Phloem Sap Probenahme aus Brassica Napus für 3D-Seite von Protein und Ribonucleoprotein komplexe

Biology
 

Summary

Hier präsentieren wir ein Protokoll, um die Proteinzusammensetzung von großen native Protein: Protein und Protein zu analysieren: Nukleinsäure-komplexe aus Raps (B. Napus) Phloem Exsudat mit einem 3D Polyacrylamid-Gel-Elektrophorese (PAGE) Ansatz kombiniert blau Native (BN) mit zwei denaturierenden Seiten gefolgt von massenspektrometrische Identifizierung.

Cite this Article

Copy Citation | Download Citations

Pahlow, S., Ostendorp, A., Krüßel, L., Kehr, J. Phloem Sap Sampling from Brassica napus for 3D-PAGE of Protein and Ribonucleoprotein Complexes. J. Vis. Exp. (131), e57097, doi:10.3791/57097 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Probenahme das Phloem der höheren Pflanzen ist oft mühsam und wesentlich abhängig von der Pflanzenart. Proteom-Studien unter denaturierenden Bedingungen konnte jedoch in verschiedenen Pflanzenarten erreicht werden. Nativen Protein: Protein und Eiweiß: Nukleinsäure-komplexe aus Bast Proben noch kaum analysiert wurden, obwohl sie eine wichtige Rolle in der Wartung von diesem spezialisierten Fach oder im Fernverkehr Signalisierung spielen könnte. Große molekularen Baugruppen können isoliert mit einer blauen gebürtige Gelelektrophorese (BN-Seite) werden. Ihre Proteinkomponenten können durch eine anschließende Natriumsulfat der Dodecyl Seite (SDS-PAGE) getrennt werden. Allerdings migrieren Co Proteine mit ähnlichen Molekulargewichten, was kann Proteinidentifikation durch Massenspektrometrie behindern. Kombination von BN-Seite mit zwei verschiedenen Geruchsstoffen Gel-Elektrophorese Schritten, nämlich Tris-Tricine-Harnstoff und SDS-PAGE, ermöglicht die weitere Trennung der Proteine nach ihrer Hydrophilie/Hydrophobie und erhöht somit Auflösung und den Erfolg der Proteinidentifizierung. Es erlaubt sogar die Proteine, die unterscheiden sich nur in ihrer posttranslationale Modifikationen zu unterscheiden. Darüber hinaus kann blau native Nordbeflecken angewendet werden, um die RNA-Komponenten in makromolekulare komplexe zu identifizieren. Wir zeigen, dass unser Protokoll geeignet, das Protein und die RNA-Komponenten von nativen Protein: Protein und Ribonucleoprotein (RNP) komplexe im Phloem Proben zu entwirren. Kombination von einem blauen native Seite mit zwei verschiedenen Geruchsstoffen Seite Schritte kann dazu beitragen, um verschiedene Arten von großer Proteinkomplexe zu trennen und ermöglicht auch eine höhere Erkennungsrate von deren Komponenten durch Massenspektrometrie. Darüber hinaus ist das Protokoll robust genug, um gleichzeitig potenziell gebundenen Nukleinsäuren in einzelne Protein-komplexe erkennen.

Introduction

Die Langstrecken das Phloem-Conduits sind essentiell für die Verteilung von Nährstoffen in höheren Pflanzen, sondern sind auch beteiligt bei der Regulierung der vielen verschiedener Prozessen wichtig für Wachstum und Entwicklung, Erreger Verteidigung und die Anpassung an den negativen Umweltbedingungen. Neben kleinen Effektoren wie Ionen, Phytohormonen oder Metaboliten selbst sind Makromoleküle wie Proteine und RNA als potentielle Signale vor kurzem entstanden.

Studien haben gezeigt, dass Phloem Laden von Proteinen Größe abhängig und kontrollierten durch Ausgrenzung Größenbeschränkung (SEL) der Pore-plasmodesmal Einheiten verbinden Begleiter Zellen (CC) und sieben Elemente (SE), die typischerweise im Bereich von 10 bis > 67 kDa1 , 2 , 3. jedoch trotz dieser Größe Beschränkungen größere Proteine und Protein komplexe innerhalb des Systems der Phloem herausfordernde Idee der Größe Ausgrenzung4gefunden wurden, und auch unspezifische Verlust von Proteinen aus CC SE wurde vorgeschlagen5 .

Multi sowie große Ribonucleoprotein komplexe spielen entscheidende Rolle bei der Biosynthese und Aufrechterhaltung der strukturellen Integritätdes der Zelle6. Es gibt Hinweise darauf, dass Protein-Protein und Ribonucleoprotein komplexe Phloem-Mobile gibt es4,7, aber bisher ist wenig über ihre Funktion bekannt. Im Phloem Siebelemente Protein: Protein und RNP-komplexe mit Fernverkehr und / oder Signalisierung8,9verwickelt. Um die Funktionen der translozierten komplexe, studieren ihre Zusammensetzung unter verschiedenen ökologischen zu entwirren oder stress Bedingungen ist erforderlich. Um dies zu erreichen, haben einheimische komplexe isoliert werden und ihre Komponenten mit ausreichender Auflösung getrennt werden.

Um hohen Molekulargewicht komplexe aus dem Phloem zu isolieren, ist es zunächst notwendig zu SAP-Proben in ausreichender Qualität und Menge zu erhalten. Die Technik, die für Phloem Probenahme verwendet werden kann hängt von der Pflanzenart von Interesse. Drei Hauptmethoden, Phloem Sap zu erhalten gibt es 10: Insekt Stylectomy11, EDTA erleichtert Exsudation12und spontane Exsudation13.

Phloem Proben von Arabidopsis Thaliana (A. Thaliana), der wichtigsten Modellpflanze in Laboren weltweit, erhalten Sie nur durch EDTA erleichtert Exsudation oder Blattlaus Stylectomy14,15. Beide Methoden führen zu stark verdünnte Phloem Sap oder sehr niedrigen Probe Beträge. EDTA-erleichtert Exsudation ist auch anfällig für Verschmutzung und kann nicht die reale Phloem Zusammensetzung16darstellen. Spontane Phloem Exsudation beschränkt sich auf Pflanzenarten wie Kürbisgewächse, Lupine oder Yucca, wohin führt Pflanzenteile abschneiden, eine spontane Emission von Phloem Sap, die leicht erhobenen13,17,18werden können, 19. Wir vor kurzem errichtet Raps (Brassica Napus) als Modellsystem für Phloem Analyse geeignet, denn es ist ein naher Verwandter von A. Thaliana und mehrere Mikroliter der Phloem Sap kann erfragt werden kleine Einschnitte, die gezeigt wurden sein hoher Reinheit4,8,20. Darüber hinaus wurde die Genomsequenz B. Napus 201421veröffentlicht.

Mit Ausnahme der Blattlaus Stylectomy alle Phloem Erhebungsmethoden beschrieben gehören Beschädigung des umgebenden Gewebes am Ort der Probenahme und die Zusammensetzung der Phloem Sap variieren in Reaktion auf eine Verletzung. Daher ist es unerlässlich, um die Qualität von Phloem Proben, unabhängig von der Sampling-Methode angewendet. Es gibt verschiedene Methoden zur Qualitätskontrolle von gesammelten Phloem Sap, z.B. durch Bestimmung der RNase Aktivität22,23, RT-PCR mit Primer gegen Rubisco8,24, oder die Analyse des Zuckers Zusammensetzung-8.

Verschiedene Methoden zu isolieren und zu trennen Proteinkomplexe aufgebracht werden können, einschließlich Größe Ausgrenzung Chromatographie, Saccharose Dichte Ultrazentrifugation oder Probenfiltration durch Membranen mit unterschiedlichen Molekulargewicht Cut Offs. Allerdings erlauben diese Ansätze keine hohen Auflösung. Die Technik namens blau native Seite (BN-Seite), erstmals von Schägger Et al.beschrieben. 25, ist überlegen in Bezug auf Auflösung. Es wurde erfolgreich verwendet, um festzustellen, die Molmassen von großen systemeigene Proteinkomplexen aus verschiedenen Organellen oder zellulären Lysates und ihre relativen Häufigkeiten26,27.

Um die komplexe Zusammensetzung von Proteinkomplexen weiter zu erhellen, ist es notwendig, die einzelnen Komponenten unter denaturierenden Bedingungen führt zu komplette Demontage komplexer Bauteile zu trennen. Dies kann durch eine zweite Dimension der SDS-PAGE 28,29 oder höheren Auflösung, durch eine zweite Dimension der isoelektrischen Fokussierung (IEF) gefolgt von einer Third dimension von SDS-PAGE30 und spätere Identifikation der zu erreichen die Proteine mittels Massenspektrometrie.

In diesem Protokoll beschreiben wir Probenahme von reinen Phloem-Saft von B. Napus Pflanzen und die Analyse von Proteinkomplexen aus solchen Phloem Proben mit einem 3D elektrophoretischen Ansatz BN-Seite mit Tris-Tricine-Harnstoff-PAGE und SDS-PAGE zu verbinden. Die getrennten Protein komplexen Bauteile werden anschließend durch Massenspektrometrie identifiziert. Darüber hinaus führen wir als eine Methode, die Erkennung von RNAs in großen RNP-komplexe4blau native Nordbeflecken erweitert die Anwendbarkeit des Ansatzes.

Protocol

1. Probenahme und Vorbereitung der Phloem-Saft von B. Napus Pflanzen 4,8,20

  1. Phloem SAP Probenahme, verwenden gut bewässerten 8 Wochen alten B. Napus Pflanzen dieser Show nur erste Blüte um Pollen Kontaminationen zu verhindern.
  2. Verwenden eine Injektionsnadel (Ø 0,8 mm) und punctata der Blütenstand ergeben sich mehrere Male. Wiederholen Sie bei mehreren anderen Blütenstand Stengel und an anderen Pflanzen genug Phloem Sap (Abbildung 2a) zu erhalten.
    Hinweis: Für die komplexe Analyse empfiehlt es mit mindestens 600 µL Phloem Sap zu starten. 4 bis 5 Pflanzen werden zwischen 200 und 700 µL Phloem Sap ergeben.
  3. Wischen Sie den ersten Tropfen von den verletzten Seiten mit Filterpapier. Diese Tropfen vor allem stark belasteten Material aus den umliegenden verletzte Gewebe enthalten und müssen verworfen werden.
  4. Sammeln Sie die folgenden Tropfen durch pipettieren und speichern Sie die gesammelten Exsudat in einem vorgekühlt konische 1,5 mL Reaktionsgefäß bei-20 ° C mit einem eisfreien Kühlsystem.
  5. Weiter sammeln, bis keine weitere Tropfenbildung zu beobachten, aber nicht länger als 1 h ist. Dieses Verfahren kann nach zwei Tagen ohne erheblichen Verlust der gesammelten Phloem Sap wiederholt werden.
    Hinweis: Der gesammelten Phloem-Saft sofort genutzt oder gespeichert werden kann bei-80 ° C zur späteren Analyse. Für die-80 ° C Lagerung Schock-Freeze das Reaktionsgefäß in flüssigem Stickstoff.
  6. Die Phloem Probe zu ca. 1/6th das Ausgangsvolumen mit zentrifugalen Konzentratoren mit einem Molekulargewicht abgeschnitten (MWCO) von 10.000 Dalton (Da) zu konzentrieren. Zentrifugieren Sie die konzentrierte Probe bei 4 ° C und 20.000 x g für mindestens 15 min. um Staubpartikel zu entfernen.
    Hinweis: Phloem SAP-Konzentration führt nicht zu einem erheblichen Verlust von Proteinen.
  7. Fahren Sie für nachfolgende Funktionentheorie mit Schritt 3.1.

(2) Phloem SAP-Reinheitskontrolle mit Reverse Transkriptase PCR (RT-PCR) 4,8,20

  1. Gesamt-RNS aus Phloem-Saft mit einer standard RNA Extraktionsmethode für flüssiges Material zu isolieren (z.B. TRIzol oder Phenol-Chloroform-Extraktion gefolgt von Isopropanol Niederschlag aus der wässrigen Phase und Ethanol Waschschritten gemäß der des Herstellers Protokoll).
    Achtung: Phenol-Chloroform ist giftig. Arbeiten Sie unter einer Haube mit geeigneter persönlicher Schutzausrüstung. Bis zu sechs Monaten kann die extrahierte RNA in Ethanol bei-80 ° C aufbewahrt werden.
  2. Entfernen Sie Verunreinigungen der DNA durch Verdauung mit DNase I (1 u/µg) für 45 min bei 37 ° C und inaktivieren das Enzym durch Zugabe von EDTA, eine Endkonzentration von 5 mM und die Probe bei 75 ° C für 10 min inkubieren.
  3. Um reine RNA, zu reinigen und die Probe zu konzentrieren, indem eine weitere Reinigungsstufe (z. B. mit RNA-Cleanup-Kits, gemäß den Anweisungen des Herstellers).
  4. Führen Sie eine Reverse Transkriptase PCR (RT-PCR) für die Synthese der cDNA mit einer cDNA Synthese Kit mit 150 ng reine RNA wie vom Hersteller beschrieben ist das Protokoll.
    Hinweis: Die cDNA kann bei-20 ° C bis zur weiteren Verwendung gespeichert werden.
  5. Verwenden Sie 5 µL cDNA als Vorlage für eine standard-PCR-Reaktion wie vom Hersteller angegeben, Fach-spezifische Protokolle zu verstärken und durch Agarose-Gelelektrophorese überprüfen. Bestätigen Sie die Reinheit der Phloem Proben z.B. mit Primer für Rubisco kleine Untereinheit, Thioredoxin-h und die Pollen-Hüllprotein (Abbildung 1 b, Tabelle 1).

3. blaue native Seite 4,25,26,31

  1. Verwenden Sie entweder selbst gegossenen native gradient Gele wie beschrieben an anderer Stelle27 oder kommerziellen Bis-Tris gradient Gele.
  2. Laden Sie mindestens 20 bis 30 µg der konzentrierten Proteins Probe pro Bohrloch auf das Gel in triplicates.
  3. Führen Sie das Gel bei 4 ° C und 150 V mit dunkel blauen Kathode Puffer B und Anode Puffer (Tabelle 2), bis die Probe 1/3rd des Gels (ca. 20 bis 30 min, Bild 3a) übergeben.
    Hinweis: Für Nordbeflecken, reicht eine einzige Gel-Gasse, während für die Analyse der Proteinzusammensetzung von 3D PAGE und Massenspektrometrie ist es empfehlenswert, die gleiche Band aus bis zu zehn Gel Bahnen sich weniger reichlich Proteine kombinieren.
  4. Unterbrechen den Lauf und Austausch dunkel blaue Kathode Puffer B mit leichten blauen Kathode Puffer B/10 (Tabelle 2) und der Flucht. Beenden Sie das Gel ausgeführt werden, wenn die blaue Front beginnt zu eluieren aus Gel (ca. 120 bis 180 min, Bild 3a).
    Hinweis: Das fertige blau native Gel kann bei 4 ° C für mindestens eine Woche gespeichert werden. Längerer Lagerung kann um zu diffundieren Bänder führen und sollte vermieden werden. Dunkel blau Puffer B kann wiederverwendet werden.

4. OPTIONAL: Nachweis von RNA mit blauen native northern Blot 4

  1. Unterschiedliche Banden geschnitten Sie aus oder verwenden Sie die ganze Gel-Spur aus dem blauen native Gel und übertragen Sie sie auf eine Nylon-Membran von semi Dry blotting bei 3,5 mA/cm2 für 60 min und markieren Sie die obere und untere Gel-Grenze mit einem Bleistift auf der Membran (Abbildung 4a).
  2. Beflecken, waschen Sie die Membran mit DEPC-behandeltem Wasser und trocknen Sie zwischen zwei Filterpapiere.
  3. Führen Sie UV-Vernetzung der gepunkteten Membran mit 120.000 µJ/cm2 (85 s wenn der Vernetzer in Tabelle Materialienverwenden).
  4. Pre-hybridisieren Sie die Membran mit 6 mL Hybridisierung Puffer (kommerzielle oder selbst gemacht) für 60 min bei 68 ° C im Backofen Hybridisierung (Abb. 4a).
  5. Fügen Sie eine zusätzliche 1 mL der Hybridisierung Puffer mit 4 µL 3' biotinylierte Sonden (100 nM).
  6. Inkubieren Sie Membran mit der Sonde über Nacht, beim Abkühlen des Backofen von 68 ° C auf 37 ° c
  7. Waschen Sie die Membran mit Puffer mit 2 X SSC und 0,1 % SDS für 5 min bei Raumtemperatur, Sonden gebunden unspezifisch zu entfernen.
    Achtung: SDS kann Reizungen verursachen. Tragen Sie Handschuhe und Kittel bei der Arbeit mit SDS und SDS mit Lösungen.
  8. Führen Sie die Erkennung der 3'-biotinylierte Sonden auf der Membran z.B. mit Streptavidin-HRP-Konjugat und Luminol als Meerrettich Peroxidase (HRP) Substrat, wodurch eine sensible Chemilumineszenz-Reaktion (Abb. 4a).

5. zweite dimension: Tris-Tricine-Harnstoff Seite 4,28

  1. Verbrauchssteuern Sie einzelne Bands aus dem blauen native Gel. Kombinieren Sie Bands aus Proben laufen in parallelen Bahnen, eine weitere Konzentration von komplexen Proteinen (Abbildung 5) zu erreichen.
    Hinweis: Ausgeschnittenen Bänder können in einzelnen Reaktionsgefäßen bis zur weiteren Verwendung bei 4 ° c gespeichert werden
  2. Gießen Sie eine 12 %-Tris-Tricine-Harnstoff-Gel (Dicke von 1 mm, 6,8 x 8,6 cm (Breite x Länge)). Das trennende Gel (Tabelle 2), 10 mL Gel Lösung A vorbereiten Gießen zwischen zwei Glasplatten und Overlay mit Isopropanol. Entfernen Sie das Isopropanol, nachdem die Polymerisation beendet ist und übertragen Sie 4 mL Gel Lösung B (Tabelle 2) für das Stapeln Gel auf das Gel und legen Sie eine 10 gut kämmen zu.
    Achtung: Unpolymerisierten Acrylamid kann neurotoxische und TEMED ist gesundheitsschädlich beim Einatmen. Immer persönliche Schutzausrüstung tragen und arbeiten unter einer Haube.
  3. Übertragen Sie die ausgeschnittenen Gel-Bands in einem 1,5 mL Reaktionsgefäß und 1 mL 2 x SDS-Probenpuffer für Gleichgewichtherstellung der Gel-Stücke (Abbildung 5, Tabelle 2).
    1. Brüten Sie die Proben 10 min bei Raumtemperatur, vor dem Kochen in einem Heizblock (95 ° C) oder in der Mikrowelle und inkubieren Sie die Proben wieder auf weitere 15 min bei Raumtemperatur.
    2. Stapeln Sie mehrere äquilibriert Gel Stücke vertreten die gleichen Komplex in einem einzigen Gel Tasche.
    3. Führen Sie die Elektrophorese mit Anode und Kathode mit 150 V für 45 bis 60 min Puffer und Verbrauchsteuern Sie die ganze Gel-Spur.
  4. Brüten die geschnittenen Fahrspur für 20 min in sauren Puffer (100 mM Tris, 100 mM Essigsäure) und equilibrate in 125 mM Tris-HCl, pH 6,8 für weitere 20 min (Abbildung 5).

(6) dritte Dimension: SDS-PAGE 4,32

  1. Gießen Sie einen 15 % SDS Trennung Gel nach Laemmli32 (Dicke: 1,5 mm, 6,8 x 8,6 cm (Breite x Länge)) (Tabelle 2) und fügen Sie eine dünne Schicht von 4 % Gel oben stapeln.
    Achtung: SDS, Acrylamid und TEMED sind giftig und schädlich. Arbeiten unter einer Haube und persönliche Schutzausrüstung tragen.
  2. Übertragen der äquilibriert Gel-Spur auf das SDS-Gel und decken das Gel mit 0,5 % (w/w) Agarose in 1 X SDS laufen Puffer ergänzt mit einer Spur von Bromophenol blue (Abbildung 5).
  3. Kochen Sie die SDS mit Puffer Agarose in der Mikrowelle vor Verladung auf das Gel.
  4. Legen Sie für den Betrieb eines Protein-Markers zur Abschätzung der Molekulargewichte der Einzelkomponenten ein Stück Filterpapier an einem Ende des Gels, bis die Agarose erstarrt oder verwenden Sie einen speziellen Kamm in der Regel für IPG Gele verwendet.
  5. Führen Sie das Gel 150 V für 60 min und Fleck Färbung das Gel mit kolloidalem Coomassie, silbernen Fleck oder eine andere Methode geeignet für anschließende massenspektrometrische Analyse.
  6. Analysieren Sie die sichtbaren Proteinspots mit massenspektrometrischer Methoden wie Matrix-unterstützte Laser Desorption/Ionisation Time-of-Flight (MALDI-TOF) oder LC-MS/MS Massenspektrometrie.
    Hinweis: Wir empfehlen, um die kolloidalen Coomassie-Färbung wie bereits beschrieben33zu verwenden. In unseren Händen sogar weniger reichlich Proteine kann ausreichend gebeizt und ermöglicht eine massenspektrometrische Analyse mit angemessenen Datenqualität.

Representative Results

Hier präsentieren wir ein Protokoll, das die Analyse von Protein: Protein erlaubt sowie Protein: RNA-komplexe im Phloem Proben aus Brassica Napus. Der Workflow ist in Abbildung 1dargestellt. Ein großer Vorteil von B. Napus über andere Modellorganismen ist die Möglichkeit, relativ einfach Phloem Musterkollektion von kleine Einstiche im Blütenstand Stiel. Dies ermöglicht, um reine Phloem Proben in vergleichsweise großen Mengen zu erhalten. Bei der Probenahme Phloem, ist es immer ratsam, für Verunreinigungen, zum Beispiel durch RT-PCR8zu überprüfen. Ein repräsentatives Ergebnis erhalten von einer reinen Phloem-Probe ist in Abbildung 2dargestellt. Non-kontaminierten Phloem Proben sollte eine sichtbare Band für Thioredoxin h zeigen, während kein Signal für Rubisco und Pollen-Hüllprotein angezeigt werden soll. Die kleine Untereinheit der Rubisco dienen als Steuerelement in Proben aus den Blättern, Blütenstand Stengel oder Pollen. Thioredoxin h sollte in allen Proben nachweisbar sein, da die mRNA gefunden wurde in das Phloem von verschiedenen Arten, während die Pollen Mantel Protein Abschrift nur in Blütenknospe Proben sichtbar sein soll. Verunreinigungen können auftreten, wenn Phloem Probenahme durchgeführt wird, voll blühender Pflanzen (Pollen Hüllprotein) oder wenn die ersten Tröpfchen aus dem Phloem Probenahme Punktionen nicht ordnungsgemäß verworfen werden (Rubisco).

Vor BN-Seite ist es zwingend erforderlich, um dem Phloem-Saft zu konzentrieren. Mit 20 bis 30 µg Protein pro Bohrloch, mindestens vier große Protein Komplex Bänder sichtbar nach BN-Seite von B. Napus Phloem Sap, zu niedrig oder zu hohe Konzentration nicht erlauben eine klare Trennung der komplexe (Abbildung 3). Es empfiehlt sich, mehrere Gel-Bands vertreten die gleichen Komplex in einer einzigen Tasche des zweiten Dimension Gels die Proteine aus jeder einzelnen Anlage für downstream-Processing und spätere massenspektrometrische Identifizierung sich laden.

Um die einzelnen Komponenten der Phloem makromolekulare komplexe zu identifizieren, wir BN-Startseite in Kombination mit einer zweiten Dimension Tris-Tricine-Harnstoff und eine dritte dimension SDS-PAGE um eine Trennung der einzelnen Proteine zu erreichen. Eine Trennung mit hoher Auflösung kann hier, aufgrund der verschiedenen Protein Migration Verhalten in Harnstoff und SDS-PAGE Gelen beobachtet werden. In der Regel sind Proteine, die Zugehörigkeit zu einem einzigen Komplex als eine diagonale Linie über das Gel sichtbar. Proteine oberhalb dieser Linie haben eine erhöhte Hydrophobie, während Proteine unter dem Strich mehr hydrophilen diejenigen28 (Abbildung 5, Abbildung 6) darstellen.

Für die Charakterisierung von RNP-komplexe haben wir einen Teil einer BN-PAGE-Gel BN Nordbeflecken durchführen. Nach beflecken eine ganze Spur auf einen Nylon-Membran und Vernetzung durch UV-Strahlung, kann die RNA mit RNA-spezifischen Sonden, wie in Abbildung 4dargestellt visualisiert werden. Hier wird gezeigt, dass eine spezifische tRNA nur in einer bestimmten Anlage vorhanden ist. Die Proteinkomponenten dieser tRNA-Binding-Komplex können mit dem oben beschriebenen 3D Gel-Ansatz weiter untersucht werden. Massenspektrometrische Analysen ergaben, dass diese Anlage vor allem tRNA-Ligases was bestätigt die tRNA verbindliche Aktivität enthält von BN Nordbeflecken gefunden.

Figure 1
Abb. 1: Ablauf der Analyse von komplexen Ribonucleoprotein in dem Phloem-Saft des Raps arbeiten. Nach der Probenahme und Vorbereitung der Proben Phloem wird BN-Seite durchgeführt, um native komplexe zu trennen. Solche Gele BN-Seite ermöglichen die parallele Analyse von Nukleinsäuren von BN Nordbeflecken und die Identifizierung von den Eiweißbausteinen der komplexe durch Massenspektrometrie. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2: Probenahme und Reinheit Kontrolle über Phloem-Saft des B. Napus. Nach der Punktion des Blütenstand Stammes von ca. 8-10 Wochen alten Rapspflanzen mit einer sterilen Injektionsnadel, Exsudat mit einer Pipette gesammelt und übertragen eine eiskalte Reaktionsgefäß (a), die Reinheit der Phloem Proben bestätigen, die RT-PCR durchgeführt wird, verstärken die Transkripte von Thioredoxin h, Rubisco kleine Untereinheit und Pollen Hüllprotein in gewebespezifischen Proben (b) RT-PCR ohne Reverse Transkriptase wurde als Kontrolle (-) durchgeführt. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3: BN-Seite. Schematische Darstellung des blauen native Seite mit konzentrierter Phloem Proben von B. Napus. (a) nach dem Laden der gradient Protein Gel mit 15-20 µL konzentrierte Phloem Sap, ist BN-Seite mit 1 X dunkle blaue Kathode Puffer B 150 V für 20-30 min in einem kalten Raum durchgeführt. Dann Puffer gegen 1 X leichte blaue Kathode Puffer B/10 ausgetauscht und die Seite ist fertig bei 150 V für 120-180 min bis dunkelblau läuft vorne läuft aus dem Gel. Die BN-Seite Gele zeigen vier verschiedene Bands aus vier verschiedenen hohen Molekulargewicht-komplexen. (b) laden (c) zu wenig oder zuviel (d) Phloem Proteine reduziert die Sichtbarkeit der einzelnen komplexe. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 4
Abbildung 4: BN Nordbeflecken. Schematische Darstellung der BN northern Blot-Methode. (a) eine Spur der BN-Seite wird auf eine Nylon-Membran durch semi-dry blotting übertragen. Nach UV-Vernetzung und Pre-Hybridisierung wird die Membran mit RNA spezifische Sonden (hier eine Methionin-tRNA-spezifische Sonde), die biotinylierte am 3'-Ende in einer Hybridisierung Ofen über Nacht inkubiert. Kostenlose Sonden werden durch Waschschritte entfernt und die Erkennung der RNA erfolgt durch einen Streptavidin-HRP-Konjugat und Luminol. Mit diesem Ansatz, wir beobachteten, dass komplexe IV von der BN-Seite Methionin enthält tRNA. (b) die Coomassie gefärbt-Gel und der tRNA-Blot ähneln zwei verschiedene Gel Bahnen laufen parallel zur Migration Unterschiede zu vermeiden. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 5
Abbildung 5: 3D-Seite. Schematische Darstellung des 3D-Seite-Ansatzes. Mehrere Bands aus der gleichen Komplex werden herausgeschnitten aus einer BN-PAGE-Gel, in Ladepuffer inkubiert und in einem Brunnen der zweiten Dimension Tris-Tricine-Harnstoff-Seite übertragen. Nach Elektrophorese sind ganze Gel Bahnen ausgeschnitten, in sauren Säure-Puffer gewaschen, equilibriert, und auf eine 15 % SDS-PAGE Gel gelegt. Nach der dritten Dimension Seite sind die getrennten Proteine Coomassie gefärbt und durch Massenspektrometrie analysiert. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 6
Abbildung 6: Vertreter führt nach 3D-Seite. Im Rahmen der ersten Dimension BN-Seite erschienen mehrere komplexe. Ihre Proteinkomponenten konnte durch zwei denaturierenden Folgeseiten, wodurch ein Muster mit diagonalen Streifen vor Ort weiter getrennt werden. Bitte klicken Sie hier für eine größere Version dieser Figur.

Sonde Sequenz
Thioredoxin h
weiter: CTCAAGGCAGCCAAAGAATC
Rückseite: ATGGCCTGAACATCGAACTC
RuBisCo kleine Kette
weiter: TTCACCGGCTTGAAGTCATC
Rückseite: CCGGGTACTCCTTCTTGCAT
Pollen-Hüllprotein BRU77666
weiter: TCAGAACTGGAGCTTCAACG
Rückseite: TTCCTTAATGGCCTCAGTGG

Tabelle 1: Primer verwendet für Phloem Probe Reinheitskontrolle. Bestätigen Phloem Probe Reinheit Primer spezifisch für Rubisco kleine Kette, Thioredoxin h und Pollen Hüllprotein cDNA Amplification einsetzbar.

Puffer und Lösungen Inhalt Kommentar
dunkel blaue Kathode Puffer B 15 mM Bis-Tris pH 7,0
50 mM Tricine
0,02 % (w/V) Coomassie blue G250
Rezept ist von Fiala Et Al. 17 angepasst.
7.0 sollte der pH-Wert eingestellt werden
Puffer kann als ein 10 X Lager gebildet werden
leichte blaue Kathode Puffer B/10 15 mM Bis-Tris pH 7,0
50 mM Tricine
0,002 % (w/V) Coomassie blue G250
Puffer kann durch Verdünnung Kathode Puffer B mit Kathode Puffer ohne Coomassie hergestellt werden
Anode Puffer
50 mM Bis-Tris pH 7,0
Puffer kann als ein 10 x Stammlösung hergestellt werden
2 x SDS-Probenpuffer
125 mM Tris-HCl pH 6,8
4 % SDS
20 % Glycerin
0,2 M DVB-T
0,02 % (w/V) Bromophenol blue
Puffer 1 X TBE Puffer übertragen
89 mM Tris pH 7.6
89 mM Borsäure
2 mM EDTA
TBE-Puffer kann gemacht und als Vorräte an 5 X oder 10 X gespeichert werden. Es ist wichtig, mit RNase-freie deionisiertes Wasser.
2 x SSC-Puffer
300 mM NaCl
30 mM Na3Citrat pH 7,0
3 x Gel-Puffer
3 M Tris
1 M HCl
0,3 % SDS

pH 8.45
Rezept von Schägger 19 angepasst
Tris-Tricine Gel Lösung A
Für 10 mL:
30 % Acrylamid-Bisacrylamide (29,1) 3,34 mL
6 M Harnstoff
3 X Gel 3,34 mL Puffer
70 % Glycerin 1,4 mL
10 mL DdH2O hinzufügen
10 % APS 40 ΜL
TEMED 4 ΜL
Gewicht 6 M Harnstoff und 3 x Gel-Puffer, der Acrylamid-Bisacrylamide Lösung und 70 % Gycerol hinzufügen. Erhitzen Sie auf 60 ° C in einem Wasserbad auf den Harnstoff zu solubilisieren. Fügen Sie DdH2O bis 10 mL, 10 % APS und TEMED für die Polymerisation.
Tris-Tricine Gel Lösung B
Für 6 mL:
30 % Acrylamid-Bisacrylamide (29,1) 0,8 mL
6 M Harnstoff
3 X Gel Puffer 1,5 mL
6 mL DdH2O hinzufügen
10 % APS 45 ΜL
TEMED 4,5 ΜL
Gewicht 6 M Harnstoff und 3 x Gel Puffer und Acrylamid-Bisacrylamide Lösung hinzufügen. Erhitzen Sie auf 60 ° C in einem Wasserbad auf den Harnstoff zu solubilisieren. Fügen Sie DdH2O bis 10 mL, 10 % APS und TEMED für die Polymerisation.
1 x Tris-Tricine laufenden Puffer (Anode)
100 mM Tris
22,5 mM HCl

pH 8,9
Rezept von Schägger 19 angepasst
1 x Tris-Tricine laufenden Puffer (Kathode)
100 mM Tris
100 mM Tricine
1 % SDS


pH 8,25
Rezept von Schägger 19 angepasst
Sauren Puffer
100 mM Tris
100 mM Essigsäure
4 % SDS Stapeln gel
Für 2 mL:
DdH2O 1,4 mL
30 % Acrylamid-Bisacrylamide (37.5:1) 0,33 mL
1 M Tris pH 6,8 0,25 mL
10 % SDS 20 ΜL
10 % APS 20 ΜL
ΜL TEMED 2
15 % SDS Trennung gel
Für 10 mL:
DdH2O 2,3 mL
30 % Acrylamid-Bisacrylamide (37.5:1) 5 mL
1.5 M Tris pH 8,8 2,5 mL
10 % SDS 100 ΜL
10 % APS 100 ΜL
TEMED 4 ΜL
1 x SDS laufenden Puffer
25 mM Tris
192 mM Glycin
0,1 % SDS
Coomassie Färbelösung
5 % (w/V) Aluminiumsulfat-(14-18)-Hydrat
10 % (V/V) Ethanol (96 %)
2 % (V/V) Orthophosphorsäure Säure (85 %)
0,02 % (w/V) Coomassie Brilliant Blue G-250
 
ULTRAhyb Gromer Hybridisierung Puffer AMBION, Life Technologies

Tabelle 2: Lösungen und Puffer Rezepte. Liste aller Puffer und Lösungen für 3D-PAGE-Analyse erforderlich.

Nein zu erkennen. MW OBS [kDa]. Identifikation Organismus Den Beitritt nein. MW [kDa] Maskottchen-Partitur
CIV_1 130 Vermeintliche Krankheit Widerstand Protein At4g19050 B. napus CDX78917 131.1 110
CIV_2 130 Vermeintliche Krankheit Widerstand Protein At4g19050 B. napus CDX78917 131.1 89
CIV_3 100 Heat shock 70 kDa-Protein 14-wie B. napus XP_013748865 89,9 113
CIV_4 90 Eukaryotische Dehnung Faktor 2
Zellteilung Steuern Protein 48 Homolog A
B. napus
B. napus
CDX90241
CDY41316.1
89,5
89,5
111
197
CIV_5 85 Heat shock Protein 90-2-like B. rapa XP_009132342 79,8 172
CIV_6 80 Threonin--tRNA-ligase
Glycin - tRNA-ligase
B. oleracea
B. napus
XP_013599115
CDY43195
81,5
80,8
110
88
CIV_7 70 Heat Shock Protein 70 kDa
Lysin - tRNA Ligase-wie
B. oleracea
B. napus
XP_013685267
XP_013747530
67,8
69,9
230
150
CIV_8 65 Myrosinase
Aspartate--tRNA-Ligase 2
Asparagin - tRNA Ligase 1
B. napus
B. napus
B. napus
ABQ42337
XP_013670803
XP_013729126
60,6
61,6
63,5
183
141
153
CIV_9 60 Myrosinase B. napus ABQ42337 60,6 164
CIV_10 55 Adenosylhomocysteinase 2-wie B. rapa XP_009135865 53.1 139
CIV_11 55 Dehnung Faktor 1-Alpha 1-wie B. oleracea XP_013586115 51,9 161
CIV_12 50 Cystin-Lyase CORI3-wie B. napus XP_013653143 48,1 237
CIV_13 44 Cystin-Lyase CORI3-wie B. rapa XP_009108611 48,3 213
CIV_14 38 Fruktose-Bisphosphate aldolase B. rapa XP_009115993 38,4 226
CIV_15 45 Cystin-Lyase CORI3-wie B. rapa XP_009108611 48,3 219
CIV_16 45 Cystin Lyase CORI3 B. rapa CDY69765 46,9 209
CIV_17 38 Fruktose-Bisphosphate aldolase B. rapa XP_009115993 38,4 124
CIV_18 18 Peptidyl-Prolyl-Cis-Trans-Isomerase CYP18-3-like B. napus XP_009101932 18.3 128
CIV_19 45 Cystin-Lyase CORI3-wie B. rapa XP_009108611 48,3 177

Tabelle 3: identifiziert Proteinkomponenten aus Komplex IV. Mehrere tRNA Ligases und weitere Proteine der tRNA verbindliche Anlage gefunden wurden mittels MALDI-TOF Masse spektrometrische Analyse nach 3D-Seite.

Discussion

Das Phloem ist ein Fach von großem Interesse, da es den wichtigsten Transportweg für Photoassimilates bildet, und auch ist für Langstrecken Signalisierung zwischen verschiedenen pflanzlichen Teile9,20,34, 35. Neben kleinen Molekülen haben Makromoleküle wie Proteine und RNA mit Phloem Wartung und Signalisierung4,7,8verwickelt. Die Analyse der Zusammensetzung der Phloem ist durch die eingeschränkte Erreichbarkeit auf Phloem Proben in den meisten Pflanzenarten beschränkt. Die Insekten Mandrin Technik ist vielseitig einsetzbar, sondern experimentell anspruchsvoll und resultiert in sehr geringen Mengen von Phloem Proben11. Eine einfache Technik zum Phloem Probenahme ist EDTA erleichtert Exsudation12. EDTA bilden zweiwertige Ionen wie Calcium und verhindert somit Schließung der Sieb Platten von P-Proteine und Zellstress. Es ist einfach zu bedienen, aber ist anfällig für Verunreinigungen durch beschädigte Zellen und Proben verdünnt. Abbauende zweiwertige Ionen durch EDTA könnte auch zu einem Zusammenbruch der bestehenden Anlagen führen. Allerdings ermöglicht es Probenahme aus einer Vielzahl von Arten, einschließlich der Modellpflanze A. Thaliana15. Spontane Exsudation von Phloem Sap tritt nur in einer kleinen Anzahl von Pflanzenarten. Es ist eine invasive Methode, die erheblichen Verletzungen der Pflanze Gewebe10beinhaltet. Vor kurzem haben wir als eine Art Modell für das Studium Fernverkehr4,8,20 B. Napus etabliert. Hier können Sie Phloem Sap von kleinen Einschnitten, probieren die Verwundung Effekte und Kontaminationsquellen reduziert.

Verwenden verschiedene Stichprobenverfahren, das Proteom von Phloem Proben aus verschiedenen Pflanzenarten wurde untersucht in den letzten Jahren7,8,17,36,37, 38,39. Für diese Studien Proteom Proteine wurden extrahiert und unter denaturierenden Bedingungen ausgefällt und erlauben daher keinerlei Rückschlüsse auf Protein: Protein und Protein: Nukleinsäure-Interaktionen unter heimischen Bedingungen zu präsentieren. Co-Immunopräzipitation (CoIP) und Overlay-Assays zeigten, dass eine große Ribonucleoprotein komplexe könnte im Phloem-Saft von Kürbis40vorhanden, aber es nicht nachgewiesen wurde, dass makromolekulare komplexe unter heimischen Bedingungen innerhalb existieren der Phloem-System.

Blaue native Seite, eingeführt durch Schägger Et al. 26, in Kombination mit weiteren hochauflösenden Gel-Elektrophorese Schritte ermöglichen die Trennung der einzelnen Komponenten der große Proteinkomplexe. Mit 3D-Seite Analysen der native B. Napus Phloem Exsudat, konnten wir kürzlich zeigen, dass mehrere im Phloem Proben existieren hohen Molekulargewicht Protein: Protein und RNP-komplexe enzymatisch aktive4 sind. Alternative Methoden um Proteinkomplexe sowie RNPs zu isolieren, wie Größe Ausgrenzung Chromatographie existieren könnte, aber nicht in Bezug auf Auflösung im Vergleich zu BN-Seite. Darüber hinaus für eine angemessene Qualität der komplexen Trennung müssen Größe Ausgrenzung Spalte Matrizen die insgesamt komplexer Molekulargewichte untersucht angepasst werden. Analysieren komplexe unterschiedlicher Größe werden daher fordern verschiedene Typen von Spalten ist kostenintensiv und lässt sich nicht als hohe Fokussierung macht als BN-Seite.

Wichtige Schritte um komplexe aus B. Napus zu analysieren sind den Gesamtbetrag der Phloem Sap als Ausgangsmaterial verwendet. Mindestens 600 µL Phloem Probe sind notwendig und können aus fünf gut-gewässerten Pflanzen gewonnen werden. Für 3D-Seite und BN Nordbeflecken ist es notwendig, das erste BN-Gel mit einer ausreichenden Menge von Phloem Proben beginnen. Um dies zu erreichen, sind Phloem Proben konzentriert, bis gut und mindestens 20 bis 30 µg Protein in jeder geladen werden kann, dass Triplicates der gleichen Probe parallel ausgeführt werden. Zu niedrige oder zu hohe Konzentrationen reduzieren die Erkennung von komplexen (Abbildung 3). Phloem Proben müssen in Reaktionsgefäßen auf Eis gesammelt und eingefroren für die spätere Verwendung zur Vermeidung von Proteinabbau und Umsatz gespeichert werden soll. Protease-Inhibitoren sind in allen Phloem Proteome analysiert gefunden worden, aber auch ein vollaktives Proteasom in das Phloem von B. Napus4beschrieben wurde. Darüber hinaus abhängig von Volumen und Zusammensetzung Phloem Proben die Sampling-Zeit-Punkt und Umweltbedingungen10. Daher muss darauf geachtet werden, zur gleichen Zeit des Tages unter ähnlichen Bedingungen zu sammeln. Stress-Behandlungen (z.B. Trockenheit) reduzieren die Menge der Bast, die gesammelt werden können. Um einzelne Proteine durch Massenspektrometrie zu identifizieren, ist es zwingend erforderlich, um mögliche Keratin Verunreinigungen durch tragen von Handschuhen die Zeit zu begrenzen. Keratin führt zu zusätzlichen Signale während der Masse Spec Analyse und Proteinidentifikation behindert. Ausführen der BN-Seite an eine höhere Spannung oder bei Raumtemperatur führen zur Erwärmung des Gels, die Demontage der fragilen komplexe führen können.

Die hier vorgestellten Protokoll eignet sich für die Analyse von Protein: Protein-komplexe. Wir zeigen auch, dass es verwendet werden kann, um bestimmte RNAs enthalten in den komplexen parallel zu erkennen. Um dies zu erreichen, haben wir vor kurzem ein Protokoll für northern Blot-4BN eingeführt. RNAs sind anfällig für Abbau durch RNAse Verunreinigungen. Um diesen Abbau zu begrenzen sollte DEPC-behandelte Wasser verwendet werden.

Wichtigste Einschränkungen der vorgestellten Methode gehören die Schätzung des Molekulargewichtes von Proteinkomplexen getrennt von BN-Seite, da Migrationsverhalten auf Größe, Form und auch posttranslationale Modifikationen der komplexe31abhängt, 41. Abschätzung der Größe der RNP-komplexe ist noch komplizierter durch den Einfluss von Nukleinsäuren auf das Migrationsverhalten. Es kann auch nicht verhindert werden, dass komplexe gleicher Größe in einem einzigen Band Co migrieren. Dies führt zu der falschen Vorhersage von komplexen Kompositionen. Überprüfen daher die beobachteten Interaktionen mit komplementären Techniken, kann z. B. durch funktionelle Assays4, erforderlich sein. Auch verloren nur schwach oder vorübergehend zu einem makromolekulare Komplex verbundenen Proteine in der BN-Puffer verwendet. Um dies zu vermeiden, könnte Proben vernetzt, was auch zu Artefakten führen können oder nicht Proteinidentifikation, oder der Pufferbedingungen optimiert werden.

Im Gegensatz zu klassischen 2D-Seite, die Kombination von Harnstoff und SDS-PAGE ermöglicht die Trennung nach Hydrophobie und Molekulargewicht statt isoelektrischen Punkt (pI) und Molekulargewicht 28, und schränkt nicht die Trennung an Proteine von einem spezifische pI reichen. Ähnlich wie bei klassischen 2D-Seite, getrennten Proteine sind als einzelne Flecken sichtbar, aber auf einer diagonalen Linie 4,28 (Abbildung 5, Abbildung 6). Weitere hydrophobe Proteine erscheinen in Flecken über diese Diagonal, während mehr hydrophile Proteine sich unterhalb der Linie28 befinden. In diesem Protokoll verwendeten Polyacrylamid-Konzentrationen werden Proteine zwischen 25 bis 80 kDa gut zu trennen. Ermöglicht einer Trennung von kleineren oder größeren Proteinen die Polyacrylamid Konzentration variiert werden oder Farbverlauf Gele eingesetzt werden, in der dritten Dimension. Die Komponenten des komplexen IV (Abbildung 3) getrennt durch 3D-Seite (Abbildung 6) wurden ausgeschnitten, Trypsin verdaut und durch Massenspektrometrie analysiert. Dies führte bei der Identifizierung von mehreren tRNA Ligases. Die Komponenten der anderen Anlagen wurden vor kurzem veröffentlicht 4. Unsere 3D-Seite aktiviert die Trennung der verschiedenen Ligases, nämlich Aspartat-, Asparagin, Threonin, Lysin und Glycin Ligases mit ähnlichen Molekulargewichten (Tabelle 3). Mit einer Methionin-tRNA-spezifische-Sonde, wir konnten potenziell gebundene tRNA innerhalb komplexer IV erkennen, aber wenn in voller Länge tRNA oder tRNA Fragmente in der Anlage sind kann nicht mit den Sonden verwendet diskriminiert werden. Um zu überprüfen, wenn die Nukleinsäuren wirklich gefesselt innerhalb des Komplexes und Co nicht migrieren sind, Protease Phloem Sap verdaut können Proben als geeignete Migration Kontrollen dienen.

Es wurde bereits spekuliert, dass Protein Übersetzung im Phloem Sieb Röhren, auftreten kann, da fast die meisten Komponenten der gesamten Ribosom sowie Dehnung Faktoren im Phloem Proben4,7gefunden worden sind. Unsere Feststellung der tRNA und tRNA Ligases scheint diese Idee zu unterstützen. Allerdings tRNA Fragmente vorhanden im Phloem Proben aus Kürbis haben gezeigt, dass potente Inhibitoren der Übersetzung42 werden und funktionelle Ribosomen scheinen zu fehlen4, was darauf hindeutet, dass die Übersetzung nicht stattfinden kann.

Zusammengenommen kann das Protokoll hier präsentierten die Trennung von nativen Protein: Protein und sogar RNP komplexe aus Bast Proben und die Trennung und Identifizierung ihrer einzelnen Komponenten mit hoher Auflösung. Die Anwendung dieser Methode ermöglicht die Entdeckung neuartiger Protein und RNP-komplexe im Phloem Proben und kann daher neue Funktionen in diesem hoch spezialisierten Werk Fach aufzuklären.

Disclosures

Die Autoren haben nichts preisgeben.

Acknowledgments

Jennifer Deke und Urszula Zarzenska danken wir für ihre wissenschaftliche Unterstützung. Diese Arbeit wurde von einem Career Integration Grant (CIG, PCIG14-GA-2013-63 0734) von der Europäischen Kommission im Rahmen des 7. Rahmenprogramms, Grant LFF-GK06 'DELIGRAH' (Landesforschungsförderung Hamburg) und das DFG-Stipendium (DFG-KE 856_6-1) finanziell unterstützt. verliehen an JK.

Materials

Name Company Catalog Number Comments
1.5 mL reaction tubes Eppendorf 30120086
10 well comb for SDS PAGE, thickness 1 mm BioRad 1653359
2-Propanol AppliChem 131090
30 % Acrylamide-bisacrylamide solution (29:1) solution BioRad 1610156
30 % Acrylamide-bisacrylamide solution (37.5:1) solution BioRad 1610158
96 % Ethanol Carl Roth P075
Acetic acid Carl Roth 6755
Agarose Lonza 50004
Aluminum sulfate-(14-18)-hydrate AppliChem 141101
Ammonium peroxodisulfate (APS) Carl Roth 9592.3
Bis-Tris AppliChem A3992
Boric acid AppliChem A2940
Bromophenol blue AppliChem A2331
Centrifugal concentrators e.g. Vivaspin 500 (Mwco 10 kDa) Sartorius VS0102
Chemiluminescent Nucleic Acid Detection Module Kit Thermo Fisher Scientific 89880
Chromatography papers e.g. 3 mm CHR Whatman 3030-153
CoolBox M30 System Biocision BCS-133
Coomassie brilliant Blue G-250 AppliChem A3480
Diethyl pyrocarbonate (DEPC) AppliChem A0881
Dithiothreitol (DTT) AppliChem A1101
DNase I AppliChem A3778
Ethanol abs. AppliChem A3693
Ethylenediaminetetraacetic acid (EDTA) AppliChem A1103
Gel Imaging system e.g. Chemidoc Touch BioRad 1708370
GeneRuler 1kb plus Thermo Fisher Scientific SM1331
Glycerol AppliChem 141339
Glycine AppliChem 131340
Heating block TS1 Biometra 846-051-500
Hybridization oven e.g. GFL Hybridization Incubator 7601 GFL 7601
Hypodermic needle (0.8 mm) B Braun 4658309
IPG gel comb, thickness 1 mm BioRad 1653367
Labeling of RNA e.g.Biotin 3'end DNA Labeling Kit Thermo Fisher Scientific 89818
Native gradient gel e.g. Novex NativePAGE 4–16% Bis-Tris protein gel Invitrogen BN1002BOX
Nylon membrane e.g. Hybond-N+ Amersham Pharmacia RPN203B
Ortho-phosphoric acid Carl Roth 6366.1
PageRuler prestained protein ladder Thermo Fisher Scientific 26616
Power supply for Gel electrophoresis EPS Amersham Pharmacia 18-1130-01 available from GE Healthcare
RNA Cleanup Kit Qiagen 74204
Semi dry blot e.g. Fastblot 43B semi dry Blot Biometra 846-015-100
Sodium chloride (NaCl) AppliChem A1149
Sodium dodecyl sulfate (SDS) AppliChem 142363
Synthesis of cDNA e.g. RevertAid First Strand cDNA Synthesis Kit Thermo Fisher Scientific K1621
Tetramethylethylenediamine (TEMED) AppliChem A1148
Tricine AppliChem A3954
Tris AppliChem A1086
Tri-sodium citrate dihydrate AppliChem A3901
TRIzol Reagent Thermo Fisher Scientific 15596026
ULTRAhyb Ultrasensitive Hybridization Buffer Thermo Fisher Scientific AM8670
Urea AppliChem A1360
UV Crosslinker e.g. Stratalinker 2400 Agilent NC0477671 from Fisher Scientific
Vertical electrophoresis apparatus e.g.The XCell SureLock Mini-Cell or Mini-Protean III System Thermo Fisher Scientific or BioRad EI0001 or 1658004
Wipers e.g. KIMWIPES Delicate Task Wipers Kimberly-Clark 34120

DOWNLOAD MATERIALS LIST

References

  1. Kempers, R., van Bel, A. J. E. Symplasmic connections between sieve element and companion cell in the stem phloem ofVicia faba L. have a molecular exclusion limit of at least 10 kDa. Planta. 201, (2), 195-201 (1997).
  2. Stadler, R., et al. Expression of GFP-fusions in Arabidopsis companion cells reveals non-specific protein trafficking into sieve elements and identifies a novel post-phloem domain in roots. Plant J. 41, (2), 319-331 (2005).
  3. Imlau, A., Truernit, E., Sauer, N. Cell-to-cell and long-distance trafficking of the green fluorescent protein in the phloem and symplastic unloading of the protein into sink tissues. Plant Cell. 11, (3), 309-322 (1999).
  4. Ostendorp, A., et al. Functional analysis of Brassica napus phloem protein and ribonucleoprotein complexes. New Phytol. 214, (3), 1188-1197 (2017).
  5. Paultre, D. S. G., Gustin, M. -P., Molnar, A., Oparka, K. J. Lost in Transit: Long-Distance Trafficking and Phloem Unloading of Protein Signals in Arabidopsis Homografts. Plant Cell. 28, (9), 2016-2025 (2016).
  6. Sali, A., Glaeser, R., Earnest, T., Baumeister, W. From words to literature in structural proteomics. Nature. 422, (6928), 216-225 (2003).
  7. Lin, M. -K., Lee, Y. -J., Lough, T. J., Phinney, B. S., Lucas, W. J. Analysis of the Pumpkin Phloem Proteome Provides Insights into Angiosperm Sieve Tube Function. Mol. Cell. Proteomics. 8, (2), 343-356 (2008).
  8. Giavalisco, P., Kapitza, K., Kolasa, A., Buhtz, A., Kehr, J. Towards the proteome of Brassica napus phloem sap. Proteomics. 6, (3), 896-909 (2006).
  9. Lucas, W. J., Yoo, B. C., Kragler, F. RNA as a long-distance information macromolecule in plants. Nat. Rev. Mol. Cell. Bio. 2, (11), 849-857 (2001).
  10. Dinant, S., Kehr, J. Sampling and Analysis of Phloem Sap. Plant Mineral Nutrients. 953, 185-194 (2013).
  11. Kennedy, J. S., Mittler, T. E. A Method of obtaining Phloem Sap via the Mouth-parts of Aphids. Nature. 171, (4351), 528 (1953).
  12. King, R. W., Zeevaart, J. A. Enhancement of Phloem exudation from cut petioles by chelating agents. Plant Physiol. 53, (1), 96-103 (1974).
  13. Alosi, M. C., Melroy, D. L., Park, R. B. The regulation of gelation of Phloem exudate from cucurbita fruit by dilution, glutathione, and glutathione reductase. Plant Physiol. 86, (4), 1089-1094 (1988).
  14. Dinant, S., Bonnemain, J. -L., Girousse, C., Kehr, J. Phloem sap intricacy and interplay with aphid feeding. Comptes rendus biologies. 333, (6-7), 504-515 (2010).
  15. Tetyuk, O., Benning, U. F., Hoffmann-Benning, S. Collection and analysis of Arabidopsis phloem exudates using the EDTA-facilitated Method. J Vis Exp. (80), e51111 (2013).
  16. Kovalskaya, N., Owens, R., Baker, C. J., Deahl, K., Hammond, R. W. Application of a modified EDTA-mediated exudation technique and guttation fluid analysis for Potato spindle tuber viroid RNA detection in tomato plants (Solanum lycopersicum). J. Virol. Methods. 198, 75-81 (2014).
  17. Rodriguez-Medina, C., Atkins, C. A., Mann, A. J., Jordan, M. E., Smith, P. M. Macromolecular composition of phloem exudate from white lupin (Lupinus albus L). BMC Plant Biol. 11, (1), 36 (2011).
  18. Taylor, J. S., Thompson, B., Pate, J. S., Atkins, C. A., Pharis, R. P. Cytokinins in the Phloem Sap of White Lupin (Lupinus albus L.). Plant Physiol. 94, (4), 1714-1720 (1990).
  19. Yoo, B., et al. A Systemic Small RNA Signaling System in Plants. Plant Cell. 16, (8), 1979-2000 (2004).
  20. Buhtz, A., Springer, F., Chappell, L., Baulcombe, D. C., Kehr, J. Identification and characterization of small RNAs from the phloem of Brassica napus. Plant J. 53, (5), 739-749 (2008).
  21. Chalhoub, B., et al. Plant genetics. Early allopolyploid evolution in the post-Neolithic Brassica napus oilseed genome. Science. 345, (6199), 950-953 (2014).
  22. Sasaki, T., Chino, M., Hayashi, H., Fujiwara, T. Detection of several mRNA species in rice phloem sap. Plant Cell Phys. 39, (8), 895-897 (1998).
  23. Doering-Saad, C., Newbury, H. J., Bale, J. S., Pritchard, J. Use of aphid stylectomy and RT-PCR for the detection of transporter mRNAs in sieve elements. J Exp. Bot. 53, (369), 631-637 (2002).
  24. Ruiz-Medrano, R., Xoconostle-Cázares, B., Lucas, W. J. Phloem long-distance transport of CmNACP mRNA: implications for supracellular regulation in plants. Dev. 126, (20), 4405-4419 (1999).
  25. Schägger, H., Cramer, W. A., von Jagow, G. Analysis of molecular masses and oligomeric states of protein complexes by blue native electrophoresis and isolation of membrane protein complexes by two-dimensional native electrophoresis. Anal. Biochem. 217, (2), 220-230 (1994).
  26. Schägger, H., von Jagow, G. Blue native electrophoresis for isolation of membrane protein complexes in enzymatically active form. Anal. Biochem. 199, (2), 223-231 (1991).
  27. Fiala, G. J., Schamel, W. W. A., Blumenthal, B. Blue native polyacrylamide gel electrophoresis (BN-PAGE) for analysis of multiprotein complexes from cellular lysates. J Vis Exp. (48), e2164 (2011).
  28. Rais, I., Karas, M., Schägger, H. Two-dimensional electrophoresis for the isolation of integral membrane proteins and mass spectrometric identification. Proteomics. 4, (9), 2567-2571 (2004).
  29. Schägger, H. Tricine-SDS-PAGE. Nature protocols. 1, (1), 16-22 (2006).
  30. Wittig, I., Braun, H. -P., Schägger, H. Blue native PAGE. Nat Protoc. 1, (1), 418-428 (2006).
  31. Eubel, H., Braun, H. -P., Millar, A. H. Blue-native PAGE in plants: a tool in analysis of protein-protein interactions. Plant Methods. 1, (1), 11 (2005).
  32. Laemmli, U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227, (5259), 680-685 (1970).
  33. Dyballa, N., Metzger, S. Fast and sensitive colloidal coomassie G-250 staining for proteins in polyacrylamide gels. J Vis Exp. (30), (2009).
  34. Turnbull, C. G. N., Lopez-Cobollo, R. M. Heavy traffic in the fast lane: long-distance signalling by macromolecules. New Phytol. 198, (1), 33-51 (2013).
  35. Hall, S. M., Baker, D. A. The chemical composition of Ricinus phloem exudate. Planta. 106, (2), 131-140 (1972).
  36. Barnes, A., Bale, J., Constantinidou, C., Ashton, P., Jones, A., Pritchard, J. Determining protein identity from sieve element sap in Ricinus communis L. by quadrupole time of flight (Q-TOF) mass spectrometry. J. Exp. Bot. 55, (402), 1473-1481 (2004).
  37. Walz, C., Giavalisco, P., Schad, M., Juenger, M., Klose, J., Kehr, J. Proteomics of curcurbit phloem exudate reveals a network of defence proteins. Phytochemistry. 65, (12), 1795-1804 (2004).
  38. Walz, C., Juenger, M., Schad, M., Kehr, J. Evidence for the presence and activity of a complete antioxidant defence system in mature sieve tubes. Plant J. 31, (2), 189-197 (2002).
  39. Kehr, J. Phloem sap proteins: their identities and potential roles in the interaction between plants and phloem-feeding insects. J Exp. Bot. 57, (4), 767-774 (2006).
  40. Ham, B. -K., Brandom, J. L., Xoconostle-Cázares, B., Ringgold, V., Lough, T. J., Lucas, W. J. A polypyrimidine tract binding protein, pumpkin RBP50, forms the basis of a phloem-mobile ribonucleoprotein complex. Plant Cell. 21, (1), 197-215 (2009).
  41. Schamel, W. W. Biotinylation of protein complexes may lead to aggregation as well as to loss of subunits as revealed by Blue Native PAGE. J. Immunol. Methods. 252, (1-2), 171-174 (2001).
  42. Zhang, S., Sun, L., Kragler, F. The phloem-delivered RNA pool contains small noncoding RNAs and interferes with translation. Plant Physiol. 150, (1), 378-387 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics