Floëem Sap bemonstering van Brassica napus voor 3D-pagina van eiwit en Ribonucleoprotein complexen

Biology
 

Summary

Hier presenteren we een protocol voor het analyseren van de samenstelling van de eiwitten van groot eiwit: eiwit en eiwit: nucleïnezuur complexen van koolzaad (B. napus) floëem afgescheiden met behulp van een 3D polyacrylamide-gel elektroforese (pagina) aanpak combineren blauw native (BN) met twee denatureren pagina's, gevolgd door massaspectrometrische identificatie.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Pahlow, S., Ostendorp, A., Krüßel, L., Kehr, J. Phloem Sap Sampling from Brassica napus for 3D-PAGE of Protein and Ribonucleoprotein Complexes. J. Vis. Exp. (131), e57097, doi:10.3791/57097 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Bemonstering van het floëem van hogere planten is vaak moeizaam en sterk afhankelijk van de plantensoorten. Proteoom studies onder voorwaarden denaturering kunnen echter gebeuren in verschillende plantensoorten. Eiwit: eiwit en eiwit: nucleïnezuur complexen van floëem monsters hebben nog nauwelijks is geanalyseerd, hoewel ze een belangrijke rol in het onderhoud van deze gespecialiseerde compartiment of interlokale signalering spelen misschien. Grote moleculaire verzamelingen kunnen worden afgezonderd met behulp van een blauwe inheemse gelelektroforese (BN-pagina). De eiwit-onderdelen kunnen worden gescheiden door een latere natrium dodecyl sulfaat (SDS-pagina). Echter, proteïnen met gelijkaardige molecuulgewichten mede migreren, wat eiwit identificatie door massaspectrometrie kan belemmeren. BN-pagina combineren met twee verschillende denatureren gel elektroforese stappen, namelijk Tris-Tricine-ureum en SDS-pagina, kunt de extra scheiding van proteïnen volgens hun hydrophilicity/hydrophobicity en dus verhoogt de resolutie en het succes eiwit identificatie. Het laat zelfs eiwitten die alleen in hun posttranslationele modificaties verschillen onderscheid te maken. Blauwe inheemse noordelijke bevlekken kan bovendien worden toegepast ter identificatie van de componenten van de RNA in macromoleculaire complexen. We laten zien dat ons protocol geschikt is voor het ontrafelen van de eiwitten en RNA onderdelen van eiwit: eiwit en ribonucleoprotein (RNP) complexen die zich voordoen in het floëem monsters. Het combineren van een blauwe inheemse pagina met twee verschillende denatureren pagina stappen kan helpen om te scheiden van de verschillende soorten grote eiwitcomplexen, en kunt ook een grotere identificatie tarief van hun componenten door massaspectrometrie. Bovendien is het protocol is robuust genoeg om te detecteren gelijktijdig potentieel afhankelijke nucleïnezuren binnen één eiwitcomplexen.

Introduction

De lange leidingen van het floëem zijn essentieel voor de toewijzing van organische nutriënten in hogere planten, maar zijn ook betrokken bij de regulering van vele verschillende processen belangrijk voor groei en ontwikkeling, pathogen defensie, en de aanpassing aan de nadelige milieu-omstandigheden. Naast kleine effectoren zoals ionen, fytohormonen of metabolieten zelf, macromoleculen zoals eiwitten en RNAs hebben onlangs naar voren gekomen als mogelijke signalen.

Studies hebben aangetoond dat floëem laden van eiwitten is grootte afhankelijk en gecontroleerd door de uitsluiting limiet (SEL) van de porie-plasmodesmal eenheden aansluiten metgezel cellen (CC) en elementen (SE), die meestal in het bereik van 10 te zeef > 67 kDa1 , 2 , 3. echter, ondanks deze grootte beperkingen grotere proteïnen en eiwit binnen het floëem systeem het idee van grootte uitsluiting4uitdagende complexen zijn bevonden, en zelfs niet-specifieke verlies van eiwitten uit CC aan SE geweest voorgestelde5 .

Zowel de multiprotein als de grote ribonucleoprotein complexen spelen cruciale rol in de biosynthese en handhaven van de structurele integriteit van de cel-6. Er is bewijs dat floëem-mobiele eiwit-eiwit en ribonucleoprotein complexen bestaan4,7, maar tot nu toe weinig over hun functie is bekend. In het floëem zeef elementen zijn eiwit: eiwit en RNP complexen betrokken met het vervoer over lange afstanden en / of signalering8,9. Is vereist om te ontrafelen van de functies van de translocated complexen, het bestuderen van hun samenstelling onder variërende milieu of stress voorwaarden. Om dit te bereiken, inheemse complexen hebben worden geïsoleerd en hun componenten moeten worden gescheiden met voldoende resolutie.

Hoog-moleculair-gewicht complexen uit het floëem te isoleren, is het eerst nodig om te sap monsters in voldoende kwaliteit en kwantiteit krijgen. De techniek die worden voor floëem bemonstering gebruikt kan, hangt af van de plantensoorten van belang. Drie belangrijkste methoden om te verkrijgen floëem sap bestaan 10: insect stylectomy11, EDTA-vergemakkelijkt afscheiding12en spontane afscheiding13.

Floëem monsters van Arabidopsis thaliana (A. thaliana), de grote model-fabriek in laboratoria wereldwijd, kunnen alleen worden verkregen door EDTA-vergemakkelijkt afscheiding of bladluis stylectomy14,15. Beide methoden leiden tot sterk verdunde floëem sap of zeer lage monster bedragen. EDTA-vergemakkelijkt afscheiding is ook gevoelig voor besmetting en misschien niet de echte floëem samenstelling16vertegenwoordigen. Spontane floëem afscheiding is beperkt tot plantensoorten zoals Cucurbitaceae met niet, lupine of yucca, waar afsnijden van plantendelen leidt tot een spontane emissie van floëem sap die kan gemakkelijk verzamelde13,17,18, 19. We onlangs koolzaad (Brassica napus) opgericht als een geschikt modelsysteem floëem p.a., omdat het een nauwe verwant van A. thaliana en verschillende microliters van floëem sap kan worden verkregen bij kleine incisies dat is aangetoond dat worden van hoge zuiverheid4,8,20. Bovendien, het genoom B. napus werd uitgebracht in 201421.

Met uitzondering van de bladluis stylectomy, alle floëem collectie beschreven methoden omvatten beschadigen van het omliggende weefsel op de plaats van bemonstering, en de samenstelling van floëem sap kan veranderen in reactie op schade. Daarom is het essentieel om de kwaliteit van floëem monsters, ongeacht de toegepaste methode van monsterneming te controleren. Er zijn verschillende methoden voor kwaliteitscontrole van de verzamelde floëem sap, bijvoorbeeld door het bepalen van RNase activiteit22,23, RT-PCR met inleidingen tegen Rubisco8,24, of de analyse van de suiker samenstelling8.

Verschillende methoden te isoleren en te scheiden van eiwitcomplexen kunnen worden toegepast, met inbegrip van grootte uitsluiting chromatografie, sacharose dichtheid ultracentrifugatie of monster filtratie door membranen met verschillende moleculair gewicht snijden offs. Deze benaderingen laat echter geen hoge resolutie. De techniek genaamd blue native-pagina (BN-pagina), voor het eerst beschreven door Schägger et al. 25, is beter in termen van resolutie. Het werd met succes gebruikt om te bepalen van het molecuulgewicht van grote native eiwitcomplexen uit verschillende organellen of uit cellulaire lysates en hun relatieve abundanties26,27.

Als u wilt verder toelichten de complexe samenstelling van eiwitcomplexen, is het noodzakelijk om te scheiden van de individuele componenten onder de voorwaarden, wat leidt tot volledige demontage van de complexe onderdelen denaturering. Dit kan worden bereikt door een tweede dimensie van SDS-pagina 28,29 , of, om een hogere resolutie, door een tweede dimensie van elektrisch scherpstellen (IEF) gevolgd door een third dimension van SDS-pagina30 en latere identificatie van de eiwitten met behulp van spectrometrie van de massa.

In dit protocol beschrijven we bemonstering van pure floëem sap uit B. napus planten en de analyse van eiwitcomplexen van dergelijke floëem monsters met behulp van een 3D elektroforetische aanpak BN-pagina combineren met Tris-Tricine-ureum-pagina en SDS-pagina. De complexe onderdelen van gescheiden eiwit worden vervolgens geïdentificeerd met behulp van spectrometrie van de massa. Daarnaast introduceren we blauwe inheemse noordelijke bevlekken als een methode waardoor de detectie van RNAs in grote RNP complexen4, verlenging van de toepasbaarheid van de benadering.

Protocol

1. de bemonstering en de bereiding van floëem sap van B. napus planten 4,8,20

  1. Gebruik voor floëem sap bemonstering, goed gedrenkt 8-week-oude B. napus planten die Toon alleen eerste bloei om te voorkomen dat verontreinigingen van stuifmeel.
  2. Gebruik een hypodermische naald (Ø 0,8 mm) en punctate de bloeiwijze Steel meerdere malen. Herhaal op verschillende andere bloeiwijze stengels en op andere planten te krijgen genoeg floëem sap (Figuur 2a).
    Opmerking: Voor de complexe analyse, is het aanbevolen om te beginnen met minstens 600 µL van floëem sap. 4 tot 5 planten zal opleveren tussen de 200 en 700 µL van floëem sap.
  3. Veeg de eerste daling van de gewonde sites met filtreerpapier. Deze dalingen voornamelijk sterk verontreinigd materiaal uit de omliggende gewonde weefsel bevatten en moeten worden verwijderd.
  4. Verzamel de volgende druppels door pipetteren en slaan de verzamelde afgescheiden in een vooraf gekoeld conische 1,5 mL reactiebuis bij-20 ° C met behulp van een ijsvrije koelsysteem.
  5. Totdat verzamelen geen verdere daling van de formatie is waarneembaar, maar langer dan 1 uur. Deze procedure kan herhaald worden na twee dagen zonder een significant verlies van verzamelde floëem sap.
    Opmerking: De verzamelde floëem sap kan onmiddellijk gebruikt of opgeslagen bij-80 ° C voor toekomstige analyses. Voor opslag-80 ° C, schok-freeze de reactiebuis in vloeibare stikstof.
  6. Concentreren het floëem monster aan ongeveer 1/6th van het oorspronkelijke volume centrifugaal concentrators met een molecuulgewicht (MWCO) afsnijden van 10.000 Dalton (Da). Centrifugeer het geconcentreerd monster bij 4 ° C en 20.000 x g gedurende ten minste 15 minuten voor het verwijderen van stofdeeltjes.
    Opmerking: Floëem sap concentratie niet leidt tot een aanzienlijk verlies van eiwitten.
  7. Voor latere complexe analyse, gaat u verder met stap 3.1.

2. floëem sap zuiverheid controle met behulp van reverse-transcriptase (RT-PCR) PCR 4,8,20

  1. Isoleren van totaal RNA van floëem sap met behulp van een standaardmethode RNA extractie voor vloeibare materiaal (bijvoorbeeld TRIzol of fenol-chloroform extractie gevolgd door isopropanol en neerslag van de waterfase en ethanol wassen stappen volgens de fabrikant protocol).
    Let op: Fenol-chloroform is giftig. Werken onder een kap met passende persoonlijke beschermingsmiddelen. De uitgepakte RNA kan worden opgeslagen in ethanol-80 ° C voor maximaal zes maanden.
  2. Verwijderen van besmetting van DNA door de spijsvertering met DNase ik (1 u/µg) gedurende 45 minuten bij 37 ° C en inactivering van het enzym door toevoeging van EDTA aan een eindconcentratie van 5 mM en Incubeer het monster bij 75 ° C gedurende 10 minuten.
  3. Om puur RNA, zuiveren en concentreren van het monster door een andere zuivering (bijvoorbeeld met behulp van RNA Cleanup Kits, volgens de instructies van de fabrikant).
  4. Een reverse-transcriptase (RT-PCR) PCR voor de synthese van cDNA uitvoeren met een cDNA synthese kit met 150 ng van pure RNA zoals beschreven door de fabrikant is protocol.
    Opmerking: De cDNA kan worden achtergelaten bij-20 ° C tot verder gebruik.
  5. 5 µL van cDNA gebruiken als een sjabloon voor een standaard PCR reactie als opgegeven door de fabrikant, om te versterken compartiment-specifieke afschriften en controle door agarose gel elektroforese. Bevestig de zuiverheid van floëem monsters door bijvoorbeeld het gebruik van inleidingen voor rubisco kleine subeenheid, thioredoxin h, alsmede het stuifmeel vacht eiwit (Figuur 1b, tabel 1).

3. blauwe inheemse pagina 4,25,26,31

  1. Gebruik ofwel zelf gegoten inheemse kleurovergang gels zoals beschreven elders27 of commerciële Bis-Tris kleurovergang gels.
  2. Belasting 20 tot 30 µg per putje op de gel in de geconcentreerde eiwitSteekproef ten minste triplicates.
  3. De gel op 4 ° C en 150 V worden uitgevoerd met behulp van donker blauwe kathode buffer B en anode buffer (tabel 2) totdat het monster voorbij 1/3rd van de gel (ca. 20 tot 30 min, Figuur 3a).
    Opmerking: Voor het noordelijke bevlekken, een enkele gel lane volstaat, terwijl voor de analyse van de samenstelling van de eiwitten door 3D-pagina en de Spectrometrie van de massa, die het is aanbevolen om het combineren van dezelfde band uit maximaal tien gel rijstroken zich minder overvloedige eiwitten.
  4. Onderbreken van de aanloop en uitwisseling donker blauwe kathode buffer B met licht blauwe kathode buffer B/10 (tabel 2) en blijven de run. Afwerking van de gel uitgevoerd wanneer de blauwe voorkant begint te elueren uit de gel (ca. 120 tot 180 min, Figuur 3a).
    Opmerking: De afgewerkte blauwe inheemse gel kan worden achtergelaten bij 4 ° C gedurende ten minste één week. Langdurige opslag kan leiden tot diffuse bands en moet worden vermeden. Donker blauwe buffer B kan worden hergebruikt.

4. Optioneel: Opsporing van RNA met blauwe inheemse Noord Bevlekkende 4

  1. Knip verschillende bands of gebruik de baan van de hele gel van de blauwe inheemse gel en ze overdragen naar een nylon membraan semi-droge bevlekken op 3,5 mA/cm2 voor 60 min en de bovenste en onderste gel grens markeren met een potlood op het membraan (figuur 4a).
  2. Na het bevlekken, het membraan met DEPC behandelde water wassen en drogen tussen twee filtreerpapier.
  3. Uitvoeren van UV-crosslinking van de volgelopen membraan met 120.000 µJ/cm2 (85 s als met behulp van de Crosslinker in Tabel van materialen).
  4. Het membraan met 6 mL hybridisatie buffer (commercieel of zelfgemaakte) voor 60 min bij 68 ° C in een oven van hybridisatie (figuur 4a) vooraf te vermengen.
  5. Voeg een extra 1 mL hybridisatie buffer met 4 µL van 3'-biotinyleerd sondes (100 nM).
  6. Het membraan met de sonde na een nacht bebroeden, terwijl de koeling van de oven van 68 ° C tot 37 ° C.
  7. Het wassen van het membraan met buffer met 2 x SSC en 0,1% SDS, gedurende 5 minuten bij kamertemperatuur te verwijderen van de sondes gebonden unspecifically.
    Let op: De SDS kan irritaties veroorzaken. Draag handschoenen en laboratoriumjas bij het werken met SDS en SDS met oplossingen.
  8. De opsporing van de 3'-biotinyleerd-sondes op de membraan bv met een streptavidine-HRP-geconjugeerde en luminol uitvoeren als horseradish peroxidase (HRP) substraat, resulterend in een gevoelige chemiluminescentie reactie (figuur 4a).

5. in de tweede dimensie: Tris-Tricine-ureum pagina 4,28

  1. Enkele bands uit de blauwe inheemse gel accijnzen. Combineren van bands uit monsters lopen in parallelle rijstroken tot een verdere concentratie van complexe eiwitten (Figuur 5).
    Opmerking: Verwijderde banden kunnen worden opgeslagen in één reactie buizen tot verder gebruik bij 4 ° C.
  2. Giet een 12% Tris-Tricine-ureum gel (dikte van 1 mm, 6,8 x 8,6 cm (breedte x lengte)). 10 mL van oplossing A van de gel voorbereiden in de scheitrechter gel (tabel 2), pour tussen twee glasplaten en overlay met isopropanol. Verwijder de isopropanol nadat de polymerisatie is voltooid en breng 4 mL van gel oplossing B (tabel 2) voor de stapelvolgorde gel op de gel en steek die een 10 goed kammen.
    Let op: Ongepolymeriseerd acrylamide kan neurotoxische en TEMED is schadelijk bij inademing. Altijd dragen van persoonlijke beschermingsmiddelen en werken onder een kap.
  3. De verwijderde gel bands overboeken naar een reactiebuis 1,5 mL en voeg 1 mL 2 x SDS monster buffer voor evenwichtsinstelling van de gel stukken (Figuur 5, tabel 2).
    1. Incubeer de monsters gedurende 10 minuten bij kamertemperatuur, vóór het koken in een blok van de verwarming (95 ° C) of in een magnetron en de monsters weer bij kamertemperatuur voor een verdere 15 min uit te broeden.
    2. Stapel verschillende stukken van de gel geëquilibreerd vertegenwoordigen hetzelfde complex in één enkele gel zak.
    3. Voer de elektroforese met behulp van de anode en kathode buffers draait op 150 V voor 45 tot 60 min en accijnzen van de hele gel lane.
  4. Incubeer de geknipte baan voor 20 min in zure buffer (100 mM Tris, 100 mM azijnzuur) en equilibreer in 125 mM Tris-HCl, pH 6.8 voor een ander 20 min (Figuur 5).

6. derde dimensie: SDS-pagina 4,32

  1. Giet een 15% SDS scheiden gel volgens Laemmli32 (dikte: 1,5 mm, 6,8 x 8,6 cm (breedte x lengte)) (tabel 2) en een dunne laag van een 4% stapelen van gel hierboven toevoegen.
    Let op: SDS, acrylamide en TEMED zijn giftig en schadelijk. Werken onder een motorkap en dragen van persoonlijke beschermingsmiddelen.
  2. Breng de gel geëquilibreerd lane op de gel SDS en dekking van de gel met 0,5% (w/w) agarose in 1 x SDS uitvoeren buffer aangevuld met een spoor van bromophenol blauw (Figuur 5).
  3. Kook de SDS met buffer agarose in de magnetron vooraf laden op de gel.
  4. Voor het uitvoeren van een eiwit marker voor het inschatten van het molecuulgewicht van de losse componenten, invoegen van een stukje papier van de filter aan het ene uiteinde van de gel totdat de agarose verhard of gebruik een speciale kam meestal gebruikt voor IPG gels.
  5. Stel de gel bij 150 V voor 60 min en vlek kleuring de gel met colloïdaal Coomassie, zilveren vlek of enige andere methode geschikt voor latere massaspectrometrische analyse.
  6. Analyseren van de zichtbare eiwit plekken met massaspectrometrische benaderingen zoals laser matrix-bijgewoonde desorptie/ionisatie time-of-flight (MALDI-TOF) of de Spectrometrie van de massa van de LC-MS/MS.
    Opmerking: We raden te gebruiken van de colloïdale Coomassie kleuring zoals reeds beschreven33. In onze handen, zelfs minder overvloedige eiwitten voldoende kan worden gekleurd en laat een massaspectrometrische analyse met redelijke datakwaliteit.

Representative Results

Hier presenteren we een protocol waarmee de analyse van eiwit: eiwit en eiwit: RNA complexen in floëem monsters van Brassica napus. De werkstroom wordt geïllustreerd in Figuur 1. Een groot voordeel van B. napus over andere modelorganismen is de mogelijkheid van relatief eenvoudig floëem sample collectie van kleine perforaties in de steel van de bloeiwijze. Hierdoor verkrijgen van zuivere floëem monsters in relatief grote hoeveelheden. Bij de bemonstering floëem, is het altijd raadzaam om te controleren op verontreinigingen, bijvoorbeeld door RT-PCR8. Een representatief resultaat verkregen van een zuivere floëem steekproef is afgebeeld in Figuur 2. Niet-verontreinigde floëem monsters moeten tonen een zichtbaar band voor thioredoxin h, overwegende dat geen signaal voor rubisco en het stuifmeel vacht eiwit moet worden weergegeven. De kleine subeenheid van rubisco kan dienen als een besturingselement in monsters van bladeren, stengels van de bloeiwijze of pollen. Thioredoxin h moet aantoonbaar in alle monsters, aangezien de mRNA is gebleken in het floëem van verschillende soorten, terwijl het stuifmeel vacht eiwit transcript alleen zichtbaar in bloem bud monsters moet zijn. Vormen van verontreiniging kunnen optreden wanneer het floëem bemonstering wordt uitgevoerd op volledig de bedektzadigen (stuifmeel vacht eiwit) of wanneer de eerste druppels uit het floëem bemonstering van lekke banden niet correct worden verwijderd (rubisco).

Voorafgaand aan BN-pagina is het verplicht om zich te concentreren het floëem sap. Met behulp van 20 tot 30 µg eiwit per putje, ten minste vier grote eiwit complex bands zichtbaar na BN-pagina van B. napus floëem sap, te laag of te hoge concentraties niet toestaan een duidelijke scheiding van de complexen (Figuur 3). Het is aanbevolen om het laden van verschillende gel bands vertegenwoordigen hetzelfde complex in één enkele zak van de tweede dimensie gel verder concentreren de eiwitten van elke één complex voor downstream processing en latere massaspectrometrische identificatie.

Voor de identificatie van de individuele componenten van floëem macromoleculaire complexen zijn wij de BN-BEGINPAGINA in combinatie met een tweede dimensie Tris-Tricine-ureum en een derde dimensie SDS-pagina om een scheiding van interne eiwitten. Hier, kan een scheiding met hoge resolutie worden waargenomen als gevolg van de verschillende eiwit migratie gedrag in ureum en SDS-pagina gelen. Meestal zal eiwitten die behoren tot een enkel complex zichtbaar zijn als een diagonale lijn in de gel. Eiwitten boven deze regel hebben een verhoogde hydrophobicity, terwijl eiwitten onder de lijn meer hydrofiele degenen28 (Figuur 5, Figuur 6 vertegenwoordigen).

Voor de karakterisatie van RNP complexen gebruikten we een deel van een BN-pagina gel voor het uitvoeren van BN noordelijke bevlekken. Na het bevlekken van een hele baan op een nylon membraan en crosslinking door UV-straling, kan RNA worden gevisualiseerd met behulp van RNA-specifieke sondes, zoals geïllustreerd in Figuur 4. Hier is het aangetoond dat een specifiek tRNA alleen aanwezig in één specifieke complex is. De proteïne componenten van dit tRNA-bindende complex kunnen verder worden onderzocht met behulp van de aanpak van de 3D gel hierboven beschreven. Massaspectrometrische analyses bleek dat dit complex voornamelijk tRNA-ligases wat bevestigt het tRNA bindende activiteit gevonden bevat door BN noordelijke bevlekken.

Figure 1
Figuur 1: werken van de stroom van de analyse van ribonucleoprotein complexen in het floëem sap van koolzaad. Na de bemonstering en de bereiding van floëem monsters, BN-pagina uitgevoerd om het scheiden van inheemse complexen. Dergelijke BN-pagina gelen toestaan de parallelle analyse van nucleic zuren door BN het noordelijke bevlekken en de identificatie van de componenten van de eiwitten van de complexen van de Spectrometrie van de massa. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2: controle van de bemonsterings- en zuiverheid van floëem sap van B. napus. Na de steel van de bloeiwijze van 8-10 week oud oliehoudende zaden verkrachting planten met een steriele hypodermische naald prikken, is afgescheiden met een pipet ingezameld en zijn overgedragen aan een ijskoude reactiebuis (a) om te bevestigen de zuiverheid van de monsters van de floëem DIE RT-PCR wordt uitgevoerd, frequentiebanden te versterken van de transcripties van thioredoxin h, rubisco kleine subeenheid en stuifmeel vacht eiwit in weefsel-specifieke monsters (b) RT-PCR zonder reverse-transcriptase werd uitgevoerd als besturingselement (-). Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3: BN-pagina. Schematische weergave van blue native-pagina met geconcentreerde floëem monsters van B. napus. (a) na het laden van de kleurovergang eiwit gel met 15-20 µL van geconcentreerde floëem sap, is BN-pagina uitgevoerd met 1 x donker blauwe kathode buffer B bij 150 V voor 20-30 min in een koude kamer. Vervolgens de buffer wordt uitgewisseld tegen 1 x licht blauw kathode buffer B/10 en de pagina is afgewerkt op 150 V voor 120-180 min tot de donkerblauw met front draait uit de gel. De BN-pagina gelen Toon vier verschillende banden voor vier verschillende complexen van de hoog-moleculair-gewicht. (b) het laden van te weinig (c) of teveel eiwitten (d) floëem vermindert de zichtbaarheid van afzonderlijke complexen. Klik hier voor een grotere versie van dit cijfer.

Figure 4
Figuur 4: BN noordelijke bevlekken. Schematische weergave van het noordelijke bevlekken methode BN. (a) een baan van de BN-pagina is overgezet naar een nylon membraan door semi-droge bevlekken. Het membraan is na UV-crosslinking en pre kruising geïncubeerd met RNA specifieke sondes (hier een methionine tRNA-specifieke sonde), die biotinyleerd aan de 3'-eind in een oven kruising over nacht. Gratis sondes door wassen stappen zijn verwijderd en de opsporing van RNA wordt uitgevoerd door een streptavidine-HRP-geconjugeerde en luminol. Met behulp van deze aanpak, we waargenomen dat complexe IV van de BN-pagina methionine bevat tRNA. (b) de Coomassie gekleurd gel en de vlek tRNA lijken op twee verschillende gel rijstroken lopen parallel aan het voorkomen van migratie verschillen. Klik hier voor een grotere versie van dit cijfer.

Figure 5
Figuur 5: 3D VEL. Schematische weergave van de 3D-pagina aanpak. Enkele bands uit hetzelfde complex zijn weggesneden uit een BN-pagina gel, geïncubeerd bij het laden van de buffer en overgebracht in een putje van de tweede dimensie Tris-Tricine-ureum-pagina. Na elektroforese, zijn hele gel rijstroken uitgesneden, gewassen in zuur zuur buffer geëquilibreerd en geplaatst op een 15% SDS-pagina gel. Na de derde dimensie pagina zijn de gescheiden eiwitten Coomassie gekleurd en geanalyseerd door massaspectrometrie. Klik hier voor een grotere versie van dit cijfer.

Figure 6
Figuur 6: vertegenwoordiger resultaten na 3D-pagina. Binnen de eerste dimensie BN-pagina verschillende complexen verscheen. Hun proteïne componenten kunnen verder worden gescheiden door twee opeenvolgende denatureren pagina's, wat resulteert in een diagonale plek patroon. Klik hier voor een grotere versie van dit cijfer.

Sonde Volgorde
Thioredoxin h
voorwaarts: CTCAAGGCAGCCAAAGAATC
omgekeerde: ATGGCCTGAACATCGAACTC
Rubisco kleine keten
voorwaarts: TTCACCGGCTTGAAGTCATC
omgekeerde: CCGGGTACTCCTTCTTGCAT
Stuifmeel vacht eiwit BRU77666
voorwaarts: TCAGAACTGGAGCTTCAACG
omgekeerde: TTCCTTAATGGCCTCAGTGG

Tabel 1: inleidingen gebruikt voor floëem monster zuiverheid controle. Om te bevestigen floëem monster zuiverheid kunnen primers specifiek voor rubisco kleine keten, thioredoxin h, en stuifmeel vacht eiwit worden gebruikt voor versterking van cDNA.

Buffers en oplossingen Inhoud Commentaar
donker blauwe kathode buffer B 15 mM Bis-Tris pH 7,0
50 mM Tricine
0,02% (m/v) Coomassie blue G250
recept is aangepast van Fiala et al. 17
pH moet worden aangepast aan 7.0
Buffer kan worden gemaakt als een 10 x voorraad
licht blauwe kathode buffer B/10 15 mM Bis-Tris pH 7,0
50 mM Tricine
0.002% (m/v) Coomassie blue G250
Buffer kan worden bereid door verdunning van de kathode buffer B met kathode buffer zonder Coomassie
anode buffer
50 mM Bis-Tris pH 7,0
Buffer kan worden voorbereid als een 10 x stockoplossing
2 x SDS monster buffer
125 mM Tris-HCl pH 6.8
4% SDS
20% glycerol
0,2 M DTT
0,02% (m/v) bromophenol blauw
Overdracht buffer 1 x TBE buffer
89 mM Tris pH 7,6
89 mM boorzuur
2 mM EDTA
FSME buffer kan worden gemaakt en opgeslagen als voorraden van 5 x of 10 x. Het is belangrijk om gebruik RNase-vrije gedeïoniseerd water.
2 x SSC buffer
300 mM NaCl
30 mM nb3citraat pH 7,0
3 x gel-buffer
3 M Tris
1 M HCl
0,3% SDS

pH 8,45
recept aangepast van Schägger 19
Tris-Tricine gel oplossing A
Voor 10 mL:
30% acrylamide-bisacrylamide (29:1) 3.34 mL
6 M ureum
3 x gel buffer 3.34 mL
70% glycerol 1,4 mL
toevoegen van ddH2O tot 10 mL
10% APS 40 ΜL
TEMED 4 ΜL
Gewicht 6 M ureum en voeg 3 x gel-buffer, het acrylamide-bisacrylamide oplossing en 70% gycerol. Verwarm tot 60 ° C in een waterbad op solubilize ureum. Toevoegen van ddH2O tot 10 mL, 10% APS en tenslotte TEMED voor polymerisatie.
Tris-Tricine gel oplossing B
Voor 6 mL:
30% acrylamide-bisacrylamide (29:1) 0,8 mL
6 M ureum
3 x 1,5 mL van de buffer van de gel
toevoegen van ddH2O tot 6 mL
10% APS 45 ΜL
TEMED 4.5 ΜL
Gewicht 6 M ureum en voeg 3 x gel-buffer en acrylamide-bisacrylamide oplossing. Verwarm tot 60 ° C in een waterbad op solubilize ureum. Toevoegen van ddH2O tot 10 mL, 10% APS en tenslotte TEMED voor polymerisatie.
1 x Tris-Tricine lopende buffer (anode)
100 mM Tris
22.5 mM HCl

pH 8,9
recept aangepast van Schägger 19
1 x Tris-Tricine lopende buffer (kathode)
100 mM Tris
100 mM Tricine
1% SDS


pH 8,25
recept aangepast van Schägger 19
Zure buffer
100 mM Tris
100 mM azijnzuur
4% SDS stapelen gel
Voor 2 mL:
ddH2O 1,4 mL
30% acrylamide-bisacrylamide (37.5:1) 0,33 mL
1 M Tris pH 6.8 0,25 mL
10% SDS 20 ΜL
10% APS 20 ΜL
TEMED 2 ΜL
15% SDS scheiden gel
Voor 10 mL:
ddH2O 2.3 mL
30% acrylamide-bisacrylamide (37.5:1) 5 mL
1.5 M Tris pH 8,8 2.5 mL
10% SDS 100 ΜL
10% APS 100 ΜL
TEMED 4 ΜL
1 x SDS lopende buffer
25 mM Tris
192 mM glycine
0,1% SDS
Coomassie kleurstofoplossing
5% (m/v)-aluminium-sulfaat-(14-18)-hydraat
10% (v/v) ethanol (96%)
2% (v/v) orthofosforzuur (85%)
0,02% (m/v) Coomassie briljant blauw G-250
 
ULTRAhyb Ultrasensitive kruising Buffer Ambion, leven technologieën

Tabel 2: oplossingen en recepten van de buffer. Lijst met alle buffers en oplossingen nodig voor 3D-pagina-analyse.

Ter plaatse neen. MW obs. [kDa] Identificatie Organisme Toetreding neen. MW [kDa] MASCOTTE score
CIV_1 130 Vermeende ziekte weerstand eiwit At4g19050 B. napus CDX78917 131,1 110
CIV_2 130 Vermeende ziekte weerstand eiwit At4g19050 B. napus CDX78917 131,1 89
CIV_3 100 Warmte schok 70 kDa proteïne 14-achtige B. napus XP_013748865 89,9 113
CIV_4 90 Eukaryotische elongatiefactor 2
Celdeling bepalen eiwit 48 homolog A
B. napus
B. napus
CDX90241
CDY41316.1
89,5
89,5
111
197
CIV_5 85 Warmte schok eiwit 90-2-achtige B. rapa XP_009132342 79,8 172
CIV_6 80 Threonine--tRNA ligase
Glycine--tRNA ligase
B. oleracea
B. napus
XP_013599115
CDY43195
81,5
80,8
110
88
CIV_7 70 Heat shock protein 70 kDa
Lysine--tRNA ligase-achtige
B. oleracea
B. napus
XP_013685267
XP_013747530
67,8
69,9
230
150
CIV_8 65 Myrosinase
Aspartaat--tRNA ligase 2
Asparagine--tRNA ligase 1
B. napus
B. napus
B. napus
ABQ42337
XP_013670803
XP_013729126
60,6
61,6
63,5
183
141
153
CIV_9 60 Myrosinase B. napus ABQ42337 60,6 164
CIV_10 55 Adenosylhomocysteinase 2-achtige B. rapa XP_009135865 53.1 139
CIV_11 55 Rek factor 1-alpha 1-achtige B. oleracea XP_013586115 51,9 161
CIV_12 50 Cystine lyase CORI3-achtige B. napus XP_013653143 48,1 237
CIV_13 44 Cystine lyase CORI3-achtige B. rapa XP_009108611 48.3 213
CIV_14 38 Fructose-difosfaat aldolase B. rapa XP_009115993 38.4 226
CIV_15 45 Cystine lyase CORI3-achtige B. rapa XP_009108611 48.3 219
CIV_16 45 Cystine lyase CORI3 B. rapa CDY69765 46.9 209
CIV_17 38 Fructose-difosfaat aldolase B. rapa XP_009115993 38.4 124
CIV_18 18 Peptide-prolyl cis-trans isomerase CYP18-3-achtige B. napus XP_009101932 18.3 128
CIV_19 45 Cystine lyase CORI3-achtige B. rapa XP_009108611 48.3 177

Tabel 3: geïdentificeerd proteïne componenten van complexe IV. Verschillende tRNA ligases en verdere eiwitten hebben binnen het tRNA bindende complex gevonden met behulp van MALDI-TOF massa-spectrometrische analyse na 3D-pagina.

Discussion

Het floëem is een compartiment van groot belang, aangezien het vormt de grote transportroute voor photoassimilates, en ook essentieel is voor de lange afstand signalen tussen verschillende plantaardige delen9,20,34, 35. Naast kleine molecules, zijn macromoleculen zoals eiwitten en RNAs betrokken met floëem onderhoud en signalering4,7,8. De analyse van floëem samenstelling wordt beperkt door de beperkte toegankelijkheid tot floëem monsters in de meeste plantensoorten. Het insect stilet-techniek is breed toepasbaar, maar experimenteel veeleisende en resulteert in zeer kleine hoeveelheden floëem monsters11. Een eenvoudige techniek die gebruikt wordt voor floëem bemonstering is EDTA-vergemakkelijkt afscheiding12. EDTA chelateert divalente ionen zoals Calcium en dus voorkomt sluiting van sieve platen door P-eiwitten en callose. Het is makkelijk te gebruiken, maar is gevoelig voor besmetting door beschadigde cellen en monsters worden verdund. Afbreken divalente ionen door EDTA kan ook leiden tot een verdeling van bestaande complexen. Het maakt echter bemonstering uit een breed scala van soorten, met inbegrip van de model plant A. thaliana15. Spontane afscheiding van floëem sap treedt alleen op in een klein aantal plantensoorten. Het is een invasieve methode waarbij ernstig letsel van plantaardige weefsels10. We onlangs B. napus opgericht als een soort model voor het bestuderen van vervoer over lange afstanden4,8,20. Hier, kunt floëem sap bemonsteren van kleine incisies, waardoor verwonding effecten en bronnen van verontreiniging.

Met behulp van verschillende bemonsteringstechnieken, het proteoom van floëem monsters van verschillende plantensoorten is onderzocht in de afgelopen jaren7,8,17,36,,37, 38,39. Voor deze Proteoom studies, eiwitten werden uitgepakt en neergeslagen onder denaturerende omstandigheden en daarom laat geen conclusies over eiwit: eiwit en eiwit: nucleïnezuur interacties presenteren onder inheemse voorwaarden. Co-immunoprecipitation (CoIP) en overlay vitrotests aangegeven dat een grote ribonucleoprotein complex zou kunnen bestaan in het floëem sap pompoen €40, maar het bleek niet dat elke macromoleculaire complexen bestaan inheemse omstandigheden binnen de floëem systeem.

Blue-inheemse pagina, geïntroduceerd door Schägger et al. 26, in combinatie met latere high-resolution gel elektroforese stappen kunnen de scheiding van de afzonderlijke componenten van grote eiwitcomplexen. Met behulp van 3D-pagina analyses van inheemse B. napus floëem afgescheiden, we konden onlangs laten zien dat verschillende hoog-moleculair-gewicht eiwit: eiwit en RNP complexen bestaan in het floëem monsters en enzymatisch actieve4. Alternatieve methoden voor het isoleren van eiwitcomplexen, alsmede RNPs zoals grootte uitsluiting chromatografie kunnen bestaan, maar niet in termen van resolutie in vergelijking met BN-pagina. Bovendien, voor een redelijke kwaliteit van complexe scheiding, grootte uitsluiting kolom matrices moeten worden aangepast volgens het algemeen complexe molecuulgewicht onderzocht. Analyse van complexen van verschillende grootte zal daarom eisen voor verschillende typen kolommen die zijn kosten verbonden aan intensieve en laat niet toe als hoog scherpstellen vermogen als een BN-pagina.

Kritische stappen voor het analyseren van complexen van B. napus omvatten het totale bedrag van floëem sap gebruikt als grondstof. Ten minste 600 µL van floëem monster nodig zijn en kunnen worden verkregen uit vijf goed gedrenkt planten. Voor 3D-pagina en het noordelijke bevlekken BN is het nodig om te beginnen met de eerste BN gel met een voldoende hoeveelheid floëem monsters. Om dit te bereiken, zijn floëem monsters geconcentreerd tot 20 tot 30 µg eiwit kan worden geladen in elk goed en ten minste triplicates van hetzelfde monster parallel worden uitgevoerd. Te laag of te hoog concentraties verminderen de detectie van complexen (Figuur 3). Floëem monsters moeten worden verzameld in reactie buizen op ijs en moeten worden opgeslagen bevroren voor later gebruik om te voorkomen dat de aantasting van het eiwit en omzet. Proteaseinhibitors gevonden in alle floëem proteomes geanalyseerd, maar ook een volledig actieve proteasoom werd beschreven in het floëem van B. napus4. Bovendien, volume en samenstelling van floëem monsters hangen af van de tijd-meetpunt en milieuomstandigheden10. Daarom moet worden gezorgd om te verzamelen op hetzelfde moment van de dag onder vergelijkbare omstandigheden. Stress behandelingen (bijv . droogte) kunnen verminderen de hoeveelheid floëem die kan worden verzameld. Om te identificeren één eiwitten door massaspectrometrie, is het verplicht te beperken mogelijke keratine verontreinigingen door dragen handschoenen de allertijden. Keratine leidt tot extra signalen tijdens de massa spec analyse en belemmert eiwit identificatie. De BN-pagina uitgevoerd bij een hogere spanning of bij kamertemperatuur kan leiden tot verwarming van de gel die zouden kunnen in demontage van fragiele complexen voortvloeien.

Het hier gepresenteerde protocol is geschikt voor de analyse van eiwit: eiwitcomplexen. Ook laten we zien dat het kan worden gebruikt om op te sporen specifieke RNAs vervat in de complexen in parallel. Om dit te bereiken, hebben we onlangs een protocol geïntroduceerd voor BN noordelijke bevlekken4. RNAs zijn vatbaar voor aantasting door RNAse verontreinigingen. Als u wilt beperken deze afbraak DEPC-behandeld, water moet worden gebruikt.

Belangrijkste beperkingen van de onderhavige methode omvat de schatting van het molecuulgewicht van eiwitcomplexen gescheiden door BN-pagina, omdat migratie gedrag hangt af van grootte, vorm en zelfs posttranslationele modificaties van de complexen31, 41. Schatting van de grootte van RNP complexen is nog complexer als gevolg van de invloed van nucleic zuren op het gedrag van de migratie. Het kan ook niet worden verhinderd dat complexen van dezelfde grootte samen in één enkele band migreren. Dit kan leiden tot de foutieve voorspelling van complexe composities. Daarom controleren de waargenomen interacties met aanvullende technieken, bijvoorbeeld door functionele assays4, kan het nodig zijn. Ook eiwitten slechts zwak of Transient gekoppeld aan een macromoleculaire complex zou verloren gaan in de buffer van de BN gebruikt. Om dit te vermijden, kunnen monsters kruisverwijzende, wat ook kan leiden tot artefacten of eiwit identificatie, kan voorkomen of de voorwaarden van de buffer kunnen worden geoptimaliseerd.

In tegenstelling tot de klassieke 2D-pagina, de combinatie van ureum-SDS-pagina en laat de scheiding volgens hydrophobicity en moleculair gewicht in plaats van elektrisch punt (pI) en moleculair gewicht 28, en wordt niet beperkt in de scheiding aan eiwitten van een specifieke pI bereik. Vergelijkbaar met klassieke 2D-pagina, gescheiden eiwitten zijn zichtbaar als enkele plekken, maar op een diagonale lijn 4,28 (Figuur 5, , Figuur 6). Meer hydrofobe eiwitten verschijnen in vlekken boven deze diagonaal, overwegende dat meer hydrofiele eiwitten worden gevonden onder de lijn28. De in dit protocol gebruikte polyacrylamide-concentraties worden eiwitten tussen 25 tot 80 kDa goed gescheiden. Toestaan van een scheiding van kleinere of grotere eiwitten de polyacrylamide concentratie kan worden gevarieerd of kleurovergang gels kunnen worden gebruikt in de derde dimensie. De onderdelen van complexe IV (Figuur 3) gescheiden door 3D-pagina (Figuur 6) werden uitgesneden, trypsine verteerd, en geanalyseerd door massaspectrometrie. Dit resulteerde in de identificatie van verschillende tRNA ligases. De componenten van de andere complexen zijn onlangs gepubliceerd van 4. Onze 3D-pagina ingeschakeld de scheiding van verschillende ligases, namelijk aspartaat, asparagine, threonine, lysine en glycine ligases, met gelijkaardige molecuulgewichten (tabel 3). Met behulp van een methionine tRNA-specifieke sonde, we waren kundig voor speurder potentieel afhankelijke tRNA binnen complexe IV, maar als full-length tRNA of tRNA fragmenten in het complex niet kan worden onderscheiden met de sondes gebruikt. Als u wilt controleren als de nucleïnezuren echt gebonden binnen het complex en niet mede migreren, protease verteerd floëem sap kunnen monsters dienen als geschikt migratie besturingselementen.

Eerder werd gespeculeerd dat eiwit vertaling binnen floëem zeef buizen, optreden kan aangezien bijna de meeste onderdelen van de gehele ribosoom evenals rek factoren in floëem monsters4,7 gevonden. Onze bevinding van tRNA en tRNA ligases lijkt om dit idee te steunen. Echter tRNA fragmenten aanwezig in het floëem monsters van pompoen is gebleken te zijn krachtige remmers van vertaling42 en functionele ribosomen lijken afwezig zijn4, wat suggereert dat de vertaling kan niet plaatsvinden.

Samen genomen, kan het protocol hier gepresenteerd de scheiding van eiwit: eiwit en zelfs RNP complexen van floëem monsters en de scheiding en identificatie van hun individuele componenten met hoge resolutie. De toepassing van deze methode maakt de ontdekking van nieuwe eiwitten en RNP complexen in floëem monsters en daarom nieuwe functies in deze gespecialiseerde plant compartiment kan toelichten.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Wij danken Jennifer Deke en Urszula Zarzenska voor hun wetenschappelijke ondersteuning. Dit werk werd financieel ondersteund door een carrière integratie subsidie (CIG, PCIG14-GA-2013-63 0734) door de Europese Commissie binnen het 7de kader-programma, de subsidie LFF-GK06 'DELIGRAH' (Landesforschungsförderung Hamburg), en de DFG grant (DFG KE 856_6-1) toegekend aan JK.

Materials

Name Company Catalog Number Comments
1.5 mL reaction tubes Eppendorf 30120086
10 well comb for SDS PAGE, thickness 1 mm BioRad 1653359
2-Propanol AppliChem 131090
30 % Acrylamide-bisacrylamide solution (29:1) solution BioRad 1610156
30 % Acrylamide-bisacrylamide solution (37.5:1) solution BioRad 1610158
96 % Ethanol Carl Roth P075
Acetic acid Carl Roth 6755
Agarose Lonza 50004
Aluminum sulfate-(14-18)-hydrate AppliChem 141101
Ammonium peroxodisulfate (APS) Carl Roth 9592.3
Bis-Tris AppliChem A3992
Boric acid AppliChem A2940
Bromophenol blue AppliChem A2331
Centrifugal concentrators e.g. Vivaspin 500 (Mwco 10 kDa) Sartorius VS0102
Chemiluminescent Nucleic Acid Detection Module Kit Thermo Fisher Scientific 89880
Chromatography papers e.g. 3 mm CHR Whatman 3030-153
CoolBox M30 System Biocision BCS-133
Coomassie brilliant Blue G-250 AppliChem A3480
Diethyl pyrocarbonate (DEPC) AppliChem A0881
Dithiothreitol (DTT) AppliChem A1101
DNase I AppliChem A3778
Ethanol abs. AppliChem A3693
Ethylenediaminetetraacetic acid (EDTA) AppliChem A1103
Gel Imaging system e.g. Chemidoc Touch BioRad 1708370
GeneRuler 1kb plus Thermo Fisher Scientific SM1331
Glycerol AppliChem 141339
Glycine AppliChem 131340
Heating block TS1 Biometra 846-051-500
Hybridization oven e.g. GFL Hybridization Incubator 7601 GFL 7601
Hypodermic needle (0.8 mm) B Braun 4658309
IPG gel comb, thickness 1 mm BioRad 1653367
Labeling of RNA e.g.Biotin 3'end DNA Labeling Kit Thermo Fisher Scientific 89818
Native gradient gel e.g. Novex NativePAGE 4–16% Bis-Tris protein gel Invitrogen BN1002BOX
Nylon membrane e.g. Hybond-N+ Amersham Pharmacia RPN203B
Ortho-phosphoric acid Carl Roth 6366.1
PageRuler prestained protein ladder Thermo Fisher Scientific 26616
Power supply for Gel electrophoresis EPS Amersham Pharmacia 18-1130-01 available from GE Healthcare
RNA Cleanup Kit Qiagen 74204
Semi dry blot e.g. Fastblot 43B semi dry Blot Biometra 846-015-100
Sodium chloride (NaCl) AppliChem A1149
Sodium dodecyl sulfate (SDS) AppliChem 142363
Synthesis of cDNA e.g. RevertAid First Strand cDNA Synthesis Kit Thermo Fisher Scientific K1621
Tetramethylethylenediamine (TEMED) AppliChem A1148
Tricine AppliChem A3954
Tris AppliChem A1086
Tri-sodium citrate dihydrate AppliChem A3901
TRIzol Reagent Thermo Fisher Scientific 15596026
ULTRAhyb Ultrasensitive Hybridization Buffer Thermo Fisher Scientific AM8670
Urea AppliChem A1360
UV Crosslinker e.g. Stratalinker 2400 Agilent NC0477671 from Fisher Scientific
Vertical electrophoresis apparatus e.g.The XCell SureLock Mini-Cell or Mini-Protean III System Thermo Fisher Scientific or BioRad EI0001 or 1658004
Wipers e.g. KIMWIPES Delicate Task Wipers Kimberly-Clark 34120

DOWNLOAD MATERIALS LIST

References

  1. Kempers, R., van Bel, A. J. E. Symplasmic connections between sieve element and companion cell in the stem phloem ofVicia faba L. have a molecular exclusion limit of at least 10 kDa. Planta. 201, (2), 195-201 (1997).
  2. Stadler, R., et al. Expression of GFP-fusions in Arabidopsis companion cells reveals non-specific protein trafficking into sieve elements and identifies a novel post-phloem domain in roots. Plant J. 41, (2), 319-331 (2005).
  3. Imlau, A., Truernit, E., Sauer, N. Cell-to-cell and long-distance trafficking of the green fluorescent protein in the phloem and symplastic unloading of the protein into sink tissues. Plant Cell. 11, (3), 309-322 (1999).
  4. Ostendorp, A., et al. Functional analysis of Brassica napus phloem protein and ribonucleoprotein complexes. New Phytol. 214, (3), 1188-1197 (2017).
  5. Paultre, D. S. G., Gustin, M. -P., Molnar, A., Oparka, K. J. Lost in Transit: Long-Distance Trafficking and Phloem Unloading of Protein Signals in Arabidopsis Homografts. Plant Cell. 28, (9), 2016-2025 (2016).
  6. Sali, A., Glaeser, R., Earnest, T., Baumeister, W. From words to literature in structural proteomics. Nature. 422, (6928), 216-225 (2003).
  7. Lin, M. -K., Lee, Y. -J., Lough, T. J., Phinney, B. S., Lucas, W. J. Analysis of the Pumpkin Phloem Proteome Provides Insights into Angiosperm Sieve Tube Function. Mol. Cell. Proteomics. 8, (2), 343-356 (2008).
  8. Giavalisco, P., Kapitza, K., Kolasa, A., Buhtz, A., Kehr, J. Towards the proteome of Brassica napus phloem sap. Proteomics. 6, (3), 896-909 (2006).
  9. Lucas, W. J., Yoo, B. C., Kragler, F. RNA as a long-distance information macromolecule in plants. Nat. Rev. Mol. Cell. Bio. 2, (11), 849-857 (2001).
  10. Dinant, S., Kehr, J. Sampling and Analysis of Phloem Sap. Plant Mineral Nutrients. 953, 185-194 (2013).
  11. Kennedy, J. S., Mittler, T. E. A Method of obtaining Phloem Sap via the Mouth-parts of Aphids. Nature. 171, (4351), 528 (1953).
  12. King, R. W., Zeevaart, J. A. Enhancement of Phloem exudation from cut petioles by chelating agents. Plant Physiol. 53, (1), 96-103 (1974).
  13. Alosi, M. C., Melroy, D. L., Park, R. B. The regulation of gelation of Phloem exudate from cucurbita fruit by dilution, glutathione, and glutathione reductase. Plant Physiol. 86, (4), 1089-1094 (1988).
  14. Dinant, S., Bonnemain, J. -L., Girousse, C., Kehr, J. Phloem sap intricacy and interplay with aphid feeding. Comptes rendus biologies. 333, (6-7), 504-515 (2010).
  15. Tetyuk, O., Benning, U. F., Hoffmann-Benning, S. Collection and analysis of Arabidopsis phloem exudates using the EDTA-facilitated Method. J Vis Exp. (80), e51111 (2013).
  16. Kovalskaya, N., Owens, R., Baker, C. J., Deahl, K., Hammond, R. W. Application of a modified EDTA-mediated exudation technique and guttation fluid analysis for Potato spindle tuber viroid RNA detection in tomato plants (Solanum lycopersicum). J. Virol. Methods. 198, 75-81 (2014).
  17. Rodriguez-Medina, C., Atkins, C. A., Mann, A. J., Jordan, M. E., Smith, P. M. Macromolecular composition of phloem exudate from white lupin (Lupinus albus L). BMC Plant Biol. 11, (1), 36 (2011).
  18. Taylor, J. S., Thompson, B., Pate, J. S., Atkins, C. A., Pharis, R. P. Cytokinins in the Phloem Sap of White Lupin (Lupinus albus L.). Plant Physiol. 94, (4), 1714-1720 (1990).
  19. Yoo, B., et al. A Systemic Small RNA Signaling System in Plants. Plant Cell. 16, (8), 1979-2000 (2004).
  20. Buhtz, A., Springer, F., Chappell, L., Baulcombe, D. C., Kehr, J. Identification and characterization of small RNAs from the phloem of Brassica napus. Plant J. 53, (5), 739-749 (2008).
  21. Chalhoub, B., et al. Plant genetics. Early allopolyploid evolution in the post-Neolithic Brassica napus oilseed genome. Science. 345, (6199), 950-953 (2014).
  22. Sasaki, T., Chino, M., Hayashi, H., Fujiwara, T. Detection of several mRNA species in rice phloem sap. Plant Cell Phys. 39, (8), 895-897 (1998).
  23. Doering-Saad, C., Newbury, H. J., Bale, J. S., Pritchard, J. Use of aphid stylectomy and RT-PCR for the detection of transporter mRNAs in sieve elements. J Exp. Bot. 53, (369), 631-637 (2002).
  24. Ruiz-Medrano, R., Xoconostle-Cázares, B., Lucas, W. J. Phloem long-distance transport of CmNACP mRNA: implications for supracellular regulation in plants. Dev. 126, (20), 4405-4419 (1999).
  25. Schägger, H., Cramer, W. A., von Jagow, G. Analysis of molecular masses and oligomeric states of protein complexes by blue native electrophoresis and isolation of membrane protein complexes by two-dimensional native electrophoresis. Anal. Biochem. 217, (2), 220-230 (1994).
  26. Schägger, H., von Jagow, G. Blue native electrophoresis for isolation of membrane protein complexes in enzymatically active form. Anal. Biochem. 199, (2), 223-231 (1991).
  27. Fiala, G. J., Schamel, W. W. A., Blumenthal, B. Blue native polyacrylamide gel electrophoresis (BN-PAGE) for analysis of multiprotein complexes from cellular lysates. J Vis Exp. (48), e2164 (2011).
  28. Rais, I., Karas, M., Schägger, H. Two-dimensional electrophoresis for the isolation of integral membrane proteins and mass spectrometric identification. Proteomics. 4, (9), 2567-2571 (2004).
  29. Schägger, H. Tricine-SDS-PAGE. Nature protocols. 1, (1), 16-22 (2006).
  30. Wittig, I., Braun, H. -P., Schägger, H. Blue native PAGE. Nat Protoc. 1, (1), 418-428 (2006).
  31. Eubel, H., Braun, H. -P., Millar, A. H. Blue-native PAGE in plants: a tool in analysis of protein-protein interactions. Plant Methods. 1, (1), 11 (2005).
  32. Laemmli, U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227, (5259), 680-685 (1970).
  33. Dyballa, N., Metzger, S. Fast and sensitive colloidal coomassie G-250 staining for proteins in polyacrylamide gels. J Vis Exp. (30), (2009).
  34. Turnbull, C. G. N., Lopez-Cobollo, R. M. Heavy traffic in the fast lane: long-distance signalling by macromolecules. New Phytol. 198, (1), 33-51 (2013).
  35. Hall, S. M., Baker, D. A. The chemical composition of Ricinus phloem exudate. Planta. 106, (2), 131-140 (1972).
  36. Barnes, A., Bale, J., Constantinidou, C., Ashton, P., Jones, A., Pritchard, J. Determining protein identity from sieve element sap in Ricinus communis L. by quadrupole time of flight (Q-TOF) mass spectrometry. J. Exp. Bot. 55, (402), 1473-1481 (2004).
  37. Walz, C., Giavalisco, P., Schad, M., Juenger, M., Klose, J., Kehr, J. Proteomics of curcurbit phloem exudate reveals a network of defence proteins. Phytochemistry. 65, (12), 1795-1804 (2004).
  38. Walz, C., Juenger, M., Schad, M., Kehr, J. Evidence for the presence and activity of a complete antioxidant defence system in mature sieve tubes. Plant J. 31, (2), 189-197 (2002).
  39. Kehr, J. Phloem sap proteins: their identities and potential roles in the interaction between plants and phloem-feeding insects. J Exp. Bot. 57, (4), 767-774 (2006).
  40. Ham, B. -K., Brandom, J. L., Xoconostle-Cázares, B., Ringgold, V., Lough, T. J., Lucas, W. J. A polypyrimidine tract binding protein, pumpkin RBP50, forms the basis of a phloem-mobile ribonucleoprotein complex. Plant Cell. 21, (1), 197-215 (2009).
  41. Schamel, W. W. Biotinylation of protein complexes may lead to aggregation as well as to loss of subunits as revealed by Blue Native PAGE. J. Immunol. Methods. 252, (1-2), 171-174 (2001).
  42. Zhang, S., Sun, L., Kragler, F. The phloem-delivered RNA pool contains small noncoding RNAs and interferes with translation. Plant Physiol. 150, (1), 378-387 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics