera proverna vid 10 000 x g för 5 min. överför supernatanten till en ny uppsättning märkta rör (~ 500 µL). Kassera pelleten med en standard icke-klorerade förfogande.
  5. Tillsätt 4 µL RNase-A (10 mg/mL) i varje rör och blanda genom att vända eller pipettering. Inkubera proverna vid 37 ° C i en värme eller vattenbad i 15 min.
  6. Tillsätt en motsvarande volym (~ 500 µL) av en 25:24:1 fenol: kloroform: isoamylacetat alkohol blandning när rören har nått rumstemperatur. Blanda noggrant genom pipettering upp och ner och/eller med inversion. Centrifugera rören vid 12 000 x g i 15 min. överföra vattenskiktet (övre skiktet) till en ny uppsättning märkta rör (~ 400 µL). Kassera det organiska lagret till en klorerade avfallsbehållare.
    Obs: Steg 2,6 kan upprepas om stora mängder sekundära föreningar förväntas i växtmaterial.
  7. Tillsätt en motsvarande volym (~ 400 µL) av en 24:1 kloroform: isoamylacetat alkohol blandning. Blanda noggrant genom pipettering upp och ner och/eller med inversion. Centrifugera rören vid 12 000 x g i 15 min. Transfer vattenskiktet (övre skiktet) till en ny uppsättning prechilled, märkta rör (~ 300 µL). Kassera det organiska lagret till en klorerade avfallsbehållare.
  8. Tillsätt en motsvarande volym (~ 300 µL) prechilled isopropanol och 12 µL 2,5 M natriumacetat till varje rör. Inkubera prover vid-20 ° C under 30 – 60 minuter.
    Obs: Inkubationstider kan förlängas (över natten inkubation), men DNA kvalitet kommer att minska ju längre proverna Inkubera.
  9. Ta proverna ur frysen och centrifugera rören på 12 000 x g i 15 min. avlägsna och Kassera supernatanten försiktigt utan att störa pelleten. Tvätta pelleten av fjädringen med färsk 70% etanol (ca 300-500 µL). För varje fördubblad prov, att konsolidera två enskilda pellets till en med tillhörande etanol.
    Obs: Prover bör konsolideras till en tub med etanol först och sedan fortsätta. Det är inte nödvändigt att tvätta varje prov med etanol separat.
  10. Centrifugera rören på 12 000 x g i 10 min. ta bort och Kassera supernatanten försiktigt utan att störa pelleten. Luften torr pellets.
    Obs: Prover kan torkas snabbare med en torr värme block (inte överstiger 65 ° C). Kontrollera att proverna inte torka alltför, eftersom detta kan minska den slutliga avkastningen av DNA.
  11. Avbryta isolerade DNA i 50 µL av 1 x TE. Förvaras i-20 ° C frysen för långtidsförvaring eller 4 ° C för användning i följande vecka.

3. kvalitetskontroll (QC)

  1. Kör en agarosgel för kvalitetskontroll.
    1. Förbereda en 1 x Tris/Borat/EDTA (TBE) buffert genom att lägga till 54 g Tris base, 27,5 g borsyra och 3.75 g EDTA dinatriumsalt, föra den totala volymen till 5 L med reagens grade vatten.
    2. Förbereda en 1% agarosgel genom att lägga 1 g agaros till 100 mL 1 x TBE. Mikrovågsugn lösningen tills ingen agaros syns. Lägg till 0,01% nukleinsyra gel fläcken (se Tabell för material). Låt kolven svalna tills den är varm vid beröring. Blanda väl genom omrörning. Häll agaros i en gel-bricka och låt det sitta tills det stelnar.
    3. Blanda 3 µL av prov, 2 µL av reagens grade vatten och 1 µL 6 x laddar färgämne. Läsa in proverna i gelmatrisen, att notera sin beställning.
    4. Kör exemplen i 60 – 70 min på 60 – 70 V. bild gelen under UV-ljus med rätt exponering och fokus.
      Obs: Närvaron av en tydlig hög molekylvikt band är ett tecken på hög kvalitet DNA, medan cellprov indikerar vanligtvis DNA nedbrytning. De flesta herbarieexemplar bryts.
  2. Kör en dsDNA kvantifiering analys (se tabell för material) för att bestämma kvantiteten av dubbel strandsatta DNA.
    1. Använd 2 µL av provet för analys.
      Obs: Utspädningar behövs inte för kvantifiering analys av herbarium material eftersom de tenderar att vara i minimala mängder. Framgångsrika bibliotek har gjorts från så lite som 1,26 ng totala dsDNA från detta steg.

4. DNA klippning

Obs: Detta är en optimerad version av en kommersiell dubbelsträngat fragmentase protokoll (se Tabell för material).

  1. Plats dsDNA fragmentering enzym på is efter vortexa för 3 s.
  2. I en steril 0,2 mL polymeras-kedjereaktion (PCR) rör isolerade mix 1 – 16 µL DNA med 2 µL åtföljer fragmentering reaktion buffert. Ta den totala volymen till 18 µL genom att lägga till nuclease gratis vatten. Tillsätt 2 µL av dsDNA fragmentering enzym och vortex blandningen för 3 s.
    Obs: Mängden DNA som behövs varierar beroende på DNA-koncentration (aim för 200 ng totalt i röret).
  3. Inkubera proverna vid 37 ° C för 8,5 min. Sedan Tillsätt 5 µL 0,5 M EDTA till rören.
    Obs: Detta steg måste utföras så snart inkubationstiden är över att avsluta reaktionen och förhindra DNA-prover från alltför klippning.

5. pärla sanering

  1. Homogenisera SPRI pärlorna av vortexa.
  2. Ta den totala volymen av klippt DNA till 50 µL genom att lägga till 25 µL nuclease gratis vatten. Lägga till 45 µL av rumstemperatur SPRI pärlor (90% volym) till 50 µL klippt DNA och blanda grundligt genom pipettering upp och ner.
    Obs: Lägga pärlor på 90% av totala provvolymen görs för att ta bort den minsta av DNA-fragment, ofta under 200 baspar.
  3. Låt proverna Inkubera för 5 min. sätt rören på en magnetisk platta och låt dem sitta i 5 min. noggrant avlägsna och Kassera supernatanten.
    Obs: Var noga med att inte störa pärlor, eftersom de innehåller de önska DNA-mål.
  4. Tillsätt 200 µL av färska 80% etanol rören medan på magnetiska stativet. Odla i rumstemperatur i 30 s och sedan försiktigt bort och Kassera supernatanten. Upprepa detta en gång. Luften torr pärlorna för 5 min när röret är på den magnetiska stå med locket öppet.
    Obs: Undvik uttorkning på pärlorna. Detta kan resultera i lägre återhämtning av DNA.
  5. Ta bort rören från magneten. Eluera DNA från pärlorna i 55 µL 0,1 x TE och blanda omsorgsfullt genom pipettering upp och ner. Odla i rumstemperatur för 5 min. plats rör på magnetiska stativet och väntan lösning att vända rensa (~ 2 min).
  6. Dra bort 52 µL av supernatanten. Kör en DNA kvantifiering analys av prov att kontrollera återhämtningen och den ursprungliga koncentrationen som går in i biblioteket prep.
    Obs: Bibliotek har gjorts med totala dsDNA uppskattas vara mindre än 1,25 ng, men i varje fall reamplification krävdes.

6. bibliotek förberedelse

Obs: Detta är en modifierad version av ett kommersiellt tillgängliga bibliotek kit (se Tabell för material -protokollet).

  1. Slutet Prep
    1. Lägga till 3 µL av Amiiiiin och fosfat förföljer enzymer och 7 µL av medföljande reaktion buffert till 50 µL av rengjorda, klippt DNA. Blanda omsorgsfullt genom pipettering upp och ner. Snurra rören för att ta bort bubblor.
      Obs: Den totala volymen bör vara 60 µL.
    2. Placera proverna i en termocykler med följande program: 30 min vid 20 ° C, 30 min vid 65 ° C, håll sedan vid 4 ° C.
      Obs: Uppvärmd locket sattes till ≥ 75 ° C
  2. Adapter ligatur
    1. Späd adaptern 25 – 50 gånger (arbetar adapter koncentration av 0,6 – 0,3 µM). Lägga till 30 µL av ligering master mix, 1 µL ligering enhancer och 2,5 µL av adapter för hög genomströmning kort Läs sekvensering i rören.
      Obs: Den totala volymen bör vara 93,5 µL.
    2. Blanda omsorgsfullt genom pipettering upp och ner. Snurra rören för att ta bort bubblor. Inkubera rören vid 20 ° C under 15 minuter.
    3. Tillsätt 3 µL av kommersiella blandning av uracil DNA glykosylas (UDG) och den DNA glykosylas-lyasen Amiiiiin VIII (se Tabell för material) till rören. Se till att den totala volymen är 96,5 µL. Blanda väl och inkubera vid 37 ° C i 15 min med en termocykler.
      Obs: Locket ska anges till ≥47 ° C. Den ursprungliga versionen av protokollet kommersiella har storlek urval efter adapter ligering steget, följt av en pärla rensning som sista steg. Detta protokoll, som uppnår högre avkastning, växlar ordningen på stegen och implementerar storlek urval som ett sista steg.
  3. Diskrensning ta bort enzymer och små fragment
    1. Homogenisera magnetiska pärlor av vortexa.
    2. Lägg till 78 µL av SPRI magnetiska pärlor (80% volym) och blanda omsorgsfullt genom pipettering upp och ner.
      Obs: Lägga pärlor på 80% av totala provvolymen görs för att ta bort de minsta DNA-fragment, som ofta är kortare än 250 baspar. Strängare avlägsnande av små DNA-fragmenten är att (i) avlägsna överskott adaptrar och (ii) betonar förstärkning av större fragment i följande steg.
    3. Låt proverna Inkubera i 5 min. Lägg rören på en magnetisk platta för 5 min. Ta försiktigt bort och kasta bort supernatanten som innehåller DNA utanför intervallet önskad storlek.
      Obs: Var noga med att inte störa de pärlor som innehåller de önska DNA-mål.
    4. Tillsätt 200 µL av färska 80% etanol rören medan på magnetiska stativet. Odla i rumstemperatur i 30 s och sedan försiktigt bort och Kassera supernatanten. Upprepa detta en gång. Luften torr pärlorna för 5 min när röret är på den magnetiska stå med locket öppet.
      Obs: Undvik över torkning pärlorna. Detta kan resultera i lägre återhämtning av DNA.
    5. Ta bort rören från magneten. Eluera DNA målet från pärlorna genom att lägga till 17 µL 0,1 x TE och blanda omsorgsfullt genom pipettering upp och ner.
    6. Odla i rumstemperatur för 5 min. plats rör på magnetiska stativet och väntan lösning att vända rensa (~ 2 min).
    7. Dra av 15 µL av supernatanten.
  4. PCR-amplifiering
    1. Tillsätt 25 µL av high fidelity PCR master mix, 5 µL av hög genomströmning kort Läs sekvensering bibliotek prep 5' primer och 5 µL av hög genomströmning kort Läs sekvensering bibliotek prep 3' primer, till 15 µL av rengjorda adapter-sammanskrivna DNA.
      Obs: Totala volym bör vara 50 µL.
    2. Blanda väl genom vortexa. Placera proverna i en termocykler använder de inställningar som finns i tabell 1: termocykler förstärkning inställning.
      Obs: Ett stort antal cykler behövs på grund av den låga mängden input DNA.
Cykel steg Temp. Tid Cykler
Inledande denaturering 98 ° C 30 s 1
Denaturering 98 ° C 10 s 12
Glödgning/förlängning 65 ° C 75 s 12
Slutliga förlängning 65 ° C 5 min 1
Håll 4 ° C

Tabell 1: PCR protokoll denaturering, glödgning och förlängning tider och temperaturer. Temperatur och tider var optimerad för de reagens som presenteras i detta protokoll. Om reagenser förändras, bör temperaturer och tider optimeras igen.

  1. Storlek urval för önskad bibliotek storlek
    Obs: Denna pärla steg tar bort fragment både ovanför och nedanför målområdet.
    1. Homogenisera SPRI pärlor av vortexa.
    2. Tillsätt 25 µL (50% volym) av rumstemperatur magnetiska pärlor och blanda omsorgsfullt genom pipettering upp och ner. Låt proverna Inkubera för 5 min. sätt rören på en magnetisk platta och låt dem sitta i 5 min. noggrant bort och överför supernatanten till en ny uppsättning märkta rör.
      Obs: Denna volym kan justeras baserat på önskad bibliotek storlek. Supernatanten innehåller DNA-fragment av önskad storlek. I den första pärla inkubationen, är pärlorna bindande större bibliotek fragment. Dessa tas bort att fokusera på de i intervallet 400 – 600 baspar. Supernatanten innehåller mindre fragment.
    3. Tillsätt 6 µL av rumstemperatur SPRI pärlor till supernatanten och blanda grundligt genom pipettering upp och ner. Låt proverna Inkubera för 5 min. Lägg rören på en magnetisk platta och låt dem sitta i 5 min.
      Obs: Denna volym kan justeras baserat på önskad bibliotek storlek enligt steg 6.5.2.
    4. Försiktigt bort och Kassera supernatanten.
      Obs: Var noga med att inte störa de pärlor som innehåller önskad DNA. I den andra pärlan inkubationen, är pärlorna bindande till fragment kvar efter inledande avlägsnande av största DNA fragment. Detta fragment är vanligtvis i intervallet önskad storlek.
    5. Tillsätt 200 µL av färska 80% etanol rören medan på magnetiska stativet. Odla i rumstemperatur i 30 s, sedan försiktigt bort och Kassera supernatanten. Upprepa. Luften torr pärlorna för 5 min när röret är på den magnetiska stå med locket öppet.
      Obs: Undvik uttorkning på pärlorna. Detta kan resultera i lägre återhämtning av DNA.
    6. Ta bort rören från magneten. Eluera DNA målet från pärlorna i 33 µL 0,1 x TE och blanda omsorgsfullt genom pipettering upp och ner.
    7. Odla i rumstemperatur för 5 min. plats rör på magnetiska stativet och väntan lösning att vända rensa (~ 2 min). Dra bort 30 µL av supernatanten och överföring till 2 mL rör (se Tabell för material) för lagring.
      Obs: Biblioteken kan förvaras vid-20 ˚C för långsiktig lagring.
  2. Kvalitetskontroll
    1. Kör en kvalitetskontroll test på DNA bibliotek. Se steg 3.1 och 3.2.
      Obs: För DNA bibliotek, Kör gelen för ~ 45 min vid 96 V.
  3. Bibliotek reamplification: valfritt om bibliotek kvantitet inte är tillräckligt.
    Obs: Prover med bibliotek koncentrationer under 10 nM kan vara reamplified med följande steg. Reamplification av låg koncentration bibliotek kan uppnå fungerande resultat för sekvensering, men reamplification kan orsaka en blygsam Skift i bas sammansättning mångfald, även om samlas in data (tabell 3) tyder på att detta är försumbar för vissa mätvärden .
    1. Späd de universella reamplification primers 10-faldig med 0.1 x TE.
    2. Tillsätt 25 µL av high fidelity PCR master mix, 5 µL utspädda universal reamplification primer 1 (AATGATACGGCGACCACCGA) och 5 µL utspädda universal reamplification primer 2 (CAAGCAGAAGACGGCATACGA) till 15 µL av låg koncentration bibliotek. Obs: Total volym bör vara 50 µL.
    3. Blanda väl genom vortexa. Placera proverna i en termocykler använder de inställningar som finns i tabell 1: termocykler förstärkning inställning
      Obs: Det stora antalet cykler behövs på grund av låg mängd indata DNA.
    4. Bead sanering
    5. Homogenisera SPRI pärlor av vortexa. Tillsätt 45 µL av rumstemperatur SPRI pärlor (90% volym) och blanda omsorgsfullt genom pipettering upp och ner.
    6. Låt proverna Inkubera i 5 min. Lägg rören på en magnetisk platta för 5 min.
    7. Försiktigt bort och kasta bort supernatanten som innehåller oönskade DNA.
      Obs: Var noga med att inte störa de pärlor som innehåller de önska DNA-mål.
    8. Tillsätt 200 µL av färska 80% etanol rören medan på magnetiska stativet. Odla i rumstemperatur i 30 s, och sedan försiktigt bort och Kassera supernatanten. Upprepa detta en gång.
    9. Luften torr pärlorna för 5 min när röret är på den magnetiska stå med locket öppet.
      Obs: Undvik uttorkning på pärlorna. Detta kan resultera i lägre återvinning av målet för DNA.
    10. Ta bort rören från magneten. Eluera DNA målet från pärlorna i 33 µL 0,1 x TE och blanda omsorgsfullt genom pipettering upp och ner.
    11. Odla i rumstemperatur för 5 min. plats rör på magnetiska stativet och väntan lösning att vända rensa (~ 2 min).
    12. Dra bort 30 µL av supernatanten. Biblioteken kan förvaras vid-20 ° C för långsiktig lagring.
  4. Kvalitetskontroll
    1. Kör en kvalitetskontroll test på DNA bibliotek. Se steg 3.1 och 3.2. För DNA bibliotek, Kör gelen för ~ 45 min vid 96 V.
      Obs: Om ett dubbelt band ses i gel, detta är sannolikt en följd av primer utmattning från reamplification steg. Banden kan avlägsnas genom upprepande 6,9, men använder endast en cykel i PCR-programmet skildras i tabell 1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

DNA isolering och slutliga bibliotek avkastning
I denna studie visades effekten av protokollet för isolering av herbarium DNA och återvinning av hög kvalitet sekvensering bibliotek med femtio olika prover med den äldsta från 1920 och den yngsta från 2012 (tabell 2). För varje prov användes cirka 10 mg löv-vävnad för DNA isolering. Grönare bladvävnad gynnades om tillgängliga, och ingen vävnad med uppenbara svamp kontaminering valdes. Framgångsrika isoleringar kan göras med gula eller bruna vävnad, även om avkastningen bör förväntas vara lägre. Totalt dubbel strandsatta DNA (dsDNA) från den inledande isolering som varierade från 3,56 ng till 2.610 ng. Som förväntat, DNA från herbarieexemplar var mycket förstörd (figur 1A, Supplemental figur 1). En del av dessa isoleringar användes för enzymatisk klippning (1,26 – 464 ng). Även om herbarium DNA är redan klippt genom bevarande processen, kräver optimering av protokollet ytterligare klippning för att förbättra övergripande bibliotek avkastning. Den totala återhämtningen av dsDNA efter klippning varierade från < 1% till 51% av ingående dsDNA, vilket resulterar i ett minimum av mindre än 1,25 ng av börjar DNA för bibliotek förberedelse och högst 328 ng. Extrema förlusten av DNA i vissa prover kan tillskrivas redan små fragment storlek mycket av DNA innan enzymatisk klippning (figur 1A, kompletterande Figur1). Användning av en 90% volym pärla rensning på klippt DNA avlägsnas avsiktligt minsta fragment av DNA för att berika för större, mer önskvärt fragment storlekar. Dessa små fragment var särskilt sett i prover TK463, TK657 och TK694, som betecknas med en intensiv signal vid 100 baspar märket (figur 1A).

Den totala mängden bibliotek post storlek urval varierade från 1.425 ng till 942,5 ng (tabell 2, kompletterande Tabell1). För 23 av proverna, initial utvinning och bibliotek preparatet inte ger en tillräcklig mängd bibliotek (< 10 nM. Tabell 2, kompletterande Tabell1), så dessa prover utsattes för reamplification och återställning stegen i protokollet, vilket resulterar i en 14 – 680 x ökning av totala bibliotek (tabell 2, kompletterande Tabell1). Slutliga bibliotek resulterade i ett band mellan 350 och 500 baspar (figur 1B, Supplemental figur 2). Ibland ett andra band som var större än den förväntade bibliotek sågs (figur 1B, Supplemental figur 2). Detta skedde när reamplification PCR utmattad tillgängliga grundfärger och började glödgning bibliotek adaptrar av icke-homolog DNA-fragment. Detta skapar en molekyl där ändarna (adaptrar) ordentligt glödgning, men DNA skäret inte. Denna ”bubblade” molekyl verkade större på en gel, som det gick långsammare genom gelmatrisen. Dessa glödgning fel har åtgärdats genom att förbereda en annan reamplification reaktion på redan reamplified biblioteket och kör det för en cykel. Denna enda cykel föreskrivs primers korrekt glödgning och förstärkning, att ta bort andra bandet (kompletterande diagram 3).

Reamplification bibliotek underlättas slutliga bibliotek koncentrationer på minst 10 nM. Dessa koncentrationer tillåtna bibliotek spädas lika molariteten och poolade i jämställd representation, hjälper till att förneka problem som skulle ha uppstått med ojämlika prov kvalitet och sekvensering bibliotek avkastning. Om målet med ett projekt är kloroplast genomet sekvensering, då den totala mängden sekvensering behövs varierar som olika härstamningar och vävnader skiljer sig i de totala procent av läsningar som härstammar från kloroplast DNA19. Normalt 50 – 100 x projicerade täckning av kloroplast genomet är tillräcklig för montering och sekvensering körningar kan slås samman för att inkludera så många som 70 personer beroende på art och sekvensering.

Testning för kontaminering, Bias och Variation orsakad av Reamplification
En märklig oro för HTS sekvensering är införandet av bias i biblioteken genom omfattande PCR-amplifiering20. För att testa effekterna av reamplification och identifiera potentiella bias gemensamt Fylogenetiska tillämpningar av herbarium material, jämförde vi ett framgångsrikt sekvenserade bibliotek (TK686) med samma bibliotek spädd 1:5 och reamplified (utsedda TK686-R). Både TK686 och TK686-R var sekvenserade i en Illumina HiSeq4000 vid University of Illinois Roy J. Carver bioteknik centrum och Michigan State University teknik Support forskningsanläggningen, respektive, med hjälp av ihopkopplade slutet 150 baspar lyder (se Tabell 3 för sekvensering Detaljer). RAW-läsningar har deponerats i den NCBI SRA (SRP128083). Läsningar rengjordes med Trimmomatic v.0.3621 inklusive adapter trimning använder NEB adapter sekvens, kvalitet filtrering för en genomsnittlig phred Poäng 20 för en 10 baspar Skjutlucka, och minst avskurna storlek av 40 baspar. Som en av de primära frågorna med herbarieexemplar är svamp förorening, kontaminering beräknades genom att mappa läser mot en del av JGI MycoCosm svamp genomet databas22 (312 nukleära genomen och 79 mitokondriella genomet) med bowtie2 v . 2.2.923 med hjälp av de ”mycket-känsliga-lokal” Parameteruppsättningen. TK686 och TK686-R bibliotek var omöjlig att skilja i nukleär svamp kontamination (9.24% och 9,68%, respektive) och mitokondrie svamp kontaminering (0,94% och 0,8%) (Tabell 3). Även om detta är bara ett exempel, tyder det på att svamp kontaminering av herbarium prover inte är försumbar och bör tas bort innan du använder herbarium-derived sekvensdata. Databasen och kommandon som används för att identifiera och ta bort svamp kontaminering kan hittas i M. R. McKain GitHub repository Herbarium genomik24.

Kloroplast Genomsekvensering används ofta för fylogenetiska analyser och herbarieexemplar används alltmer som källa material12. För att testa reamplification trohet i kloroplast genomet församling, monterades kloroplast genomen för både TK686 och TK686-R med snabb-Plast v.1.2.525 enligt standardinställningarna med bowtie indexet inställt Poales. En full kloroplast genomet erhölls för TK686-R, men TK686 kloroplast genomet var monterade i sju contigs på grund av lägre Läs djup. De TK686 contigs monterades manuellt efter McKain o.a. 26 färdigmonterad kloroplast genomen anpassades till varandra i en GUI-baserade justering programvara (se Tabell av material) och variationen mellan församlingar bedömdes. Totalt 12 SNP och en ditsatta identifierades mellan kloroplast sammansättningar för TK686 och TK686-R. För varje variant bedömdes täckning i Läs uppsättningar från både TK686 och TK686-R. I alla fall var den vanligaste varianten samma mellan de två biblioteken. TK686 visade en T→C, en G→A, en G→T, en G→, en C→A, en T→A och fyra C→A varianter. Fem av dessa varianter inträffade inom en homopolymer sträng, vilket tyder på deras införlivande i församlingen kan ha varit resultatet av sekvensering fel och låga övergripande täckning. Andra kan ha varit resultatet av antingen kloroplast haplotyp variation, sekvensering fel, eller cytosin deaminering, eller någon kombination av dessa faktorer. TK686-R hade en C→T, en G→T och en A→G. Varianter av C→T och G→T hittades i en homopolymer enligt ovan. I slutändan identifierades identiska komplett kloroplast genomen från båda Läs uppsättningar. En enda kloroplast arvsmassa från TK686 var kommenterade med grönskande21 och jämfört med andra medlemmar av stammen Andropogoneae. Alla standard kloroplast funktioner var kommenterad: 8 rRNAs, 38 tRNAs och 84 protein kodande gener. Komplett kloroplast genomet är tillgänglig från GenBank (MF170217) och grönskande27.

Potentiella bias från reamplification bibliotek fastställdes också genom uppskattning av procent GC och totala uppskattade transposon innehåll. Procent GC uppskattades med hjälp av ett anpassat skript24. Skillnader i GC innehåll av de två exemplaren var försumbar, med 49,7% GC i TK686 och 51,2% GC i TK686-R. Transposon sammansättning uppskattades med hjälp av Transposome28. För båda biblioteken, 100.000 läsningar var slumpmässigt subsampled och transposon sammansättning uppskattades med hjälp av en procent identitet 90, en bråkdel täckning av 0,55, en klusterstorlek på 100, och den RepBase 21,10 gräs upprepa referenssetet29. Detta upprepades 100 gånger för att utföra bootstrapping transposon uppskattning från dessa datamängder. Totala arvsmassan procentsatser för stora underfamiljer av transposoner utvanns från Transposome utgång, och det medelvärdet och standardavvikelsen för dessa för replikerar 100 uppskattades. Alla skript används för att generera dessa utgångar kan hittas i M. R. McKain Github repository transposoner30och alla resultat har deponerats i Dryad (doi:10.5061/dryad.r8t2m). Med de två vanligaste transposon underfamiljerna som indikatorer (Copia och Gypsy lång terminal upprepa retrotransposons), var resultaten nästan identiska med Copia på 33.52 ± 4.00% och 31.68 ± 2,94% och Gypsy 24.83 ± 2,72% och 24.00 ± 2,35% i TK686 och TK686-R, respektive (tabell 3). Dessa testresultat tyder på att det reamplification steget i detta protokoll inte skapar meningsfulla sekvensering bias för high-level genomet mätvärden. Det bör dock noteras att detta enda exempel inte kanske helt representativa för alla reamplified bibliotek. Detta enda test visar att det reamplification steget till sin natur inte var förspänns genomet mätvärden i TK686/TK686-R. Introducerade bias inte skulle påverka montering av en kloroplast genomet ges tillräcklig täckning av sekvensering, men det rekommenderas att experiment, som presenteras i denna studie med TK686/TK686-R, utförs på målet härstamningar Kontrollera att bias inte är som inträffar under studier som undersöker överförbara element mångfald.

Figure 1
Figur 1: agaros gel bilder av A) DNA isolering och B) slutliga sekvensering bibliotek från tio herbarieexemplar. För varje lane användes 3 µL av DNA eller bibliotek. (A) DNA var förstörd i alla herbarium isoleringar som ses av allmänna utstryket. (B) slutliga sekvensering bibliotek skildra en primär band av 300-500 baspar med en bredare distribution av 200-1 000 baspar; det sistnämnda är vanligare i reamplified bibliotek. Körfält för både (A) och (B) identifierades av prov och kan jämföras med resultaten i tabell 2. Stege storlek var avbildad i baspar (bp). Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2 : Cirkulär tomt på Condensatum scoparium (TK686) kloroplast genomet med annotation. Färdigmonterad genomet från shotgun sekvensering av herbarium-derived DNA uppvisade en total längd av 139,296 baspar (bp), ett stort exemplar regionen (LSC) 81,401 bp, en inverterad upprepad region (IR) i 22,669 bp, och en liten exemplar regionen (SSC) 12,557 BP. Alla standard protein-kodande gener, tRNAs och rRNAs för medlemmar av den Andropogoneae stammen identifierades i kommentaren. Klicka här för att se en större version av denna siffra.

Tabell 2: DNA extraktion och bibliotek förberedelse resultat för tio herbarium prover och fyra reamplified bibliotek. Den totala dubbel stranded DNA vid olika steg i protokollet visat hur varierande kvalitet kan vara, särskilt när filtreras för storlek. Vänligen klicka här för att hämta tabellen.

Tabell 3: sekvensering statistik för TK686 och den reamplified TK686R. Reamplification påverkar inte den totala incidensen av svamp genomet kontaminering, GC innehåll uppskattning, transposon sammansättning uppskattning eller förmågan att montera hela kloroplast genomen. Vänligen klicka här för att hämta tabellen.

Kompletterande Tabell1: resultat för DNA-extraktion och bibliotek förberedelse för fyrtio ytterligare herbarium prover, inklusive tjugo reamplified bibliotek. Totala dubbel stranded DNA vid olika steg i protokollet visat hur varierande kvalitet kan vara, särskilt när filtreras för storlek. Vänligen klicka här för att hämta tabellen.

Kompletterande Figur1: agaros gel bilder av fyrtio ytterligare DNA isoleringar från herbarieexemplar. Både (A) och (B) skildrar tjugo separata DNA isoleringar och demonstrera den karakteristiska nedbrytningen av herbarium-derived DNA. För varje lane användes 3 µL av DNA. Körfält för både (A) och (B) identifierades av prov och kan jämföras med resultaten i extra Tabell1. Stege storlek är avbildad i baspar (bp). Vita fläckar på bilden är på grund av artefakter i gel kameran som inte kunde tas bort med rengöring. Vänligen klicka här för att ladda ner denna siffra.

Kompletterande figur 2: agaros gel bilder av fyrtio ytterligare sekvensering bibliotek från herbarium-derived DNA. För varje lane användes 3 µL av bibliotek. Slutliga sekvensering bibliotek finns i både (A) och (B) med en genomsnittlig storlek på 300-500 baspar. Sekundära band ses i några förstärkta prover föreslår ”bubblande” bibliotek. Körfält för både (A) och (B) identifieras av prov och kan jämföras med resultaten i extra Tabell1. Stege storlek är avbildad i baspar (bp). Vänligen klicka här för att ladda ner denna siffra.

Kompletterande figur 3: agaros gel bild av sekundära bandet borttagning med ett ytterligare enda cykel PCR steg. Vänligen klicka här för att ladda ner denna siffra.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Det protokoll som presenteras här är en omfattande och robust metod för DNA isolering och sekvensering bibliotek förberedelse från torkade växten exemplar. Konsekvensen av den metod och minimalt behov av att ändra det baserat på preparatet kvalitet gör det skalbara för stora herbarium-baserade sekvensering projekt. Införandet av ett valfritt reamplification steg för låg avkastning bibliotek tillåter införandet av låg kvalitet, låg kvantitet, sällsynt, eller historiskt viktiga prover som annars inte skulle vara lämplig för sekvensering.

Vikten av ursprungliga DNA avkastning
Herbarium-derived DNA försämras ofta till följd av första exemplaret bevarande11, med DNA prover mindre än 300 år gammal vara så förstörd som DNA isolerade från djurrester som är flera hundra till tusentals år gammal31 , 32. optimering av ursprungliga DNA avkastning är därför mycket viktigt att få tillräckligt hög kvalitet dsDNA för framgångsrika sekvensering bibliotek beredning. För gräs arter, en optimal avkastning uppnås genom kombinerad användning av steriliserad sand och flytande kväve i första slipningen steg, som ger en mer grundlig förstörelse av cellväggar och frisättning av nukleinsyror. Detta tillvägagångssätt ökar både önskvärt större dsDNA och oönskade mindre fragment (figur 1, kompletterande Figur1, tabell 2, kompletterande Tabell1). Efterföljande pärla reningssteg isolera och berika för fragment av en storlek som är lämplig för sekvensering (300 – 500 baspar), kraftigt minska återhämtning men också berikande för längre fragment (tabell 2, kompletterande Tabell1). Ändringar av de initiala DNA isolering steg kan behövas baserat på härstamning som provtas för att minska effekterna av sekundära metaboliter på nedströms behandling18.

Optimering av bibliotek adaptrar
Koncentrationen av adaptrar används för ligering har en direkt effekt på mängden adapter dimer i färdiga bibliotek. Adapter dimerer resultera från adapter själv ligatur när otillräcklig prov är närvarande, och förorena sekvensering körningar33. Den relativt låga totala dsDNA tillgänglig från herbarieexemplar kräver spädning av adaptrar före ligering. Adaptrar kan spädas 50-fold från lager koncentrationen av 15 µM (se Protokollenheten) att underlätta hög genomströmning bibliotek beredning utan att individuellt mäta och späd adapter för varje prov (tabell 2, kompletterande tabell 1). även om mättnad av adaptrar kan i princip minska övergripande bibliotek avkastning, är det osannolikt att herbarieexemplar kommer att ge dsDNA i sådana överskott av adapter.

Variation i Bead rengöring steg för högre avkastning
Storlek urval i beredning av sekvensering bibliotek görs vanligen efter adapter ligatur, möjliggör amplifiering av fragment främst inom intervallet önskad storlek; Detta görs genom att ta bort fragment som är både större och mindre än målstorleken. Låga mängden herbarium-derived dsDNA för bibliotek förberedelse förvärras efter storlek urval vid detta steg, vilket resulterar i unworkably låga totala dsDNA och slutligen låg avkastning i slutliga biblioteket. Genom att utföra en standard pärla-rengöring steg med 90% volym pärlor efter ligering, återstår mer totala dsDNA för anrikning i steget förstärkning. Extremt små DNA-fragment tas företrädesvis använder 90% volym pärlor. Storlek urval sker i det sista steget på förstärkta biblioteket, vilket garanterar anrikning av önskad fragment storlekar. Totala volymer av pärlor kan justeras för att välja önskat intervall, även om de två volymerna av 25 µL och 6 µL av pärlor är optimerade för att hämta bibliotek av 400-500 baspar skär inom detta protokoll (figur 1B, kompletterande figur 2).

Prov räddning genom Reamplification av bibliotek
Trots metodtips i DNA isolering och bibliotek förberedelse, kan slutliga koncentrationer av sekvensering bibliotek vara otillräckliga för ytterligare sekvensering. Den destruktiva karaktären av provtagning och ofta begränsad expendable material från herbarieexemplar tillåter inte alltid upprepa DNA isolering. Av reamplifying biblioteket upp till kan 12 ytterligare PCR cykler, även ovanligt dåligt bibliotek sparas. Ett par standard primer används för förstärkning, som är kompatibel med antingen dubbel- eller Enkelrum indexerade bibliotek protokoll. En huvudfråga för reamplification är införandet av bias, ofta genom minskning av GC-rika delar av genomet20. Med hjälp av en HiFi-polymeras (se Tabell för material), dessa potentiella fördomar är potentiellt undvikas. Detta demonstreras genom en minimal variation av GC innehåll sekvenserade bibliotek TK686 och TK686-R (tabell 3). Som en andra kontroll, var transposon innehållet i både TK686 och TK686-R beräknad och visade inga märkbara skillnader (tabell 3). Slutligen sammanställdes hela kloroplast genomet hos denna anslutning från TK686 och TK686-R, vilket resulterade i identiska sekvenser efter noggrann undersökning av SNP variationen mellan de två församlingarna (figur 2, tabell 3). Dessa tester tyder det genomiska standardstatistisk, såsom GC innehåll och transposon sammansättning och möjligheten att montera komplett kloroplast genomen, inte påverkas av reamplification. Detta öppnar upp möjligheten att införliva herbarium exemplar trodde att brytas alltför eller saknas i materialet i phylogenomic studier utan oro för introducerade partiskhet genom PCR. Dessa reamplified bibliotek kan också användas för sekvens fånga34, även om det vore nödvändigt att testa om SNP calling är partisk. Det rekommenderas att småskaliga tester av bias bedrivas med varje projekt för att kontrollera att bias inte införs i sekvensering bibliotek.

Begränsningar och eventuella ändringar
Trots att detta protokoll har arbetat på misslyckas fortfarande hundratals herbarieexemplar dåligt bevarade vävnader vid varje steg. Det är dock ytterst sällsynt för biblioteken att misslyckas från vävnader med framgångsrika DNA extraktioner, särskilt efter bibliotek räddning genom reamplification. Storlek urval stegen kan ändras att rikta olika storlek fragment eller att minska mängd fragment sett i några slutliga bibliotek. Som med alla växtbaserade extraktion protokoll, kan åtgärder behövas ta bort härstamning-specifika sekundära föreningar som kan hämma övergripande protokollet. Som presenteras, detta protokoll ger en standardmetod för förberedelse för DNA-isolering och hög genomströmning bibliotek för gräs herbarieexemplar och genom kontroll och experiment är sannolikt att vara möjligt att ändra till andra växt härstamningar.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna förklarar de har inga konkurrerande intressen.

Acknowledgments

Vi tackar Taylor AuBuchon-äldste, Jordan Teisher, och Kristina Zudock för hjälp med provtagning herbarieexemplar och Missouri botaniska trädgården för tillträde till herbarieexemplar för destruktiva provtagning. Detta arbete var stöd av ett stipendium från National Science Foundation (DEB-1457748).

Materials

Name Company Catalog Number Comments
Veriti Thermal Cycler Applied Biosystems 4452300 96 well 
Gel Imaging System Azure Biosystems c300
Microfuge 20 Series Beckman Coulter B30137
Digital Dry Bath Benchmark Scientific BSH1001
Electrophoresis System EasyCast B2
PURELAB flex 2 (Ultra pure water) ELGA  89204-092
DNA LoBind Tube  Eppendorf 30108078 2 ml
Mini centrifuge Fisher Scientific 12-006-901
Vortex-Genie 2 Fisher Scientific 12-812
Mortar Fisher Scientific S02591 porcelain
Pestle fisher Scientific S02595 porcelain
Centrifuge tubes fisher Scientific 21-403-161
Microwave Kenmore 405.7309231
Qubit Assay Tubes Invitrogen Q32856
0.2 ml Strip tube and Cap for PCR VWR 20170-004
Qubit 2.0 Fluorometer Invitrogen Q32866
Balance Mettler Toledo PM2000
Liquid Nitrogen Short-term Storage Nalgene F9401
Magnetic-Ring Stand  ThermoFisher Scientific  AM10050 96 well 
Water Bath VWR 89032-210
Hot Plate Stirrers VWR 97042-754
Liquid Nitrogen Airgas UN1977
1 X TE Buffer Ambion AM9849 pH 8.0
CTAB AMRESCO 0833-500G
2-MERCAPTOETHANOL AMRESCO 0482-200ML
Ribonuclease A AMRESCO E866-5ML 10 mg/ml solution
Agencourt AMPure XP Beckman Coulter A63882
Sodium Chloride bio WORLD 705744
Isopropyl Alcohol bio WORLD 40970004-1
Nuclease Free water bio WORLD 42300012-2
Isoamyl Alcohol Fisher Scientific A393-500
Sodium Acetate Trihydrate Fisher Scientific s608-500
LE Agarose GeneMate E-3120-500
100bp PLUS DNA Ladder Gold Biotechnology D003-500
EDTA, Disodium Salt IBI Scientific IB70182
Qubit dsDNA HS Assay Kit Life Technologies Q32854
TRIS MP Biomedicals 103133 ultra pure
Gel Loading Dye Purple (6 X) New England BioLabs B7024S
NEBNext dsDNA Fragmentase New England BioLabs M0348L
NEBNext Ultra II DNA Library Prep Kit for Illumina  New England BioLabs E7645L
NEBNext Multiplex Oligos for Illumina New England BioLabs E7600S Dual Index Primers Set 1
NEBNext Q5 Hot Start HiFi PCR Master Mix New England BioLabs M0543L
Mag-Bind RXNPure Plus Omega bio-tek M1386-02
GelRed 10000 X Pheonix Research 41003-1
Phenol solution SIGMA Life Science P4557-400ml
PVP40 SIGMA-Aldrich PVP40-50G
Chloroform VWR EM8.22265.2500
Ethanol Koptec V1016 200 Proof
Silica sand VWR 14808-60-7
Reamplification primers Integrated DNA Technologies see text
Sequencher v.5.0.1 GeneCodes

DOWNLOAD MATERIALS LIST

References

  1. Savolainen, V., Cuénoud, P., Spichiger, R., Martinez, M. D. P., Crèvecoeur, M., Manen, J. F. The use of herbarium specimens in DNA phylogenetics: Evaluation and improvement. Plant Syst Evo. 197, (1-4), 87-98 (1995).
  2. Zedane, L., Hong-Wa, C., Murienne, J., Jeziorski, C., Baldwin, B. G., Besnard, G. Museomics illuminate the history of an extinct, paleoendemic plant lineage (Hesperelaea, Oleaceae) known from an 1875 collection from Guadalupe Island, Mexico. Bio J Linn Soc. 117, (1), 44-57 (2016).
  3. Teisher, J. K., McKain, M. R., Schaal, B. A., Kellogg, E. A. Polyphyly of Arundinoideae (Poaceae) and Evolution of the Twisted Geniculate Lemma Awn. Ann Bot. (2017).
  4. Cozzolino, S., Cafasso, D., Pellegrino, G., Musacchio, A., Widmer, A. Genetic variation in time and space: the use of herbarium specimens to reconstruct patterns of genetic variation in the endangered orchid Anacamptis palustris. Conserv Gen. 8, (3), 629-639 (2007).
  5. Wandeler, P., Hoeck, P. E. A., Keller, L. F. Back to the future: museum specimens in population genetics. Tre Eco & Evo. 22, (12), 634-642 (2007).
  6. Rivers, M. C., Taylor, L., Brummitt, N. A., Meagher, T. R., Roberts, D. L., Lughadha, E. N. How many herbarium specimens are needed to detect threatened species? Bio Conserv. 144, (10), 2541-2547 (2011).
  7. Saltonstall, K. Cryptic invasion by a non-native genotype of the common reed, Phragmites australis, into North America. PNAS USA. 99, (4), 2445-2449 (2002).
  8. Besnard, G., et al. From museums to genomics: old herbarium specimens shed light on a C3 to C4 transition. J Exp Bot. 65, (22), 6711-6721 (2014).
  9. Särkinen, T., Staats, M., Richardson, J. E., Cowan, R. S., Bakker, F. T. How to open the treasure chest? Optimising DNA extraction from herbarium specimens. PLoS ONE. 7, (8), e43808 (2012).
  10. Harris, S. A. DNA analysis of tropical plant species: An assessment of different drying methods. Plant Syst Evo. 188, (1-2), 57-64 (1994).
  11. Staats, M., et al. DNA damage in plant herbarium tissue. PLoS ONE. 6, (12), e28448 (2011).
  12. Bakker, F. T., et al. Herbarium genomics: plastome sequence assembly from a range of herbarium specimens using an Iterative Organelle Genome Assembly pipeline. Bio J of the Linn Soc. 117, (1), 33-43 (2016).
  13. Camacho, F. J., Gernandt, D. S., Liston, A., Stone, J. K., Klein, A. S. Endophytic fungal DNA, the source of contamination in spruce needle DNA. Mol Eco. 6, (10), 983-987 (1997).
  14. Hofreiter, M., Jaenicke, V., Serre, D., Von Haeseler, A., Pääbo, S. DNA sequences from multiple amplifications reveal artifacts induced by cytosine deamination in ancient DNA. Nucl Acids Res. 29, (23), 4793-4799 (2001).
  15. Staats, M., et al. Genomic treasure troves: Complete genome sequencing of herbarium and insect museum specimens. PLoS ONE. 8, (7), e69189 (2013).
  16. Bakker, F. T. Herbarium genomics: skimming and plastomics from archival specimens. Webbia. 72, (1), 35-45 (2017).
  17. Doyle, J. J., Doyle, J. L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bul. 19, 11-15 (1987).
  18. Allen, G. C., Flores-Vergara, M. A., Krasynanski, S., Kumar, S., Thompson, W. F. A modified protocol for rapid DNA isolation from plant tissue using cetryltrimethylammonium bromide. Nat Prot. 1, 2320-2325 (2006).
  19. Twyford, A. D., Ness, R. D. Strategies for complete plastid genome seqeuncing. Mol Eco Resour. (2016).
  20. Aird, D., et al. Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries. Genome Bio. 12, (2), R18 (2011).
  21. Bolger, A. M., Lohse, M., Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinf. 30, 2114-2120 (2014).
  22. Grigoriev, I. V., et al. MycoCosm portal: gearing up for 1000 fungal genomes. Nucl Acids Res. 42, (1), D699-D704 (2014).
  23. Langmead, B., Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat Meth. 9, (4), 357-359 (2012).
  24. McKain, M. R. Herbarium Genomics. Github Repository https://github.com/mrmckain/ (2017).
  25. McKain, M. R., Wilson, M. A. Fast-Plast: Rapid de novo assembly and finishing for whole chloroplast genomes. Github Repository https://github.com/mrmckain/ (2017).
  26. McKain, M. R., McNeal, J. R., Kellar, P. R., Eguiarte, L. E., Pires, J. C., Leebens-Mack, J. Timing of rapid diversification and convergent origins of active pollination within Agavoideae (Asparagaceae). Am J Bot. 103, (10), 1717-1729 (2016).
  27. McKain, M. R., Hartsock, R. H., Wohl, M. M., Kellogg, E. A. Verdant: automated annotation, alignment, and phylogenetic analysis of whole chloroplast genomes. Bioinf. (2016).
  28. Staton, S. E., Burke, J. M. Transposome: A toolkit for annotation of transposable element families from unassembled sequence reads. Bioinf. 31, (11), 1827-1829 (2015).
  29. Bao, W., Kojima, K. K., Kohany, O. Repbase Update, a database of repetitive elements in eukaryotic genomes. Mobile DNA. 6, (1), 11 (2015).
  30. McKain, M. R. Transposons. Github Repository https://github.com/mrmckain/ (2017).
  31. Weiß, C. L., et al. Temporal patterns of damage and decay kinetics of DNA retrieved from plant herbarium specimens. Royal Soc Open Sci. 3, (6), 160239 (2016).
  32. Sawyer, S., Krause, J., Guschanski, K., Savolainen, V., Pääbo, S. Temporal patterns of nucleotide misincorporations and DNA fragmentation in ancient DNA. PLoS ONE. 7, (3), e34131 (2012).
  33. Head, S. R., et al. Library construction for next-generation sequencing: overviews and challenges. BioTechniques. 56, (2), 61-64 (2014).
  34. Grover, C. E., Salmon, A., Wendel, J. F. Targeted sequence capture as a powerful tool for evolutionary analysis. Am J Bot. 99, 312-319 (2012).

Comments

1 Comment

  1. Thanks for this video!

    Reply
    Posted by: Anony m.
    August 25, 2018 - 10:13 AM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics