Sağlam DNA izolasyon ve yüksek işlem hacmi sıralama kitaplığı inşaat sulak numuneler için

* These authors contributed equally
Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Bu makalede, DNA izolasyon ve yüksek işlem hacmi sıralama kitaplığı inşaat sulak malzeme son derece kalitesiz DNA'ın kurtarma dahil olmak üzere ayrıntılı bir protokol gösterilir.

Cite this Article

Copy Citation | Download Citations

Saeidi, S., McKain, M. R., Kellogg, E. A. Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens. J. Vis. Exp. (133), e56837, doi:10.3791/56837 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Herbaria biyolojik çalışmalar çeşitli kullanılan bitki materyali paha biçilmez bir kaynaktır. Sulak örnekler kullanımı zorlukları örnek koruma kalitesi, bozulmuş DNA ve nadir örneklerin yıkıcı örnekleme dahil olmak üzere, bir dizi ile ilişkilidir. Daha etkili bir şekilde sulak malzeme büyük sıralama projelerde kullanmak için güvenilir ve ölçeklenebilir yöntemi DNA izolasyon ve Kütüphane hazırlanması gereklidir. Bu kağıt bir sağlam, başına sonuna protokol değişikliği için bireysel örnekleri gerektirmeyen DNA izolasyon ve yüksek işlem hacmi Kütüphane yapımı için sulak örnekler üzerinden gösteriyor. Bu iletişim kuralı, Kütüphane boyutu seçimi değiştirme ve düşük verim kitaplıkları için bir isteğe bağlı reamplification adım tanıtımı doku kabuğu optimize ederek düşük kaliteli kurutulmuş bitki malzeme ve alır avantajı mevcut yöntemler için hazırlanmıştır. Reamplification düşük verim DNA kütüphanelerinin yeri doldurulamaz ve potansiyel olarak değerli sulak numuneler, ihtiyaç için ek yıkıcı örnekleme ve fark edilebilir sıralama önyargı için ortak tanıtımı olmadan inkâr türetilen örnekleri kurtarabilirsiniz Filogenetik uygulamaları. Protokol çim türleri yüzlerce üzerinde test edilmiştir, ancak doğrulama sonra diğer bitki soy kullanmak için adapte olması bekleniyor. Bu iletişim kuralı nerede parçaları istediğiniz boyuta aralığında var olmayan, son derece bozulmuş DNA ve temiz DNA izolasyon inhibe Sekonder metabolitler bazı bitki malzeme mevcut sınırlı olabilir. Genel olarak, bu protokol bırakmak için DNA izolasyon ve az 13 h, 24 örnekleri kitaplığı hazırlanması sadece 8 h minimal değişiklikler ile aktif uygulamalı zaman ile hızlı ve kapsamlı bir yöntem sağlar.

Introduction

Sulak koleksiyonları tür ve genomik çeşitlilik filogenetik1,2,3, Populasyon genetiği4,5, koruma çalışmaları için potansiyel olarak değerli bir kaynaktır Biyoloji6, istilacı türlerin Biyoloji7ve özellik evrim8. Zengin bir çeşitlilik türlerin, nüfus, coğrafi yer ve zaman puan elde etmek için yeteneğini sulak olduğunu "hazine sandığı"9 vurgulamaktadır. Tarihsel olarak, bozulmuş doğa sulak elde edilen DNA PCR tabanlı projeler genellikle yalnızca bölgeleri kloroplast genom veya ribozomal, iç kopya etmek Rondela (ITS) gibi yüksek bir kopyasını buldum işaretçileri kullanarak araştırmacılar relegating engel RNA. Örnekler ve DNA kalitesini kapsamlı koruma9,10, çift iplikçikli sonları ve parçalanma hasar en yaygın formları olmak, oluşturma kurutma işleminde kullanılan ısı ile yöntemleri göre değişir sözde % 90'ı DNA kilit-up bu çalışmalar PCR tabanlı11ipotekli. Parçalanma bir yana, ikinci en yaygın sulak genomik kirlenme, bu endophytic mantarlar13 türetilmiş veya mantar toplama sonra ama yine de içinde sulak12, montaj önce öldükten sonra edinilen gibi sorundur Bu sorun çözüldü bioinformatically şu mantar veritabanı (aşağıya bakın) verilen olabilir. Üçüncü ve daha az yaygın bir sorun ile sitozin Deaminasyon (C/G→T/A)14, sıra değişiklik olsa da sulak numuneler11' (~ %0,03) düşük olduğu tahmin edilmektedir. Yüksek işlem hacmi sıralama (HTS) gelişiyle, parçalanma sayısında kısa okuma ve düşük kalitesi ile çok sayıda numune üzerinden genomik düzeyinde veri toplama izin sıralama derinliği12,15, üstesinden gelebilir DNA ve hatta bazen tüm genom sıralama15erişimine izin verme.

Sulak örnekleri daha sık kullanılan olma ve filogenetik projeleri16büyük bir bileşenidir. HTS için sulak örnekler kullanarak geçerli bir meydan okuma tutarlı bir şekilde yeterli çift telli DNA, sıralama iletişim kuralları için gerekli bir ön koşul zamanında, çok sayıda tür yöntemleri birey için optimize etmek gerek kalmadan almaktır numuneler. Bu yazıda, bu mevcut yöntemlerden yararlanır ve onlara hızlı ve yinelenebilir sonuçları için izin vermek için değiştirir DNA ekstraksiyon ve Kütüphane sulak numunelerin hazırlanması için bir iletişim kuralı gösterilmiştir. Bu yöntem için tam 13 h, 8 h uygulamalı zamanla veya isteğe bağlı reamplification adım gerekli olduğunda 9 h uygulamalı zamanla 16 h 24 örnekleri kitaplığına örnek işleme sağlar. Daha fazla örnek aynı anda işleme ulaşılabilir, olsa da santrifüj kapasitesi ve teknik beceri sınırlayıcı faktördür. Protokol yalnızca tipik labaratuar donanımları (thermocycler, santrifüj ve manyetik duruyor) Nebulizatör veya sonicator, gibi özel ekipman yerine DNA kesme için gerektirecek şekilde tasarlanmıştır.

DNA kalite, parça boyutu ve miktar faktörler sulak örneklerin yüksek üretilen iş sıralama deneylerde kullanmak için sınırlı hale gelir. Sulak DNA izole ve yüksek işlem hacmi sıralama kitaplıkları oluşturmak için diğer yöntemleri 10 kadar az kullanma belgili tanımlık yarar göstermiştir ng DNA16; Ancak onlar deneysel olarak PCR optimum sayısını belirleme gerektiren bir kütüphane hazırlık için gerekli geçer. Son derece küçük miktarlarda uygun çift ile ilgili DNA (dsDNA), telli birkaç sulak numune yalnızca bir tek kitaplık hazırlık için yeterli DNA üretmek gibi bu pratik olur. DNA yok Kütüphane optimizasyonu adımda kayıp burada sunulan yöntem döngüleri örnek kalite, ne olursa olsun tek bir sayı kullanır. Bunun yerine, kitaplıkları sıralama için gerekli minimum tutarları uygun olmayan bir reamplification adım çağrılır. Birçok sulak örnekleri nadirdir ve sahip küçük malzeme birçok durumda yıkıcı örnekleme haklı zorlaştırır. Bu karşı sunulan Protokolü sağlar dsDNA giriş boyutları daha az 1,25 ng Kütüphane hazırlık sürecine yüksek üretilen iş sıralama ve örneklerin yıkıcı örnekleme gereksinimini en aza indirilmesi için uygun örnekleri kapsamını genişletiyor.

Aşağıdaki iletişim kuralı otlar için en iyi duruma getirilmiş ve protokol başka birçok bitki gruplarına uygulanabilir beklemek rağmen sulak örnekleri, farklı türlerin yüzlerce test. Düşük kaliteli ve/veya nadir örnekleri kaydetmek için kullanılan bir isteğe bağlı kurtarma adım içerir. Test iki yüz sulak numuneler üzerinde bağlı olarak, bu protokol bırakmak nadir örnekleri minimal yıkıcı örnekleme yoluyla korunması için numuneler ile düşük doku girdi ve kalite, çalışır. Burada bu protokolü phylogenomics tabanlı projeler için sıralı kaliteli kitaplıkları sağlayabilir gösterilir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. başlangıç önce

  1. CTAB, polyvinylpyrrolidone (PVP) 40, 100,0 mL 1 M Tris pH 8.0, 0, 5 M ethylenediaminetetraacetic asit (EDTA) pH 8.0, 280,0 mL 40 mL 5 10 g 20 g ekleyerek taze setil trimethylammonium bromür (CTAB) arabellek17 olun M NaCl ve 400.0 mL reaktif su birlikte, Toplam hacim 1 L reaktif sınıf kullanarak su getir. 8,0 pH ayarlayın.
    Not: Ek reaktifler CTAB için bireysel takson olarak ikincil bileşikler bağlı olarak ilave edilebilir. Allen ve ark. görmek 18 katkı Kimyasalları kapsamlı bir listesi için.
  2. β-mercaptoethanol 5 mL CTAB arabellek de başına 10 µL ekleyin.
    Not: Bu 50 mL toplu olarak hazırlanan ve 3-4 hafta için oda sıcaklığında saklanan.
    1. Isı 65 ° C su banyosu CTAB çözümde.
  3. Harçlar ve en az 20 dakika-20 ° C'de dibekler chill.
  4. 2 n 2 mL tüpler x 4 set etiket (burada n = örnekleri sayısı). 1 etiketli tüpler kümesi buza koy.
  5. İsopropanol buz üzerinde veya -20 ° C-dondurucu soğuk.
  6. Katı faz ters çevrilebilir immobilizasyon (SPRI) boncuk ( Tablo malzemelerigörmek) buzdolabından çıkarın ve oda sıcaklığında (en az 30 dk) equilibrate etmelerine izin.
  7. % 80 etanol hazırlayın.
  8. Sulak numuneler çıkarılması için seçmek ve ~ 1 cm2veya 10 mg, numune, tercihen yaprak malzeme başına doku almak.

2. DNA ekstraksiyon

  1. ~ 1 cm2 prechilled havan ve dibekler kullanarak önceden seçilmiş sulak doku eziyet. Sıvı azot ve 30-50 mg steril kum ekleyin. Doku ince toz haline döner kadar eziyet.
    Not: 10 mg veya daha fazla doku tercih edilir, ancak daha az Ayrıca bazı durumlarda çalıştı. Bir kere sıvı azot buharlaşır, daha fazla doku tamamen yere kadar gerektiği gibi ekleyin. Hücre ve doku için başka bir ortak yöntem boncuk çırpıcı kullanmaktır. Ancak, bu yöntem de bu deneylerde kullanılan numuneler için çalışmıyor bulundu.
  2. Donmuş toz (tüp 's birim fazla yarısını ekleyin) iki 2 mL tüpler içine aktarın. Sıcak CTAB çözüm 600 µL her boru ve tüpler inversiyon ve vortexing tarafından iyice karıştırın.
    Not: miktar ve sulak malzeme kalitesi ve sık sık düşük DNA izolasyon içinde iki tekrar performans daha yüksek verim elde etmek için yardımcı olur.
  3. 1 – 1,5 h, vortexing her 15 dakikada bir 65 ° C su banyosunda örnekleri kuluçkaya.
  4. Santrifüj örnekleri 10.000 x g 5 dakika süreyle de süpernatant etiketli tüpler (~ 500 µL) taze bir dizi Transfer. Standart olmayan klorlu elden çıkarma yordamı kullanarak Pelet atmak.
  5. 4 µL RNase-A (10 mg/ml) her tüp ve ters çevirme veya pipetting karıştırın. Bir ısı blok veya su banyoda 15dk için 37 ° C'de örnekleri kuluçkaya.
  6. Tüpler oda sıcaklığında alabilirseniz eşit bir birim (~ 500 µL) 25:24:1 fenol: kloroform: izoamil alkol karışımı ekleyin. Yukarı ve aşağı pipetting tarafından ve/veya inversiyon ile iyice karıştırın. Borular 12,000 x g 15 dakika süreyle de sulu katman (üst katman) için yeni bir set Transfer santrifüj tüpleri (~ 400 µL) etiketli. Organik katman klorlu atık konteyner içine atın.
    Not: Adım 2.6 tekrar ikincil bileşiklerin büyük miktarlarda bekleniyor Eğer bitki malzeme.
  7. Eşit bir birim (~ 400 µL) 24:1 kloroform: izoamil alkol karışımı ekleyin. Yukarı ve aşağı pipetting tarafından ve/veya inversiyon ile iyice karıştırın. Borular 12,000 x g 15 dk. Transfer için de prechilled, etiketli tüpler (~ 300 µL) yeni bir set için sulu katman (üst katman) santrifüj kapasitesi. Organik katman klorlu atık konteyner içine atın.
  8. Eşit bir birim (~ 300 µL) 12 µL 2.5 M sodyum asetat ve prechilled isopropanol her tüp için ekleyin. Örnekleri-20 ° c 30-60 dk için kuluçkaya.
    Not: Kuluçka kez (kadar gece kuluçka) uzatılabilir ama DNA kalite artık örnekleri kuluçkaya azalacak.
  9. Dondurucu ve borular 12,000 x g 15 dakika süreyle de kaldırmak ve süpernatant yavaşça atmak Pelet bozmadan santrifüj numune al. Pelet tarafından süspansiyon taze % 70 etanol (yaklaşık 300-500 µL) ile yıkayın. Her iki katına örnek için iki bireysel granül etanol eşlik eden biriyle birleştirir.
    Not: Örnekleri etanol ilk kullanarak bir tüpe konsolide edilecek ve daha sonra devam edin. Her örnek etanol ile ayrı ayrı yıkamak gerekli değildir.
  10. 12.000 x g 10 dk. Kaldır, tüpler santrifüj kapasitesi ve süpernatant yavaşça Pelet bozmadan atın. Hava Kuru granül.
    Not: Örnekleri daha hızlı bir kuru sıcak blok kullanarak kurutulmuş (65 ° C fazla olamaz). Örnekleri değil aşırı kuru olduğundan emin olun, bu DNA son verimini düşürebilir.
  11. İzole DNA 1 x TE 50 µL içinde askıya alma. Uzun süreli depolama için-20 ° C-derin dondurucu veya kullanılmak üzere aşağıdaki hafta 4 ° C'de depolayın.

3. kalite kontrol (QC)

  1. Kalite kontrol için bir özel jel çalıştırın.
    1. 1 x Tris/Bor/EDTA (TBE) arabellek 54 g Tris Bankası, 27,5 g Borik asit ve 3.75 g EDTA ekleyerek disodyum tuzu, Toplam hacim 5 L reaktif sınıf su kullanarak getirerek hazırlayın.
    2. % 1'özel jel hazırlamak için 100 mL 1 1 g özel ekleyerek x TBE. Hiçbir özel görünene kadar çözüm mikrodalga. % 0,01 nükleik asit jel ekleyin ( Tablo malzemelerigörmek) leke. Dokunmak sıcak kadar şişesi soğumaya bırakın. Tarafından iyi karıştırma karıştırın. Özel bir jel tepsiye dökün ve bunun katılaşır kadar oturmak izin.
    3. Örnek 3 µL, reaktif sınıf su 2 µL ve boya yükleme x 6 1 µL karıştırın. Onların düzen belirterek örnekleri jel matris yükleyin.
    4. Örnekleri için 60-70 dk 60 – 70 V. Image'da UV ışık altında jel doğru pozlama ve odak ile çalıştırın.
      Not: smear genellikle DNA Bozulması gösterir iken açık yüksek molekül ağırlıklı bant varlığı yüksek kalitede DNA, bir ibret vardır. En sulak numuneler bozulmuş.
  2. DsDNA miktar analizler (çift miktarını belirlemek için malzemeler tablo bkz:) telli DNA.
    1. Örnek 2 µL çözümleme için kullanın.
      Not: en az miktarlarda olmak eğilimi olarak Dilutions sulak malzeme miktar analiz için gerekli değildir. Başarılı kitaplıkları kadar az 1.26 ng toplam dsDNA bu adım üzerinden yapıldı.

4. DNA kesme

Not: Bu ticari bir çift iplikçikli fragmentase en iyi duruma getirilmiş bir sürümüdür ( Tablo malzemelerigörmek) protokol.

  1. Yer dsDNA parçalanma enzim buzda vortexing için 3 sonra s.
  2. Bir steril 0.2 mL Polimeraz zincir reaksiyonu (PCR) tüp, mix 1 – 16 µL parçalanma tepki arabellek eşlik 2 µL DNA izole. Toplam hacim için 18 µL nükleaz boş su ekleyerek getir. 2 µL dsDNA parçalanma enzim ve girdap karışımı için 3 eklemek s.
    Not: Gerekli DNA'ın DNA toplama (AIM tüp 200 ng toplamda için) bağlı olarak değişebilir.
  3. 8,5 min için 37 ° C'de örnekleri kuluçkaya. Sonra 0,5 M EDTA 5 µL tüpler için ekleyin.
    Not: Bu adımı tepki sonlandırmak ve DNA örnekleri aşırı kesme önlemek için kuluçka dönemi bitti en kısa zamanda yapılması gerekiyor.

5. boncuk temizlik

  1. SPRI boncuk vortexing tarafından lunaparkçı.
  2. Yamultulmuş DNA hacmi 25 µL nükleaz boş su ekleyerek için 50 µL getir. Oda sıcaklığında SPRI boncuk (% 90 cilt) 45 µL yamultulmuş DNA ve mix 50 µL iyice yukarı ve aşağı pipetting tarafından ekleyin.
    Not: Toplam numune hacmi yüzde 90'ını boncuk ekleme kez 200 baz çifti aşağıda DNA parçalarının en küçüğü kaldırmak için yapılır.
  3. Örnekleri kuluçkaya 5 dk. tüpler manyetik tabağa koy ve onlara 5 dk. için dikkatli bir şekilde oturmak için izin kaldırmak ve süpernatant atın.
    Not: onlar istenen DNA hedefleri içeren boncuklar, rahatsız değil dikkatli olun.
  4. Taze % 80 etanol 200 µL iken manyetik stand tüpler ekleyin. 30 oda sıcaklığında kuluçkaya s ve o zaman dikkatle kaldırmak ve süpernatant. Bir kez bu adımı yineleyin. Hava tüpü kapağı açık manyetik ayaklıklı açıkken Boncuk 5 min için kuru.
    Not: boncuk aşırı kurutma önlemek. Bu DNA'ın alt kurtarma yol açabilir.
  5. Tüpler mıknatıs kaldırın. Boncuk DNA'dan 0.1 x TE 55 µL elute ve yukarı ve aşağı pipetting tarafından iyice karıştırın. 5 dk. yer tüpler manyetik stand için oda sıcaklığında kuluçkaya ve açmak belgili tanımlık eriyik için bekleyin (~ 2 dk) temizleyin.
  6. 52 µL süpernatant ile çekin. Bir DNA miktar analiz örnekleri kurtarma ve Kütüphane hazırlık gider ilk toplama kontrol için çalıştırın.
    Not: Kütüphaneler daha az 1,25 olarak tahmin toplam dsDNA ile yapılmış olan ng, yine de her durumda reamplification gerekli.

6. Kütüphane hazırlık

Not: Bu bir ticari olarak mevcut Kütüphane seti değiştirilmiş bir versiyonu olduğunu (bakınız Tablo reçetesi Protokolü).

  1. Son hazırlık
    1. 3 µL endonükleaz ve enzimler takip fosfat ve reaksiyon arabellek temizlenmiş, yamultulmuş DNA'ın 50 µL eşlik 7 µL ekleyin. Yukarı ve aşağı pipetting tarafından iyice karıştırın. Kabarcıklar kaldırmak tüplere spin.
      Not: Toplam hacmi 60 µL olmalıdır.
    2. Aşağıdaki programı ile bir thermocycler örnekleri yer: 20 ° C, 65 ° C'de 30 dk, 30 dk sonra 4 ° C'de tutun
      Not: Isıtmalı kapak ≥75 ° C kuruldu
  2. Adaptör ligasyonu
    1. 25-50 kat adaptör seyreltik (0,6 – 0.3 konsantrasyon adaptör çalışma µM). Tüp ligasyonu ana karışımı 30 µL, 1 µL ligasyonu artırıcı ve yüksek-den geçerek kısa okuma sıralama için adaptör 2.5 µL tüpler için ekleyin.
      Not: Toplam hacim 93,5 µL olmalıdır.
    2. Yukarı ve aşağı pipetting tarafından iyice karıştırın. Kabarcıklar kaldırmak tüplere spin. 15 dakika 20 ° C'de tüpler kuluçkaya.
    3. 3 µL urasil DNA glycosylase (UDG) ve DNA glycosylase-liyaz endonükleaz VIII ticari karışımı ekleyin ( Tablo malzemelerigörmek) tüpler için. Toplam hacim 96,5 olduğundan emin µL. iyice karıştırın ve bir thermocycler kullanarak 15dk için 37 ° C'de kuluçkaya.
      Not: Kapağı olmalıdır küme ≥47 ° C. Ticari iletişim kuralı özgün sürümü boyutu seçimi son adımı olarak bir boncuk temizlik ardından adaptör ligasyonu adım sonra sahiptir. Daha yüksek verim elde, bu iletişim kuralı aşağıdaki adımları sırasını geçirir ve Boyut seçimi son bir adım olarak uygular.
  3. Enzimler ve küçük parçalarını kaldırmak için Temizleme
    1. Manyetik boncuklar tarafından vortexing homojenize.
    2. SPRI manyetik boncuklar (% 80 cilt) 78 µL ve yukarı ve aşağı pipetting tarafından iyice karıştırın.
      Not: çoğu kez 250 baz çifti kısa en küçük DNA parçalarının kaldırmak için toplam numune hacmi % 80'i boncuk ekleme yapılır. Küçük DNA parçalarının daha sıkı (i) ihtiyaç fazlası adaptörleri kaldırmak ve (ii) daha büyük parçaları aşağıdaki adımlarda amplifikasyon vurgulamak için çıkartılmasıdır.
    3. 5 dk. tüpler 5 dakika süreyle manyetik bir plaka üzerinde dikkatle kaldırmak ve istediğiniz boyuta aralığın dışındaki DNA içeren süpernatant yerine örnekleri kuluçkaya izin.
      Not: istediğiniz DNA hedefinde boncuk değil rahatsız etmek için dikkatli olun.
    4. Taze % 80 etanol 200 µL iken manyetik stand tüpler ekleyin. 30 oda sıcaklığında kuluçkaya s ve o zaman dikkatle kaldırmak ve süpernatant. Bir kez bu adımı yineleyin. Hava Kuru Boncuk 5 min için tüp manyetik stand ile kapak açık iken.
      Not: boncuk kurutma üzerinde kaçının. Bu DNA'ın alt kurtarma yol açabilir.
    5. Tüpler mıknatıs kaldırın. 0.1 x TE 17 µL ekleyerek boncuk DNA hedef elute ve yukarı ve aşağı pipetting tarafından iyice karıştırın.
    6. 5 dk. yer tüpler manyetik stand için oda sıcaklığında kuluçkaya ve açmak belgili tanımlık eriyik için bekleyin (~ 2 dk) temizleyin.
    7. 15 µL süpernatant ile çekin.
  4. PCR güçlendirme
    1. Yüksek sadakat PCR ana Mix 25 µL, 5 µL Kütüphane hazırlık 5' astar sıralama yüksek üretilen iş kısa okuma ve yüksek-den geçerek kısa okuma sıralama kitaplığı hazırlık 3' astar, 5 µL temizlenmiş adaptör bakmaksızın DNA'ın 15 µL ekleyin.
      Not: Toplam hacmi 50 µL olmalıdır.
    2. De vortexing tarafından karıştırın. Tablo 1' de bulunan ayarları kullanarak bir thermocycler örnekleri yerleştirin: Thermocycler amplifikasyon ayarı.
      Not: Devir çok sayıda giriş DNA düşük miktar nedeniyle gereklidir.
Döngüsü adım Temp. Zaman Döngüleri
İlk denatürasyon 98 ° C 30 s 1
Denatürasyon 98 ° C 10 s 12
Tavlama/uzantısı 65 ° C 75 s 12
Son uzantısı 65 ° C 5 dk 1
Basılı tutun 4 ° C

Tablo 1: PCR protokol denatürasyon, tavlama ve uzantısı kez ve sıcaklıklar. Sıcaklık ve kez bu protokol için sunulan reaktifler için optimize. Reaktifler değişmiş, sıcaklık ve kez tekrar optimize edilmelidir.

  1. İstenen Kütüphane boyutu için Boyut seçimi
    Not: Bu boncuk adım parçaları hedef aralığı altında ve üstünde kaldırır.
    1. SPRI boncuk vortexing tarafından lunaparkçı.
    2. 25 µL (% 50 cilt) oda sıcaklığında manyetik boncuklar ve yukarı ve aşağı pipetting tarafından iyice karıştırın. Örnekleri kuluçkaya 5 dk. tüpler manyetik tabağa koy ve onlara 5 dk. için dikkatli bir şekilde oturmak için izin ve süpernatant etiketli tüpler yeni bir dizi transfer çıkarın.
      Not: Bu ses seviyesi istenen Kütüphane boyutu temelinde ayarlanabilir. Süpernatant istediğiniz boyuta DNA parçaları içerir. İlk boncuk kuluçka içinde boncuklar daha büyük kütüphane parçaları bağlayıcıdır. Bunlar o 400-600 baz çifti aralıktaki odaklanmak için kaldırılır. Süpernatant daha küçük parçaları içerir.
    3. Oda sıcaklığında SPRI boncuk 6 µL süpernatant için iyice yukarı ve aşağı pipetting tarafından ekleyip karıştırın. İzin için 5 dk. tüpler manyetik tabağa koy ve 5 min için oturmak izin örnekleri kuluçkaya.
      Not: Bu ses seviyesi adım 6.5.2 uygun olarak istenilen Kütüphane boyutu temelinde ayarlanabilir.
    4. Dikkatle kaldırmak ve süpernatant.
      Not: istediğiniz DNA içeren boncuk değil rahatsız etmek için dikkatli olun. İkinci boncuk kuluçka içinde boncuklar ilk kaldırma en büyük DNA parçaları sonra kalan parçaları için bağlayıcıdır. Bu parçaları genellikle istenen boyut aralığında kümesidir.
    5. Taze % 80 etanol 200 µL iken manyetik stand tüpler ekleyin. 30 oda sıcaklığında kuluçkaya s, o zaman dikkatle kaldırmak ve süpernatant. Tekrar ediyorum. Hava Kuru Boncuk 5 min için tüp manyetik stand ile kapak açık iken.
      Not: boncuk aşırı kurutma önlemek. Bu DNA'ın alt kurtarma yol açabilir.
    6. Tüpler mıknatıs kaldırın. Boncuk DNA hedeften 0.1 x TE 33 µL elute ve yukarı ve aşağı pipetting tarafından iyice karıştırın.
    7. 5 dk. yer tüpler manyetik stand için oda sıcaklığında kuluçkaya ve açmak belgili tanımlık eriyik için bekleyin (~ 2 dk) temizleyin. (Bkz. Tablo reçetesi) 2 mL tüpler için depolama için 30 µL süpernatant ve transfer çekin.
      Not: Kütüphaneler, uzun süreli depolama için-20 ˚C tutulabilir.
  2. Kalite kontrol
    1. DNA arşivini kalite kontrol testi. 3.1 ve 3.2 adımlarına bakın.
      Not: DNA kitaplıkları için 96 V ~ 45 dk için jel çalıştırın.
  3. Kütüphane reamplification: isteğe bağlı kitaplık miktar yeterli değil.
    Not: Örnekleri kitaplığına konsantrasyonları altında 10 ile nM reamplified aşağıdaki adımları kullanarak. Reamplification düşük konsantrasyon kütüphanelerin sıralama için uygulanabilir sonuçlar elde edebilirsiniz, ancak reamplification toplanan veri (Tablo 3) bu belirli ölçümleri için önemsiz olduğunu göstermektedir rağmen temel kompozisyon çeşitlilik, mütevazı bir kayma neden olabilir .
    1. 10 kat 0.1 x TE kullanarak evrensel reamplification astar sulandırmak.
    2. Yüksek sadakat PCR ana Mix 25 µL, 5 µL seyreltilmiş evrensel reamplification astar 1 (AATGATACGGCGACCACCGA) ve 5 µL seyreltilmiş evrensel reamplification astar 2 (CAAGCAGAAGACGGCATACGA) düşük konsantrasyon kütüphanelerin 15 µL ekleyin. Not: Toplam hacim 50 µL olmalıdır.
    3. De vortexing tarafından karıştırın. Tablo 1' de bulunan ayarları kullanarak bir thermocycler örnekleri yerleştirin: Thermocycler amplifikasyon ayarı
      Not: Devir çok sayıda giriş DNA düşük miktar nedeniyle gereklidir.
    4. Boncuk temizlik
    5. SPRI boncuk vortexing tarafından lunaparkçı. Oda sıcaklığında SPRI boncuk (% 90 cilt) 45 µL ve yukarı ve aşağı pipetting tarafından iyice karıştırın.
    6. 5 dk. 5 min için manyetik bir tabakta tüpler koymak için kuluçkaya örnekleri ver.
    7. Dikkatle kaldırın ve istenmeyen DNA içeren süpernatant.
      Not: istediğiniz DNA hedefinde boncuk değil rahatsız etmek için dikkatli olun.
    8. Taze % 80 etanol 200 µL iken manyetik stand tüpler ekleyin. 30 oda sıcaklığında kuluçkaya s ve o zaman dikkatle kaldırmak ve süpernatant. Bir kez bu adımı yineleyin.
    9. Hava tüpü kapağı açık manyetik ayaklıklı açıkken Boncuk 5 min için kuru.
      Not: boncuk aşırı kurutma önlemek. Bu DNA hedef alt kurtarılması neden olabilir.
    10. Tüpler mıknatıs kaldırın. Boncuk DNA hedeften 0.1 x TE 33 µL elute ve yukarı ve aşağı pipetting tarafından iyice karıştırın.
    11. 5 dk. yer tüpler manyetik stand için oda sıcaklığında kuluçkaya ve açmak belgili tanımlık eriyik için bekleyin (~ 2 dk) temizleyin.
    12. 30 µL süpernatant ile çekin. Uzun süreli depolama için-20 ° C'de kitaplık depolanabilir.
  4. Kalite kontrol
    1. DNA arşivini kalite kontrol testi. 3.1 ve 3.2 adımlarına bakın. DNA kitaplıkları için 96 V ~ 45 dk için jel çalıştırın.
      Not: Çift Kişilik bir grup içinde jel görüldüğünde, bu büyük olasılıkla bir reamplification adım yorgunluktan astar sonucudur. Bantları 6,9 yinelenen, ancak Tablo 1' de tasvir PCR programda yalnızca bir döngüsü kullanılarak kaldırılabilir.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

DNA izolasyonu ve son Kütüphane verim
Bu çalışmada, sulak DNA izolasyonu ve yüksek kaliteli sıralama kitaplıkları kurtarılması için iletişim kuralı etkinliğinin 1920 en eski ve en küçük 2012 (Tablo 2) ile 50 farklı örnekleri kullanarak gösterilmiştir. Her örnek için yaklaşık 10 mg yaprak doku DNA izolasyon için kullanıldı. Yeşil yaprak dokusu varsa tercih ve hiçbir doku bariz mantar kirlenme ile seçilmiştir. Verim düşük olması beklenmelidir rağmen başarılı izolasyonların sarı veya kahverengi doku kullanılarak yapılabilir. Çift Kişilik toplam 3.56 değişiyordu ilk yalıtım gelen DNA (dsDNA) telli 2.610 ng ng. Beklendiği gibi sulak örnekler elde edilen DNA son derece bozulmuş (şekil 1A, Supplemental şekil 1). Bir kısmı bu izolasyonların enzimatik (1,26 – 464 ng) kesme için kullanılmıştır. Sulak DNA zaten nın korunması sürecinde yaşadığı rağmen genel kütüphane verimi artırmak için ek kesme optimizasyonu Protokolü gerektirir. DsDNA sonrası yamultma toplam kurtarma arasında değişiyordu < %1 %51 daha az 1,25 minimum olarak sonuçlanan giriş dsDNA DNA Kütüphane hazırlık ve 328 maksimum için başlatma ng ng. DNA, aşırı kaybına bazı örnekleri DNA enzimatik kesme (şekil 1A, tamamlayıcı şekil 1) önce çoğunu zaten küçük parça boyutu bağlanabilir. % 90 birim boncuk Temizleme tarihinde yamultulmuş DNA kullanımı bilerek daha büyük, daha çekici parçası boyutları için zenginleştirmek için DNA'ın en küçük parçaları kaldırıldı. Bu küçük parçaları özellikle yoğun bir sinyal (şekil 1A) 100 baz çifti işareti tarafından gösterilen örnek TK463, TK657 ve TK694, görüldü.

Kütüphane yazı boyutu seçimi toplam miktarı arasında değişiyordu 1.425 942.5 ng ng (Tablo 2, ek tablo 1). 23 örnekleri için ilk çıkarma ve Kütüphane hazırlama kitaplığı yeterli miktarda vermemiştir (< 10 nM; 14 – 680 x içinde kaynaklanan bu örnekler iletişim kuralı, reamplification ve kurtarma adımları tabi tutuldu bu yüzden Tablo 2, ek tablo 1), (Tablo 2, ek tablo 1) toplam kitaplığında artırmak. 350 ve 500 baz çifti (şekil 1B, Supplemental Şekil 2) arasındaki bir grupta son kütüphaneleri sonuçlandı. Zaman zaman, beklenen Kütüphane boyutundan daha büyük ikinci bir grup görüldü (şekil 1B, Supplemental Şekil 2). Bu olay ne zaman reamplification PCR kullanılabilir astar bitkin ve Kütüphane adaptörleri homolog olmayan DNA parçalarının tavlama başladı. Bu nerede biter (adaptör) düzgün tavlama, DNA ekleme yaptım ama olmadı bir molekül oluşturur. Jel matris daha yavaş hareket ettikçe bu "bubbled" molekül üzerinde bir jel, daha büyük ortaya çıktı. Tavlama bu hatalar zaten reamplified kitaplığından başka bir reamplification reaksiyon hazırlama ve tek bir döngüsü için çalışan tarafından tespit edildi. Bu tek döngüsü astar uygun tavlama ve güçlendirme, ikinci grup (tamamlayıcı şekil 3) kaldırma için sağlanan.

Reamplification kütüphanelerin kolaylaştırdı son kitaplığına konsantrasyonları en az 10 nM. Bu konsantrasyonlarının eşit Derişim ve eşit olmayan örnek kalite ile ortaya çıkmıştır sorunları inkâr etmek için yardımcı ve Kütüphane verim sıralama içinde havuzlu eşit temsil seyreltilmiş için kitaplıklar izin. Bir projenin amacı kloroplast genom ise sıralama, sonra sıralama toplam miktarı farklı soy değişir ve doku kloroplast DNA19kaynaklanan okuma toplam yüzdesi olarak farklılık gösterir. Genellikle, 50-100 x kloroplast genom öngörülen kapsama derleme için yeterli ve sıralama çalıştırır türler ve sıralama yöntemi bağlı olarak en çok 70 bireyler dahil etmek için havuza alınmış.

Kirlenme, önyargı ve Reamplification tarafından neden varyasyon için test
HTS sıralama için önemli bir endişe önyargı geniş PCR güçlendirme20kitaplıklarınızın içine giriştir. Reamplification etkilerini sınamak ve sulak malzemenin olası önyargı ortak filogenetik uygulamaları tanımlamak için biz aynı seyreltilmiş Kütüphane 1:5 ve reamplified (belirlenen TK686-R) ile başarıyla sıralanmış bir kitaplığı (TK686) göre. Her iki TK686 ve TK686-R üzerine bir Illumina HiSeq4000 University of Illinois Roy J. Carver biyoteknoloji Merkezi ve Michigan State Üniversitesi Araştırma teknoloji Destek Merkezi, sırasıyla sıralı, eşleştirilmiş sonunda 150 baz çifti kullanılarak (bkz: okur Tablo 3 sıralama Ayrıntılar için). Ham okuma NCBI SRA (SRP128083) yatırmış. Okuma NF'leri adaptör sırası, kaliteli bir ortalama phred puanı kayar pencere, 10 bir baz çifti için 20 için filtre uygulama kullanılarak adaptör düzeltme de dahil olmak üzere Trimmomatic v.0.3621 kullanarak temizlenmiştir ve en az 40 baz çifti boyutunu kesti. Mantar kirlenme sulak numuneler ile birincil sorunlardan biri olarak kirlenme okuma JGI MycoCosm mantar genom veritabanı22 (312 nükleer genleri ve 79 mitokondrial genom) bir kısmını karşı eşleyerek tahmin edilmiştir bowtie2 v kullanarak . 2.2.9 "çok duyarlı-yerel" parametre kümesi kullanarak23 . TK686 ve TK686-R kitaplıkları nükleer mantar kirlenme ayırt edilemez (%9,24 ve %9.68, sırasıyla) ve mitokondrial mantar kirlenme (%0,94 ve % 0.8) (Tablo 3). Bu sadece bir örnek olmasına rağmen sulak örnekleri mantar kirlenme ihmal edilebilir değildir ve sulak elde edilen sıra veri kullanmadan önce kaldırılması gerektiğini öneririz. Belirlemek ve mantar kirlenme kaldırmak için kullanılan komutlar ve veritabanı M. R. McKain'ın GitHub repository sulak genomik24bulunur.

Kloroplast genom sıralama Filogenetik analizi için yaygın olarak kullanılan ve sulak numuneler giderek kaynak malzeme12olarak kullanılır. Kloroplast genom derlemede reamplification kalitesini test etmek için kloroplast genleri TK686 ve TK686-R için Poales için ayarla papyon dizini olan Fast-Plast v.1.2.525 altında varsayılan ayarları kullanarak monte. Tam kloroplast genom TK686-R için elde edildi, ama daha düşük okuma derinliği nedeniyle yedi contigs içine TK686 kloroplast genom toplandı. TK686 contigs el ile McKain vd. takip toplandı 26 tam olarak birleştirilmiş kloroplast genleri birbirine bir hizalama GUI tabanlı yazılım uyumlu ( Tablo malzemelerigörmek) ve derlemeleri arasında varyasyon değerlendirildi. Toplam 12 SNPs ve bir Indel kloroplast derlemeler için TK686 ve TK686-r arasında tespit edildi Her değişken için hem TK686 hem de TK686-r okuma kümeleri içinde kapsama değerlendirildi Her durumda, en yaygın değişken aynı iki kitaplıkları arasında yapıldı. TK686 bir T→C, bir G→A, bir G→T, bir G→, bir C→A, bir T→A ve dört C→A değişik gösterdi. Bu çeşitleri beşi derleme içine onların birleşme sonucu sıralama hatası ve düşük genel kapsama olabilir düşündüren bir homopolymer dize içinde oluştu. Diğerleri kloroplast haplogrubundan değişme miktarı, sıralama hatası, ya da sitozin Deaminasyon sonucu veya bu faktörlerin bir bileşimi olabilir. TK686-R bir C→T, bir G→T ve bir A→G vardı. C→T ve G→T türevleri yukarıdaki gibi bir homopolymer bulundu. Sonuçta, her iki okuma kümelerinden aynı tam kloroplast genleri tespit edilmiştir. Tek kloroplast genom TK686 üzerinden yemyeşil21 kullanarak ve kıyasla kabile Andropogoneae diğer üyelere açıklama. Tüm standart kloroplast özellikleri açıklamalı: 8 rRNA'lar, 38 tRNA ve 84 protein kodlama genler. Tam kloroplast genom GenBank (MF170217) ve yemyeşil27edinilebilir.

Kütüphanelerin reamplification üzerinden olası önyargı da tahmini yüzde GC ve toplam tahmini transposon içeriği ile tespit edilmiştir. Yüzde GC bir özel komut dosyası24kullanarak tahmin edilmiştir. İki örnek GC içeriğini farklılıkları %49,7 GC içinde TK686 ve TK686-R. %51.2 GC ile ihmal edilebilir Transposon kompozisyon Transposome28kullanarak tahmin edilmiştir. Her iki kütüphane için 100.000 okur rastgele subsampled ve transposon kompozisyon kullanarak 90 yüzde bir kimlik, 0,55 kesir kapsamında, 100 küme boyutunu tahmin edilmiştir ve29RepBase 21,10 çim tekrar başvuru oluşturun. Bu transposon tahmin bu veri kümesinden gelen önyükleme gerçekleştirmek için 100 kez tekrarlandı. Büyük Alt familyaya için toplam genom oranlarda Transpozonlar Transposome çıktısı elde ve ortalama ve standart sapma için 100 çoğaltır bu tahmin edilmiştir. Bu çıktıların oluşturmak için kullanılan tüm komut dosyalarının M. R. McKain'ın Github repository Transpozonlar30bulunabilir ve tüm-den sonuçlanmak içinde orman perisi (doi:10.5061/dryad.r8t2m) yatırılır. İki en yaygın transposon Alt familyaya (Copia ve çingene uzun terminal tekrar retrotransposons) göstergeleri olarak kullanarak, sonuçları 24.83 ± 33.52 ± %4,00 ve 31.68 %2.94 ± ve çingene olarak Copia ile hemen hemen aynı %2.72 ve 24.00 ± %2,35 TK686 ve TK686-R, sırasıyla (Tablo 3). Bunlar test sonuçları reamplification adım bu protokol için üst düzey genom ölçümleri anlamlı sıralama önyargı oluşturmak değil öneririz. Ancak, bu tek örnek tüm reamplified kütüphanelerin tam temsilcisi olmayabilir unutulmamalıdır. Bu tek test reamplification adım doğal olarak TK686/TK686-R. genom ölçümleri kutuplama yapıldı değil olduğunu gösterir Tanıtılan önyargı sıralama yeterli kapsama verilen kloroplast genom Meclisi etkilemeyeceği ancak deneyler, TK686/TK686-r, bu çalışmada sunulan gibi önyargı olmadığını doğrulamak için hedef soy yapılmaktadır önerilir olan öğe çeşitlilik araştıran çalışmalar sırasında meydana gelen.

Figure 1
Resim 1: özel jel görüntüleri a) DNA izolasyon ve on sulak numuneler B) final sıralama kitaplıklardan. Her lane için DNA veya kitaplığın 3 µL kullanıldı. (A)DNA tarafından genel smear görüldüğü gibi tüm sulak izolasyonların bozulmuş. (B) Final sıralama kitaplıkları 300-500 baz çifti 200-1000 baz çifti daha geniş bir dağıtım ile bir birincil grup tasvir; İkinci reamplified kütüphanelerde daha prevalandir. Şerit için her iki (A) ve (B) örnek tarafından tespit edilmiştir ve sonuçları Tablo 2' deki karşılaştırılabilir. Merdiven boyutu baz çifti (bp) olarak tasvir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Resim 2 : Dairesel arsa Schizachyrium scoparium (TK686) kloroplast genom ek açıklama. Tam olarak birleştirilmiş genom sulak elde edilen DNA'ın shotgun sıralama gelen 139,296 baz çifti (bp), bir büyük tek kopya bölgesinin (LSC) 81,401 toplam uzunluğu sergilenen bp, ters tekrar bölgesi (IR) 22,669 bp ve 12,557 bir küçük tek kopya bölgesinde (SSC) Kan basıncı. Tüm standart protein kodlayıcı genlerin, tRNA ve rRNA'lar Andropogoneae kabilesinin üyeleri için ek açıklama tespit edilmiştir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Tablo 2: DNA ekstraksiyon ve Kütüphane hazırlama sonuçları on sulak örnekleri ve dört reamplified kitaplık. Toplam çift iplikçikli DNA çeşitli adımlar iletişim kuralında gösterdi nasıl değişken kalite, özellikle boyut için filtre uygulanmış olabilir. Bu tabloyu indirmek için buraya tıklayınız.

Tablo 3: TK686 ve reamplified TK686R için istatistikleri sıralama. Reamplification mantar genom kirlenme, GC içerik tahmini, transposon kompozisyon tahmini veya tüm kloroplast genleri araya yeteneği genel insidansı etkilemez. Bu tabloyu indirmek için buraya tıklayınız.

Ek tablo 1: DNA ekstraksiyon ve Kütüphane hazırlama sonuçları yirmi reamplified kütüphaneler de dahil olmak üzere kırk ek sulak örnekleri için. Toplam çift iplikçikli DNA çeşitli adımlar iletişim kuralında gösterdi nasıl değişken kalite, özellikle boyut için filtre uygulanmış olabilir. Bu tabloyu indirmek için buraya tıklayınız.

Tamamlayıcı şekil 1: özel jel görüntüleri sulak örnekler üzerinden kırk ek DNA izolasyonların. Her iki (A) ve (yirmi ayrı DNA izolasyonların tasvir ve sulak elde edilen DNA karakteristik bozulma göstermekB). Her lane için DNA'ın 3 µL kullanıldı. Şerit için her iki (A) ve (B) örnek tarafından tespit edilmiştir ve sonuçları ek tablo 1' deki karşılaştırılabilir. Merdiven boyutu baz çifti (bp) olarak tasvir edilir. Beyaz lekeler görüntüde çoğu Temizleme ile kaldırılamadı jel Imager aktarımında nedeniyle. Bu rakam indirmek için buraya tıklayınız.

Tamamlayıcı Şekil 2: özel jel görüntüleri sulak elde edilen DNA'kırk ek sıralama kütüphanelerin. Her lane için kütüphane 3 µL kullanıldı. Final sıralama kütüphaneler her iki (A) bulunur ve (B) 300-500 baz çifti bir ortalama büyüklüğü ile. İkincil grup güçlendirilmiş bazı örnekleri görülen "kütüphanelerin köpüren" öneririz. Şerit için her iki (A) ve (B) örnek tarafından tanımlanır ve sonuçları ek tablo 1' deki karşılaştırılabilir. Merdiven boyutu baz çifti (bp) olarak tasvir edilir. Bu rakam indirmek için buraya tıklayınız.

Tamamlayıcı şekil 3: özel jel görüntü ikincil grubu kaldırma ile bir ek tek döngüsü PCR adım. Bu rakam indirmek için buraya tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Burada sunulan Protokolü DNA izolasyon ve Kütüphane hazırlık kurutulmuş bitki örnekleri üzerinden sıralama için kapsamlı ve sağlam bir yöntemdir. Yöntemi ve bunu değiştirmek için çok az ihtiyaç örnek kalite make büyük sulak alan sıralama projeler için ölçeklenebilir temel. Düşük verim kitaplıkları için bir isteğe bağlı reamplification adım dahil düşük kaliteli, düşük miktar, nadir, ya da başka türlü sıralama için uygun olmaz tarihsel açıdan önemli örnekleri dahil sağlar.

İlk DNA verim önemi
Sulak elde edilen DNA kez sonucu olarak ilk numune koruma11, örneklerin DNA ile 300 yıldan az eski birkaç yüz binlerce yıl eski31 çoğu hayvan kalıntıları üzerinden izole DNA olarak bozulmuş olarak varlık düşer , 32. sonuç olarak, ilk DNA verimli duruma getirilmesi başarılı sıralama kitaplığı hazırlık için yeterince yüksek kaliteli dsDNA elde etmek önemlidir. Çimen türünün en iyi bir verim sterilize kum kombine kullanımı yoluyla elde edilir ve ilk taşlama içinde sıvı azot adım, hücre duvarları daha kapsamlı bir imha ve nükleik asitler sürümü sağlamak. Bu yaklaşım artar arzu daha büyük dsDNA ve istenmeyen daha küçük parçaları (şekil 1, tamamlayıcı şekil 1, Tablo 2, ek tablo 1). Sonraki boncuk temizleme adımları izole ve sıralama (300-500 baz çifti), büyük ölçüde azaltarak kurtarma ama aynı zamanda daha uzun parçaları (Tablo 2, ek tablo 1) zenginleştirici için uygun boyutta parçaları için zenginleştirmek. Soy aşağı akım işleme18Sekonder metabolitler etkilerini azaltmak için örnek temel değişiklikler ilk DNA izolasyon adımlar için gerekli olabilir.

Kütüphane adaptörleri duruma getirilmesi
Ligasyonu için kullanılan adaptörleri konsantrasyonu bitmiş kitaplıklarda adaptör dimer miktarda üzerinde doğrudan etkisi vardır. Adaptör dimer yetersiz örnek olmadığı durumlarda adaptörü kendini ligasyonu sonucu ve sıralama çalıştırır33kontamine. Nispeten düşük toplam dsDNA sulak örnekler kullanılabilir bağdaştırıcıları ligasyonu önce seyreltme gerektirir. Adaptör 50-fold seyreltilmiş 15 µM hisse senedi toplama üzerinden ayrı ayrı ölçmek ve her örnek (Tablo 2, ek tablo için adaptör sulandırmak için gerek kalmadan ( Protokol bölümünebakın) kolaylaştırıcı yüksek üretilen iş Kütüphane hazırlık 1). doygunluk adaptörler, prensip olarak genel kütüphane verim azaltmak rağmen bu sulak numuneler dsDNA adaptör böyle fazla verim düşüktür.

Değişim için daha yüksek verimleri adımları Temizleme boncuk
Boyut seçimi hazırlık sıralama kütüphanelerin genellikle adaptör ligasyonu, bırakmak için öncelikle istediğiniz boyuta aralığı içinde parçaları amplifikasyon sonra yapılır; Bu daha büyük ve hedef boyutundan küçük parçaları kaldırarak yapılır. Sulak kaynaklı dsDNA Kütüphane hazırlık için düşük miktarda unworkably düşük toplam dsDNA kaynaklanan bu adımda boyutu seçimden sonra şiddetlenir ve sonuçta son kütüphanede verim düşük. Sonra tüp ligasyonu % 90 birim boncuk kullanarak standart bir boncuk temizlik adım yaparak, daha fazla toplam dsDNA zenginleştirme amplifikasyon adım kalır. Son derece küçük DNA parçalarının tercihen % 90 birim boncuk kullanarak kaldırılır. Boyut seçimi son adım istenen parça boyutları zenginlik sağlar güçlendirilmiş kitaplığını yürütülmektedir. 25 µL ve boncuk 6 µL iki aşamalı hacimleri 400-500 baz çifti ekler bu Protokolü (şekil 1B, tamamlayıcı Şekil 2) içinde kütüphanelerin almak için en iyi duruma rağmen toplam birimleri boncuk istediğiniz aralığı seçmek için ayarlanabilir.

Örnek kurtarma Reamplification kütüphanelerin aracılığıyla
DNA izolasyon ve Kütüphane hazırlık en iyi yöntemler rağmen son sıralama kitaplıkları konsantrasyonları daha fazla sıralama için yetersiz olabilir. Sulak numuneler örnekleme ve genellikle sınırlı harcanabilir malzemeden yıkıcı doğa her zaman DNA izolasyon yinelenen izin vermez. Kütüphanede ilâ reamplifying tarafından 12 ek PCR döngü, hatta son derece yoksul kitaplıkları kaydedilebilir. Standart astar çifti her iki çiftli veya tekli dizin oluşturulmuş Kütüphane kurallarıyla uyumlu amplifikasyon için kullanılır. Reamplification için önemli bir konu önyargı, GC-zengin bölümleri genom20azalma ile sık sık giriştir. Yüksek sadakat polimeraz kullanarak (bkz. Tablo reçetesi) potansiyel bu önyargıları potansiyel kaçınılmalıdır. Bu GC içerik TK686 ve TK686-R (Tablo 3) sıralı kütüphanelerin en az varyasyon ile gösterilmiştir. İkinci bir doğrulama TK686 ve TK686-R transposon içeriğini tahmin ve fark edilebilir hiçbir farkı yoktur (Tablo 3) gösterdi. Son olarak, bu katılım tüm kloroplast genom TK686 ve TK686-R, iki derleme (Şekil 2, Tablo 3) arasında SNP varyasyon yakın muayene sonra aynı serilerinde sonuçlanan toplandı. GC içerik ve transposon kompozisyon ve tam kloroplast genleri, araya yeteneği reamplification tarafından etkilenip etkilenmedikleri sınanmamıştır gibi bu testler bu standart genomik ölçümleri, tavsiye ederim. Bu örnekleri çok bozulmuş düşünülen sulak birleşmeyle veya phylogenomic çalışmalar PCR aracılığıyla tanıtılan önyargı için endişe olmadan içine malzeme eksik olasılığı açılır. SNP arama önyargılı olup olmadığını sınamak için gerekli olacak, ancak bu reamplified kütüphaneler de sıra yakalama34için kullanılabilir. Bu küçük ölçekli testleri önyargı önyargı sıralama kitaplıkları tanıtmadın doğrulamak için her proje ile yürütülen tavsiye edilir.

Sınırlamalar ve olası değişiklikler
Düz-se bile bu protokol üzerinde çalıştığı sulak numuneler, kötü dokuları korunmuş yüzlerce hala herhangi bir adım başarısız olabilir. Ancak, özellikle Kütüphane kurtarma reamplification aracılığıyla sonra başarılı DNA çekimi, kurcalayarak üzerinden başarısız kitaplıklar için son derece nadir. Boyut seçimi adımları farklı ölçekli parçaları hedeflemek için veya son bazı kütüphaneler görülen parçaları çeşitli azaltmak için değiştirilebilir. Olarak tüm bitkisel kökenli çıkarma protokolleri ile adımları genel protokol engelleyebilir lineage özgü ikincil bileşenleri kaldırmak için gerekli olabilir. Sunulan bu protokolü çim sulak numuneler için DNA izolasyon ve yüksek işlem hacmi Kütüphane hazırlık için standart bir yöntem sağlar ve doğrulama ve deneme diğer bitki soy iyileştirilebilir olması muhtemeldir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar onlar rakip hiçbir ilgi alanlarına sahip bildirin.

Acknowledgments

Taylor AuBuchon-yaşlı, Jordan Teisher ve Kristina Zudock için örnekleme sulak numuneler yardım ve Missouri Botanical Garden erişim sulak numuneler için yıkıcı örnekleme için teşekkür ederiz. Bu eser Ulusal Bilim Vakfı (DEB-1457748) bir hibe destek oldu.

Materials

Name Company Catalog Number Comments
Veriti Thermal Cycler Applied Biosystems 4452300 96 well 
Gel Imaging System Azure Biosystems c300
Microfuge 20 Series Beckman Coulter B30137
Digital Dry Bath Benchmark Scientific BSH1001
Electrophoresis System EasyCast B2
PURELAB flex 2 (Ultra pure water) ELGA  89204-092
DNA LoBind Tube  Eppendorf 30108078 2 ml
Mini centrifuge Fisher Scientific 12-006-901
Vortex-Genie 2 Fisher Scientific 12-812
Mortar Fisher Scientific S02591 porcelain
Pestle fisher Scientific S02595 porcelain
Centrifuge tubes fisher Scientific 21-403-161
Microwave Kenmore 405.7309231
Qubit Assay Tubes Invitrogen Q32856
0.2 ml Strip tube and Cap for PCR VWR 20170-004
Qubit 2.0 Fluorometer Invitrogen Q32866
Balance Mettler Toledo PM2000
Liquid Nitrogen Short-term Storage Nalgene F9401
Magnetic-Ring Stand  ThermoFisher Scientific  AM10050 96 well 
Water Bath VWR 89032-210
Hot Plate Stirrers VWR 97042-754
Liquid Nitrogen Airgas UN1977
1 X TE Buffer Ambion AM9849 pH 8.0
CTAB AMRESCO 0833-500G
2-MERCAPTOETHANOL AMRESCO 0482-200ML
Ribonuclease A AMRESCO E866-5ML 10 mg/ml solution
Agencourt AMPure XP Beckman Coulter A63882
Sodium Chloride bio WORLD 705744
Isopropyl Alcohol bio WORLD 40970004-1
Nuclease Free water bio WORLD 42300012-2
Isoamyl Alcohol Fisher Scientific A393-500
Sodium Acetate Trihydrate Fisher Scientific s608-500
LE Agarose GeneMate E-3120-500
100bp PLUS DNA Ladder Gold Biotechnology D003-500
EDTA, Disodium Salt IBI Scientific IB70182
Qubit dsDNA HS Assay Kit Life Technologies Q32854
TRIS MP Biomedicals 103133 ultra pure
Gel Loading Dye Purple (6 X) New England BioLabs B7024S
NEBNext dsDNA Fragmentase New England BioLabs M0348L
NEBNext Ultra II DNA Library Prep Kit for Illumina  New England BioLabs E7645L
NEBNext Multiplex Oligos for Illumina New England BioLabs E7600S Dual Index Primers Set 1
NEBNext Q5 Hot Start HiFi PCR Master Mix New England BioLabs M0543L
Mag-Bind RXNPure Plus Omega bio-tek M1386-02
GelRed 10000 X Pheonix Research 41003-1
Phenol solution SIGMA Life Science P4557-400ml
PVP40 SIGMA-Aldrich PVP40-50G
Chloroform VWR EM8.22265.2500
Ethanol Koptec V1016 200 Proof
Silica sand VWR 14808-60-7
Reamplification primers Integrated DNA Technologies see text
Sequencher v.5.0.1 GeneCodes

DOWNLOAD MATERIALS LIST

References

  1. Savolainen, V., Cuénoud, P., Spichiger, R., Martinez, M. D. P., Crèvecoeur, M., Manen, J. F. The use of herbarium specimens in DNA phylogenetics: Evaluation and improvement. Plant Syst Evo. 197, (1-4), 87-98 (1995).
  2. Zedane, L., Hong-Wa, C., Murienne, J., Jeziorski, C., Baldwin, B. G., Besnard, G. Museomics illuminate the history of an extinct, paleoendemic plant lineage (Hesperelaea, Oleaceae) known from an 1875 collection from Guadalupe Island, Mexico. Bio J Linn Soc. 117, (1), 44-57 (2016).
  3. Teisher, J. K., McKain, M. R., Schaal, B. A., Kellogg, E. A. Polyphyly of Arundinoideae (Poaceae) and Evolution of the Twisted Geniculate Lemma Awn. Ann Bot. (2017).
  4. Cozzolino, S., Cafasso, D., Pellegrino, G., Musacchio, A., Widmer, A. Genetic variation in time and space: the use of herbarium specimens to reconstruct patterns of genetic variation in the endangered orchid Anacamptis palustris. Conserv Gen. 8, (3), 629-639 (2007).
  5. Wandeler, P., Hoeck, P. E. A., Keller, L. F. Back to the future: museum specimens in population genetics. Tre Eco & Evo. 22, (12), 634-642 (2007).
  6. Rivers, M. C., Taylor, L., Brummitt, N. A., Meagher, T. R., Roberts, D. L., Lughadha, E. N. How many herbarium specimens are needed to detect threatened species? Bio Conserv. 144, (10), 2541-2547 (2011).
  7. Saltonstall, K. Cryptic invasion by a non-native genotype of the common reed, Phragmites australis, into North America. PNAS USA. 99, (4), 2445-2449 (2002).
  8. Besnard, G., et al. From museums to genomics: old herbarium specimens shed light on a C3 to C4 transition. J Exp Bot. 65, (22), 6711-6721 (2014).
  9. Särkinen, T., Staats, M., Richardson, J. E., Cowan, R. S., Bakker, F. T. How to open the treasure chest? Optimising DNA extraction from herbarium specimens. PLoS ONE. 7, (8), e43808 (2012).
  10. Harris, S. A. DNA analysis of tropical plant species: An assessment of different drying methods. Plant Syst Evo. 188, (1-2), 57-64 (1994).
  11. Staats, M., et al. DNA damage in plant herbarium tissue. PLoS ONE. 6, (12), e28448 (2011).
  12. Bakker, F. T., et al. Herbarium genomics: plastome sequence assembly from a range of herbarium specimens using an Iterative Organelle Genome Assembly pipeline. Bio J of the Linn Soc. 117, (1), 33-43 (2016).
  13. Camacho, F. J., Gernandt, D. S., Liston, A., Stone, J. K., Klein, A. S. Endophytic fungal DNA, the source of contamination in spruce needle DNA. Mol Eco. 6, (10), 983-987 (1997).
  14. Hofreiter, M., Jaenicke, V., Serre, D., Von Haeseler, A., Pääbo, S. DNA sequences from multiple amplifications reveal artifacts induced by cytosine deamination in ancient DNA. Nucl Acids Res. 29, (23), 4793-4799 (2001).
  15. Staats, M., et al. Genomic treasure troves: Complete genome sequencing of herbarium and insect museum specimens. PLoS ONE. 8, (7), e69189 (2013).
  16. Bakker, F. T. Herbarium genomics: skimming and plastomics from archival specimens. Webbia. 72, (1), 35-45 (2017).
  17. Doyle, J. J., Doyle, J. L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bul. 19, 11-15 (1987).
  18. Allen, G. C., Flores-Vergara, M. A., Krasynanski, S., Kumar, S., Thompson, W. F. A modified protocol for rapid DNA isolation from plant tissue using cetryltrimethylammonium bromide. Nat Prot. 1, 2320-2325 (2006).
  19. Twyford, A. D., Ness, R. D. Strategies for complete plastid genome seqeuncing. Mol Eco Resour. (2016).
  20. Aird, D., et al. Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries. Genome Bio. 12, (2), R18 (2011).
  21. Bolger, A. M., Lohse, M., Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinf. 30, 2114-2120 (2014).
  22. Grigoriev, I. V., et al. MycoCosm portal: gearing up for 1000 fungal genomes. Nucl Acids Res. 42, (1), D699-D704 (2014).
  23. Langmead, B., Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat Meth. 9, (4), 357-359 (2012).
  24. McKain, M. R. Herbarium Genomics. Github Repository https://github.com/mrmckain/ (2017).
  25. McKain, M. R., Wilson, M. A. Fast-Plast: Rapid de novo assembly and finishing for whole chloroplast genomes. Github Repository https://github.com/mrmckain/ (2017).
  26. McKain, M. R., McNeal, J. R., Kellar, P. R., Eguiarte, L. E., Pires, J. C., Leebens-Mack, J. Timing of rapid diversification and convergent origins of active pollination within Agavoideae (Asparagaceae). Am J Bot. 103, (10), 1717-1729 (2016).
  27. McKain, M. R., Hartsock, R. H., Wohl, M. M., Kellogg, E. A. Verdant: automated annotation, alignment, and phylogenetic analysis of whole chloroplast genomes. Bioinf. (2016).
  28. Staton, S. E., Burke, J. M. Transposome: A toolkit for annotation of transposable element families from unassembled sequence reads. Bioinf. 31, (11), 1827-1829 (2015).
  29. Bao, W., Kojima, K. K., Kohany, O. Repbase Update, a database of repetitive elements in eukaryotic genomes. Mobile DNA. 6, (1), 11 (2015).
  30. McKain, M. R. Transposons. Github Repository https://github.com/mrmckain/ (2017).
  31. Weiß, C. L., et al. Temporal patterns of damage and decay kinetics of DNA retrieved from plant herbarium specimens. Royal Soc Open Sci. 3, (6), 160239 (2016).
  32. Sawyer, S., Krause, J., Guschanski, K., Savolainen, V., Pääbo, S. Temporal patterns of nucleotide misincorporations and DNA fragmentation in ancient DNA. PLoS ONE. 7, (3), e34131 (2012).
  33. Head, S. R., et al. Library construction for next-generation sequencing: overviews and challenges. BioTechniques. 56, (2), 61-64 (2014).
  34. Grover, C. E., Salmon, A., Wendel, J. F. Targeted sequence capture as a powerful tool for evolutionary analysis. Am J Bot. 99, 312-319 (2012).

Comments

1 Comment

  1. Thanks for this video!

    Reply
    Posted by: Anony m.
    August 25, 2018 - 10:13 AM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics