Phloem Sap provtagning från Brassica napus för 3D-sidan av Protein och ribonukleoprotein komplex

Biology
 

Summary

Här presenterar vi ett protokoll för att analysera stora infödda protein: protein och protein protein sammansättning: nukleinsyra komplex från raps (B. napus) phloem exsudat använder en 3D Polyakrylamidgelen elektrofores (sidan) strategi som kombinerar blå Native (BN) med två denatureringen sidor följt av massa spektrometriska identifiering.

Cite this Article

Copy Citation | Download Citations

Pahlow, S., Ostendorp, A., Krüßel, L., Kehr, J. Phloem Sap Sampling from Brassica napus for 3D-PAGE of Protein and Ribonucleoprotein Complexes. J. Vis. Exp. (131), e57097, doi:10.3791/57097 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Provtagning phloemen av högre växter är ofta arbetskrävande och kraftigt beroende av växtarterna. Dock kunde proteomet studier under denatureringen villkor uppnås i olika växtarter. Infödda protein: protein och protein: nukleinsyra komplex från phloem prover har ännu knappt analyserats, även om de kan spela en viktig roll i upprätthållandet av specialiserade kupén eller långdistans signalering. Stora molekylära sammanställningar kan isoleras med en blå infödda gelelektrofores (BN-sidan). Deras proteinkomponenter kan avgränsas med en efterföljande sodium dodecyl sulfate (SDS-sidan). Dock migrerar proteiner med liknande molekylvikter samarbete, vad kan hindra protein identifiering av masspektrometri. Att kombinera BN-sida med två olika denatureringen gelelektrofores steg, nämligen Tris-Tricine-urea och SDS-PAGE, möjliggör ytterligare separation av proteiner enligt deras hydrophilicitet/vattenavvisande egenskaper och ökar därmed resolution och framgång av protein identifiering. Det kan skilja proteiner som bara skiljer sig åt i deras posttranslationell ändringar. Dessutom kan blå infödda northern blotting användas för att identifiera RNA komponenter i makromolekylärt komplex. Vi visar att vår protokoll är lämplig att nysta upp protein och RNA komponenter av infödda protein: protein och ribonukleoprotein (RNP) komplex som förekommer i floem prover. Kombinera en blå infödda sida med två olika denatureringen sida steg kan hjälpa till att separera olika typer av stora proteinkomplex, och också möjliggör en ökad identifiering andelen deras komponenter genom masspektrometri. Protokollet är dessutom tillräckligt robust för att samtidigt upptäcka potentiellt bundna nukleinsyror inom enda proteinkomplex.

Introduction

De långväga conduits i floem är nödvändiga för fördelningen av organiska näringsämnen i högre växter, men är också involverade i regleringen av många olika processer som är viktiga för tillväxt och utveckling, patogen försvar och anpassning till negativa miljöförhållanden. Förutom små effektorer som joner, fytohormoner eller metaboliter själva, makromolekyler som proteiner och RNAs har nyligen dykt upp som potentiella signaler.

Studier har visat att phloem lastning av proteiner är storlek beroende och kontrollerad av utslagning storleksgränsen (SEL) av por-plasmodesmal enheter ansluta följeslagare celler (CC) och sikten element (SE) som är normalt i intervallet 10 till > 67 kDa1 , 2 , 3. men trots dessa storlek begränsningar större proteiner och protein komplex har hittats inom phloem systemet utmanande tanken på storlek utslagning4och även ospecifik förlust av proteiner från CC till SE har varit föreslagna5 .

Multiprotein samt stor ribonukleoprotein komplex spela avgörande roller i biosyntes och underhålla den strukturella integriteten av cell6. Det finns bevis att phloem-mobile protein-protein och ribonukleoprotein komplex finns4,7, men hittills lite om deras funktion är känd. I floem sieve element har protein: protein och RNP komplex varit inblandade med långväga transporter och / eller signalering8,9. För att riva upp funktioner flyttade komplexen, studera deras sammansättning under varierande miljö eller stress villkor krävs. För att uppnå detta, infödda komplex måste isoleras och deras komponenter måste separeras med tillräcklig upplösning.

För att isolera hög molekylvikt komplex från floem, är det först nödvändigt att erhålla sap prover i tillräcklig kvalitet och kvantitet. Den teknik som kan användas för phloem provtagning är beroende av växtarterna av intresse. Finns tre huvudsakliga metoder att få phloem sap 10: insekt stylectomy11, EDTA-stödda exsudation12och spontana exsudation13.

Phloem prover från Arabidopsis thaliana (A. thaliana), den större modellen växten i laboratorier över hela världen, kan endast erhållas genom EDTA-stödda exsudation eller bladlöss stylectomy14,15. Båda metoderna leda till antingen mycket utspädda phloem sap eller mycket låg prov belopp. EDTA-stödda exsudation är också benägna att kontaminering och kan inte representera de verkliga phloem sammansättning16. Spontan phloem exsudation är begränsad till växtarter som gurkväxter, Lupin eller yucca, där skära av växtdelar leder till en spontan utsläpp av phloem sap som kan vara enkelt insamlade13,17,18, 19. Vi har nyligen etablerat raps (Brassica napus) som lämplig modellsystem för phloem analys, eftersom det är en nära släkting till A. thaliana och flera mikroliter av phloem sap kan erhållas från små snitt som har visat sig vara av hög renhet4,8,20. Dessutom släpptes den B. napus genomsekvens 201421.

Förutom bladlöss stylectomy, alla metoder för insamling av phloem beskrivs inkluderar skada på omgivande vävnad på platsen för provtagning och floem sap sammansättning ändras som svar på skadan. Därför är det viktigt att kontrollera kvaliteten på phloem proverna, oavsett den provtagningsmetod som tillämpas. Det finns olika metoder för kvalitetskontroll av insamlade phloem sap, t.ex. genom bestämning av RNase aktivitet22,23, RT-PCR med grundfärg mot Rubisco8,24eller analys av sockret sammansättning8.

Olika metoder att isolera och separera proteinkomplex kan tillämpas, inklusive storlek utslagning kromatografi, sackaros densitet ultracentrifugering eller prov filtrering genom membran med distinkta molekylvikt cut offs. Dessa tillvägagångssätt tillåter dock inte hög upplösning. Den teknik som kallas blå infödda (sidan BN-), först beskrevs av Schägger et al. 25, är överlägsen när det gäller upplösning. Det har framgångsrikt använts för att bestämma molekylvikt av stora infödda proteinkomplex från olika organeller eller cellulär lysates och deras relativa förekomsten26,27.

För att ytterligare belysa den komplexa sammansättningen av proteinkomplex, är det nödvändigt att separera de enskilda komponenterna under denatureringen förhållanden, som leder till fullständig demontering av komplexa komponenter. Detta kan uppnås genom en andra dimension av SDS-PAGE 28,29 eller, för att uppnå högre upplösning, av en andra dimension av isoelektrisk fokusering (IEF) följt av en third dimension av SDS-PAGE30 och efterföljande identifiering av proteiner med hjälp av masspektrometri.

I detta protokoll beskriver vi provtagning av ren phloem sap från B. napus växter och analys av proteinkomplex från sådana phloem prover med en 3D elektroforetiska metod som kombinerar BN-sida med Tris-Tricine-urea-PAGE och SDS-PAGE. Separerade proteinet komplexa komponenter identifieras därefter med masspektrometri. Dessutom introducerar vi blå infödda northern blotting som en metod som möjliggör upptäckt av RNAs i stora RNP komplex4, utvidga tillämpligheten av metoden.

Protocol

1. provtagning och förberedelse av phloem sap från B. napus växter 4,8,20

  1. För phloem sap provtagning, använda välbevattnat 8-vecka-gammal B. napus växter att visa endast första blomningen för att förhindra pollen föroreningar.
  2. Använda en injektionsnål (Ø 0,8 mm) och punktuell Blomställningen stamceller flera gånger. Upprepa på flera andra blomställning stjälkar och andra växter att erhålla tillräckligt phloem sap (figur 2a).
    Obs: För komplex analys, det rekommenderas att börja med minst 600 µL av phloem sap. 4 till 5 växter kommer att ge mellan 200 och 700 µL av phloem sap.
  3. Torka av första droppen från skadade webbplatser med filterpapper. Dessa droppar främst innehåller mycket förorenat material från omgivande skadade vävnaden och måste kasseras.
  4. Samla in följande dropparna genom pipettering och lagra den insamlade exsudat i en pre kylda koniska 1,5 mL reaktionsröret vid-20 ° C med ett isfritt kylsystem.
  5. Fortsätt samla tills ingen ytterligare nedgång bildning är observerbara, men inte längre än 1 h. Proceduren kan upprepas efter två dagar utan betydande förlust av insamlade phloem sap.
    Obs: Insamlade phloem sap kan användas omedelbart eller förvaras vid-80 ° C för framtida analys. -80 ° C för förvaring, chock-frysa reaktionsröret i flytande kväve.
  6. Koncentrera sig phloem provet med cirka 1/6th av den ursprungliga volymen med centrifugal koncentratorer med en molekylvikt avskurna (MWCO) av 10 000 Dalton (Da). Centrifugera koncentrerad provet vid 4 ° C och 20 000 x g under minst 15 minuter att ta bort dammpartiklar.
    Obs: Phloem sap koncentrationen inte leder till en betydande förlust av proteiner.
  7. För efterföljande komplex analys, fortsätter du med steg 3.1.

2. phloem sap renhet kontroll med hjälp av omvänt transkriptas PCR (RT-PCR) 4,8,20

  1. Isolera total-RNA från phloem sap med en standardmetod för RNA-extraktion för flytande material (t.ex. utvinning TRIzol eller fenol-kloroform följt av isopropanol nederbörd från vattenfasen och etanol tvätt steg enligt den tillverkarens protokollet).
    Varning: Fenol-kloroform är giftiga. Arbeta under en huv med lämplig personlig skyddsutrustning. Extraherade RNA kan lagras i etanol vid-80 ° C i upp till sex månader.
  2. Ta bort kontaminering av DNA av matsmältning med DNAS I (1 u/µg) för 45 min vid 37 ° C och inaktivera enzymet genom att lägga till EDTA till en slutkoncentration på 5 mM och inkubera provet vid 75 ° C i 10 min.
  3. Att få rent RNA, rena och koncentrera provet genom en annan reningssteg (t.ex. använda RNA Clean kit, enligt tillverkarens instruktioner).
  4. Utföra ett omvänt transkriptas PCR (RT-PCR) för syntesen av cDNA med ett cDNA syntes kit använder 150 ng av ren RNA som beskrivs av tillverkaren 's protokoll.
    Obs: CDNA kan förvaras vid-20 ° C tills vidare användning.
  5. Använd 5 µL av cDNA som en mall för en vanlig PCR-reaktion som anges av tillverkaren, att förstärka fack-specifika avskrifter och kontrollera av agaros gelelektrofores. Kontrollera renheten av phloem prover genom exempelvis primers för rubisco liten subunit, thioredoxin h och pollen coat protein (figur 1b, tabell 1).

3. blå infödda sida 4,25,26,31

  1. Använd antingen själv hällde infödda gradient geler som beskrivs någon annanstans27 eller kommersiella Bis-Tris gradient geler.
  2. Belastning som 20 till 30 µg provets koncentrerat protein per brunn på gelen i minst tripletter.
  3. Kör gelen vid 4 ° C och 150 V med mörk blå katoden buffert B och anoden buffert (tabell 2) tills provet gick 1/3rd av gelen (ca. 20-30 min, figur 3a).
    Obs: För northern blotting, en enda gel lane är tillräckligt, medan för analys av protein sammansättning av 3D sida och masspektrometri rekommenderas att kombinera samma band från upp till tio gel lanes koncentrera sig mindre riklig proteiner.
  4. Pausa körningen och exchange Mörk blå katoden buffert B med ljus blå katoden buffert B/10 (tabell 2) och fortsätta körningen. Slut gelen kör när blå framsidan börjar eluera ur gelen (ca. 120-180 min, figur 3a).
    Obs: Färdiga blå infödda gelen kan lagras vid 4 ° C i minst en vecka. Långvarig lagring kan leda till diffusa band och bör undvikas. Mörk blå buffert B kan återanvändas.

4. Valfritt: Påvisande av RNA som använder blå infödda northern blotting 4

  1. Klipp ut distinkt band eller använda hela gel lane från blå infödda gelen och överföra dem på en nylon membran av halvtorr blotting på 3,5 mA/cm2 för 60 min och markera den övre och nedre gel gränsen med en penna på membranet (figur 4a).
  2. Efter blotting, tvätta membranet med DEPC-behandlad vatten och torka mellan två filtrerpapper.
  3. Utföra UV-crosslinking skrynkligt membran med 120.000 µJ cm2 (85 s om använder Crosslinker i Tabellen för material).
  4. Pre hybridisera membranet med 6 mL av hybridisering buffert (kommersiella eller egengjord) för 60 min vid 68 ° C i en hybridisering ugn (figur 4a).
  5. Lägg till ytterligare 1 mL av hybridisering buffert innehållande 4 µL av 3'-biotinylerade sonder (100 nM).
  6. Inkubera membranet med sonden över natten, medan kyla ugnen från 68 ° C till 37 ° C.
  7. Tvätta membranet med buffert innehållande 2 x SSC och 0,1% SDS, för 5 min i rumstemperatur ta bort sonder bunden ospecifikt.
    Varning: SDS kan orsaka irritationer. Använd skyddshandskar och labbrock när du arbetar med SDS och SDS innehållande lösningar.
  8. Utför detektion av 3'-biotinylerade sonderna på det membran t.ex. med en streptividin-HRP-konjugat och urin som pepparrotperoxidas (HRP) substrat, vilket resulterar i en känslig Kemiluminiscens reaktion (figur 4a).

5. andra dimension: Tris-Tricine-urea sida 4,28

  1. Punktskatt enda band från blå infödda gelen. Kombinera band från prover som kör i parallella körfält att uppnå en ytterligare koncentration av komplexa proteiner (figur 5).
    Obs: Exciderad band kan lagras i enda reaktionsrören tills vidare användning vid 4 ° C.
  2. Häll en gel med 12% i Tris-Tricine-urea (tjocklek av 1 mm, 6,8 x 8,6 cm (bredd x längd)). Förbereda 10 mL gel lösning A separerande gelen (tabell 2), häll mellan två glasplattor och överlägg med isopropanol. Ta bort isopropanol efter polymerisationen är färdig och överföra 4 mL gel lösning B (tabell 2) för stapling gelen på gel och infoga en 10 väl kamma.
    Varning: Opolymeriserade akrylamid kan vara neurotoxiska och TEMED är skadligt vid inandning. Använd personlig skyddsutrustning alltid och arbeta under en huv.
  3. Överföra banden exciderad gel i en 1,5 mL reaktionsröret och tillsätt 1 mL 2 x SDS prov buffert för Jämviktstiden av gel bitar (figur 5, tabell 2).
    1. Inkubera proverna för 10 min vid rumstemperatur, innan kokning i ett värmeblock (95 ° C) eller i en mikrovågsugn och inkubera proverna igen i rumstemperatur i ytterligare 15 minuter.
    2. Stapla flera skakad gel bitar som representerar samma komplex i en enda gel ficka.
    3. Utföra den elektrofores med anod och katod kör buffertar på 150 V 45-60 min och punktskatt hela gel körfältet.
  4. Inkubera skär körfältet i 20 min i sura buffert (100 mM Tris, 100 mM ättiksyra) och låt jämvikta i 125 mM Tris-HCl, pH 6,8 för en annan 20 min (figur 5).

6. tredje dimensionen: SDS-PAGE 4,32

  1. Häll en 15% SDS separera gel enligt Laemmli32 (tjocklek: 1,5 mm, 6,8 x 8,6 cm (bredd x längd)) (tabell 2) och Lägg ett tunt lager på en 4% stapling gel ovan.
    Försiktighet: SDS, akrylamid och TEMED är giftiga och skadliga. Arbeta under en huv och bära skyddsutrustning.
  2. Överföra den skakad gel lanen på SDS gelen och täck gelen med 0,5% (w/w) agaros i 1 x SDS kör buffert kompletteras med ett spår av bromofenolblått (figur 5).
  3. Koka SDS kör buffert med agaros i mikrovågsugn före lastning på gelen.
  4. För att köra en protein markör för att uppskatta molekylvikt av enstaka komponenter, infoga en filterpapper på ena änden av gelen tills agarosen stelnat eller använda en speciell kam används vanligtvis för IPG geler.
  5. Kör gelen vid 150 V för 60 min och fläcken färgning gelen med kolloidal Coomassie, Silver fläcken eller någon annan metod lämpar sig för efterföljande massa spektrometriska analys.
  6. Analysera de synliga protein fläckar med massa spektrometriska metoder som matris-assisted laser desorption/jonisering time-of-flight (MALDI-TOF) eller LC-MS/MS masspektrometri.
    Obs: Vi rekommenderar för att använda den kolloidal Coomassie färgning som redan beskrivs33. I våra händer, ännu mindre riklig proteiner kan färgas tillräckligt och gör en massa spektrometriska analys med rimlig datakvalitet.

Representative Results

Här presenterar vi ett protokoll som tillåter analys av protein: protein samt protein: RNA komplex i floem prover från Brassica napus. Arbetsflödet illustreras i figur 1. En stor fördel med B. napus över andra modellorganismer är möjligheten att relativt lätt phloem provsamling från små punkteringar i blomställning stammen. Detta gör det möjligt för att erhålla rena phloem prover i comparably stora mängder. När provtagning phloem, är det alltid lämpligt att kontrollera för föroreningar, till exempel genom RT-PCR-8. Representativa resultat erhållet från en ren phloem prov avbildas i figur 2. Icke-kontaminerade phloem prover bör visa en synlig band för thioredoxin h, medan ingen signal för rubisco och pollen coat protein bör visas. Den små subuniten rubisco kan fungera som en kontroll i prover från blad, blomställning stjälkar eller pollen. Thioredoxin h får upptäckas i alla prover, eftersom dess mRNA har hittats i phloemen av olika arter, medan pollen coat protein avskriften bör endast synlig i blomknopp prover. Föroreningar kan uppstå när phloem provtagning utförs på fullt blommande växter (pollen coat protein) eller när de första dropparna från floem provtagning punkteringar inte ignoreras korrekt (rubisco).

Före BN-sidan är det obligatoriskt att koncentrera phloem sap. Med 20 till 30 µg av protein per brunn, minst fyra stora protein complex band blir synliga efter BN-sida av B. napus phloem sap, för låg eller för höga koncentrationer tillåter inte en tydlig åtskillnad mellan komplexen (figur 3). Det rekommenderas att ladda flera gel band som representerar samma komplex i en enkel ficka av andra-dimension gel att ytterligare koncentrera proteinerna från varje enstaka komplex för nedströms behandling och efterföljande massa spektrometriska identifiering.

För att identifiera de enskilda komponenterna i floem makromolekylärt komplex, vi kombinerat den inledande BN-sidan med en andra dimension Tris-Tricine-urea och en tredje dimension SDS-PAGE för att uppnå en separation av enstaka proteiner. Här, kan ett avskiljande med hög upplösning observeras på grund av olika protein migration beteenden i urea och SDS-PAGE geler. Vanligtvis kommer proteiner som tillhör en enda komplex att visas som en diagonal linje över gelen. Proteiner ovanför denna linje har en ökad vattenavvisande egenskaper, medan proteiner under raden representerar mer hydrofil kära28 (figur 5, figur 6).

För karakterisering av RNP komplex använde vi en del av en BN-PAGE gel för att utföra BN northern blotting. Efter blotting av hela körbana på en nylon membran och crosslinking av UV-strålning, kan RNA visualiseras med RNA-specifika prober som illustreras i figur 4. Här är det visat att en viss tRNA finns bara i en specifik komplex. Lägenhetskomplexet tRNA-bindande proteinkomponenter kan undersökas ytterligare med hjälp av 3D gel-strategi som beskrivs ovan. Massa spektrometriska analyser visade att detta komplex innehåller främst tRNA-ligases vad bekräftar aktiviteten tRNA bindande hittade av BN northern blotting.

Figure 1
Figur 1: arbete flöde av analysen av ribonukleoprotein komplex i floem sap av raps. Efter provtagning och floem prover utförs BN-sida för att separera infödda komplex. Sådan BN-PAGE geler kan en parallell analys av nukleinsyror av BN northern blotting och identifiering av de protein-komponenterna av komplex av masspektrometri. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: provtagning och renhet kontroll av phloem sap av B. napus. Efter punktering blomställning stammen av 8-10 vecka gammal oljeväxter rapsen med steril injektionsnål, exsudat samlas in med en pipett och överförs till en iskall reaktionsröret (a) att bekräfta renheten av phloem proverna RT-PCR utförs, förstärka avskrifter av thioredoxin h, rubisco liten subunit och pollen coat protein i vävnadsspecifika prover (b) RT-PCR utan omvänt transkriptas utfördes som kontroll (-). Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: BN-sida. Schematisk representation av blå infödda sida med koncentrerad phloem prover av B. napus. (a) efter lastning gradient protein gelen med 15-20 µL av koncentrerad phloem sap, utförs BN-sidan med 1 x Mörk blå katoden buffert B 150 V för 20-30 min i ett kallt rum. Sedan bufferten är utbytt mot 1 x ljus blå katoden buffert B/10 och sidan är färdig på 150 V för 120-180 min tills den mörka blå kör främre slut på gelen. De BN-PAGE gelerna visar fyra distinkta band som representerar fyra olika hög molekylvikt komplex. (b) laddar för lite (c) eller för mycket (d) phloem proteiner reducerar synbarheten av enskilda komplex. Klicka här för att se en större version av denna siffra.

Figure 4
Figur 4: BN northern blotting. Schematisk bild av BN northern blotting metod. (a) ett körfält av BN-sidan överförs till ett nylon membran av halvtorr blotting. Efter UV-crosslinking och före hybridisering inkuberas membranet med RNA särskilda sonder (här en metionin tRNA-specifika probe), som är biotinylerade i slutet 3'-i hybridisering ugn över natten. Gratis sonder avlägsnas genom tvättning steg och påvisande av RNA utförs av en streptividin-HRP-konjugat och urin. Använder denna metod, vi observerade att komplex IV från BN-sidan innehåller metionin tRNA. (b) Coomassie färgade gel och tRNA blot likna två olika gel körfält kör parallellt att undvika migration skillnader. Klicka här för att se en större version av denna siffra.

Figure 5
Figur 5: 3D-sida. Schematisk bild av metoden 3D-sidan. Flera band från samma komplex censurerade från en BN-PAGE gel, inkuberas i lastning buffert och övergår i en brunn i den andra dimensionen Tris-Tricine-urea-PAGE. Efter elektrofores, är hela gel körfält klipp ut, tvättas i sura syra buffert, utjämnad och placeras på en 15% SDS-PAGE gel. Efter den tredje dimensionen sida är separerade proteinerna Coomassie färgas och analyseras med masspektrometri. Klicka här för att se en större version av denna siffra.

Figure 6
Figur 6: representativa resultat efter 3D-sida. Inom den första dimensionen BN-sida visades flera komplex. Deras proteinkomponenter kunde avskiljas ytterligare genom två efterföljande denatureringen sidorna, vilket resulterar i en diagonal spot mönster. Klicka här för att se en större version av denna siffra.

Sonden Sekvens
Thioredoxin h
fram: CTCAAGGCAGCCAAAGAATC
omvänd: ATGGCCTGAACATCGAACTC
RubisCO lilla kedjan
fram: TTCACCGGCTTGAAGTCATC
omvänd: CCGGGTACTCCTTCTTGCAT
Pollen coat protein BRU77666
fram: TCAGAACTGGAGCTTCAACG
omvänd: TTCCTTAATGGCCTCAGTGG

Tabell 1: Primers används för phloem prov renhet kontroll. För att bekräfta phloem prov renhet kan primers som är specifika för rubisco lilla kedjan, thioredoxin h och pollen coat protein användas för cDNA förstärkning.

Buffrar och lösningar Innehåll Kommentar
Mörk blå katoden buffert B 15 mM Bis-Tris pH 7,0
50 mM Tricine
0,02% (w/v) Coomassie blå G250
recept är anpassade från Fiala et al. 17
pH bör anpassas till 7.0
Bufferten kan göras som en 10 x lager
ljus blå katoden buffert B/10 15 mM Bis-Tris pH 7,0
50 mM Tricine
0,002% (w/v) Coomassie blå G250
Bufferten kan förberedas genom att späda ut katod buffert B med katod buffert utan Coomassie
anod buffert
50 mM Bis-Tris pH 7,0
Bufferten kan framställas som en 10 x stamlösning
2 x SDS prov buffert
125 mM Tris-HCl pH 6,8
4% SDS
20% glycerol
0,2 M DTT
0,02% (w/v) bromofenolblått
Överföra buffert 1 x TBE buffert
89 mM Tris pH 7,6
89 mM borsyra
2 mM EDTA
TBE-buffert kan gjort och lagras som lager av 5 x eller 10 x. Det är viktigt att använda RNase-fri avjoniserat vatten.
2 x SSC buffert
300 mM NaCl
30 mM Na3citrat pH 7,0
3 x gel buffert
3 M Tris
1 M HCl
0,3% SDS

pH 8,45
recept från Schägger 19
Tris-Tricine gel lösning A
För 10 mL:
30% akrylamid-bisacrylamide (29: 1) 3.34 mL
6 M Urea
3 x gel buffert 3.34 mL
70% glycerol 1,4 mL
Lägg till ddH2O till 10 mL
10% APS 40 ΜL
TEMED 4 ΜL
Vikt 6 M Urea och Lägg till 3 x gel buffert, akrylamid-bisacrylamide lösning och 70% gycerol. Värm till 60 ° C i ett vattenbad till solubilize Ureaen. Lägg till ddH2O 10 ml, 10% APS och slutligen TEMED för polymerisation.
Tris-Tricine gel lösning B
För 6 mL:
30% akrylamid-bisacrylamide (29: 1) 0,8 mL
6 M Urea
3 x gel buffert 1,5 mL
lägga till ddH2O 6 mL
10% APS 45 ΜL
TEMED 4.5 ΜL
Vikt 6 M Urea och Lägg till 3 x gellösningen buffert och akrylamid-bisacrylamide. Värm till 60 ° C i ett vattenbad till solubilize Ureaen. Lägg till ddH2O 10 ml, 10% APS och slutligen TEMED för polymerisation.
1 x Tris-Tricine körs buffert (anod)
100 mM Tris
22,5 mM HCl

pH 8,9
recept från Schägger 19
1 x Tris-Tricine körs buffert (katod)
100 mM Tris
100 mM Tricine
1% SDS


pH 8,25
recept från Schägger 19
Sura buffert
100 mM Tris
100 mM ättiksyra
4% SDS stapling gel
För 2 mL:
ddH2O 1,4 mL
30% akrylamid-bisacrylamide (37.5:1) 0,33 mL
1 M Tris pH 6,8 0,25 mL
10% SDS 20 ΜL
10% APS 20 ΜL
TEMED 2 ΜL
15% SDS separera gel
För 10 mL:
ddH2O 2,3 mL
30% akrylamid-bisacrylamide (37.5:1) 5 mL
1.5 M Tris pH 8,8 2,5 mL
10% SDS 100 ΜL
10% APS 100 ΜL
TEMED 4 ΜL
1 x SDS rinnande buffert
25 mM Tris
192 mM glycin
0,1% SDS
Coomassie färgning lösning
5% (w/v) aluminium sulfate-(14-18)-hydrat
10% (v/v) etanol (96%)
2% (v/v) ortofosforsyra (85%)
0,02% (w/v) Coomassie Brilliant Blue G-250
 
ULTRAhyb Ultrasensitive hybridisering buffert Ambion, Life Technologies

Tabell 2: lösningar och buffert recept. Lista över alla buffrar och lösningar krävs för 3D-analys.

Plats nr. MW obs. [kDa] Identifiering Organismen Anslutningen nr. MW [kDa] MASKOT Poäng
CIV_1 130 Förmodad sjukdom bröstcancerresistent protein At4g19050 B. napus CDX78917 131,1 110
CIV_2 130 Förmodad sjukdom bröstcancerresistent protein At4g19050 B. napus CDX78917 131,1 89
CIV_3 100 Värme chock 70 kDa-protein 14-liknande B. napus XP_013748865 89,9 113
CIV_4 90 Eukaryota brottöjning 2
Celldelning styra protein 48 homolog A
B. napus
B. napus
CDX90241
CDY41316.1
89,5
89,5
111
197
CIV_5 85 Heat shock protein 90-2-liknande B. rapa XP_009132342 79,8 172
CIV_6 80 Treonin--tRNA ligase
Glycin--tRNA ligase
B. oleracea
B. napus
XP_013599115
CDY43195
81,5
80,8
110
88
CIV_7 70 Heat shock protein 70 kDa
Lysin--tRNA ligase-liknande
B. oleracea
B. napus
XP_013685267
XP_013747530
67,8
69,9
230
150
CIV_8 65 Myrosinase
Aspartat--tRNA ligase 2
Asparagin--tRNA ligase 1
B. napus
B. napus
B. napus
ABQ42337
XP_013670803
XP_013729126
60,6
61,6
63,5
183
141
153
CIV_9 60 Myrosinase B. napus ABQ42337 60,6 164
CIV_10 55 Adenosylhomocysteinase 2-liknande B. rapa XP_009135865 53,1 139
CIV_11 55 Elongation factor 1-alpha 1-liknande B. oleracea XP_013586115 51,9 161
CIV_12 50 Cystin lyasen CORI3-liknande B. napus XP_013653143 48,1 237
CIV_13 44 Cystin lyasen CORI3-liknande B. rapa XP_009108611 48,3 213
CIV_14 38 Fruktos-bisphosphate aldolase B. rapa XP_009115993 38,4 226
CIV_15 45 Cystin lyasen CORI3-liknande B. rapa XP_009108611 48,3 219
CIV_16 45 Cystin lyasen CORI3 B. rapa CDY69765 46,9 209
CIV_17 38 Fruktos-bisphosphate aldolase B. rapa XP_009115993 38,4 124
CIV_18 18 Peptidyl-prolyl cis-trans isomerase CYP18-3-liknande B. napus XP_009101932 18,3 128
CIV_19 45 Cystin lyasen CORI3-liknande B. rapa XP_009108611 48,3 177

Tabell 3: identifierade proteinkomponenter från komplex IV. Flera tRNA ligases och ytterligare proteiner har hittats inom tRNA bindande komplex med VITEK-MS samlas spektrometriska analys efter 3D-sidan.

Discussion

Floem är ett fack av stort intresse, eftersom den utgör den viktigaste transportled för photoassimilates och är också viktigt för långdistans signalering mellan olika växt delar9,20,34, 35. Förutom små molekyler, har makromolekyler som proteiner och RNAs varit inblandade med phloem underhåll och signalering4,7,8. Analysen av phloem sammansättning begränsas av begränsad tillgänglighet till phloem prover i de flesta växtarter. Insekt mandrängen tekniken är allmänt tillämplig, men experimentellt krävande och resulterar i mycket små mängder av phloem prover11. En enkel teknik som används för phloem provtagning är EDTA-stödda exsudation12. EDTA kelater tvåvärda joner som kalcium och därmed hindrar stängning av sikten plattor av P-proteiner och callose. Det är lätt att använda, men är benägna att kontaminering av skadade celler och prover är utspädda. Nedbrytande tvåvärda joner av EDTA kan också leda till en uppdelning av befintliga komplex. Det tillåter dock provtagning från en rad olika arter, inklusive modell växten A. thaliana15. Spontan utsöndring av phloem sap förekommer endast i ett litet antal växtarter. Det är en invasiv metod som innebär betydande skada växt vävnader10. Vi har nyligen etablerat B. napus som modell art för att studera långväga transporter4,8,20. Här, kan phloem sap avsmakas från små snitt, vilket minskar skadade effekter och källor till förorening.

Använder olika urvalsmetoder, proteomet phloem prover från olika växtarter har undersökts i senaste åren7,8,17,36,37, 38,39. För dessa studier i proteomet var proteiner extraheras och fälls ut under denatureringen villkor och därför tillåter inte slutsatser om protein: protein och protein: nukleinsyra interaktioner presentera infödda villkor. Co-immunoprecipitation (CoIP) och overlay analyser visade att en större ribonukleoprotein komplex kan finnas i floem sap från pumpa40, men det visades inte att någon makromolekylärt komplex finns infödda villkor inom den Phloem system.

Blue-native sida, introducerades av Schägger et al. 26, i kombination med efterföljande högupplösta gelelektrofores steg aktiverar separation av de enskilda komponenterna i stora proteinkomplex. Med hjälp av 3D-sidan analyser av infödda B. napus phloem exsudat, kunde vi nyligen visar att flera hög molekylvikt protein: protein och RNP komplex finns i floem prover och enzymatiskt aktiva4. Alternativa metoder att isolera proteinkomplex samt RNPs liknande storlek utslagning kromatografi kanske finns, men misslyckas när det gäller upplösning jämfört med BN-sida. Dessutom för en rimlig kvalitet på komplexa separation måste storlek utslagning kolumn matriser anpassas enligt de övergripande komplexa molekylvikter utreds. Analysera komplex av olika storlek kommer därför att kräva olika typer av kolonner som kostar intensiv och tillåter inte som hög fokuserande effekt som en BN-sida.

Kritiska steg att analysera komplex från B. napus inkluderar den totala mängden phloem sap används som utgångsmaterial. Minst 600 µL phloem prov är nödvändiga och kan erhållas från fem välbevattnat växter. För 3D-sidan och BN northern blotting är det nödvändigt att börja den inledande BN-gel med en tillräcklig mängd phloem prover. För att uppnå detta, är phloem prover koncentrerade tills 20 till 30 µg av protein kan läsas in i varje brunn och minst exemplar av samma prov löper parallellt. För låg eller för hög koncentrationer minska detektion av komplex (figur 3). Phloem prover behöver samlas in reaktionsrören på is och bör förvaras frysta för senare användning för att undvika proteinnedbrytning och omsättning. Proteashämmare har hittats i alla phloem proteom analyseras, men också en fullt aktiv proteasom beskrevs i phloemen av B. napus4. Dessutom beror volym och sammansättning av phloem prover på provtagning tidpunkt och miljöförhållanden10. Därför måste vara försiktig att samla på samma tid på dagen under liknande förhållanden. Stress behandlingar (t.ex. torka) kan minska mängden phloem som kan samlas. För att identifiera enstaka proteiner av masspektrometri, är det obligatoriskt att begränsa möjliga keratin föroreningar genom att bära handskar hela tiden. Keratin leder till ytterligare signaler under massa spec analys och hämmar protein identifiering. Kör BN-sidan på en högre spänning eller vid rumstemperatur kan leda till uppvärmning av gelen som kan resultera i demontering av bräckliga komplex.

Det protokoll som presenteras här är lämplig för analys av protein: protein komplex. Vi visar också att det kan användas för att identifiera specifika RNAs i komplexen parallellt. För att uppnå detta, infört vi nyligen ett protokoll för BN northern blotting4. RNAs är utsatta för nedbrytning av RNAse föroreningar. För att begränsa sådan nedbrytning DEPC-behandlad, vatten ska användas.

Huvudsakliga begränsningar av den presenterade metoden inkluderar uppskattning av molekylvikten för proteinkomplex åtskilda av BN-sida, eftersom migration beteende beror på storlek, form och även på posttranslationell modifieringar av komplex31, 41. Storlek uppskattning av RNP komplex är ännu mer komplicerat på grund av påverkan av nukleinsyror på migration beteende. Det kan också inte förhindras att komplex av samma storlek samarbete migrerar i ett enda band. Detta kan leda till felaktiga förutsägelse av komplexa kompositioner. Därför att kontrollera de observerade interaktionerna med kompletterande tekniker, kan t.ex. genom funktionella analyser4, vara nödvändigt. Proteiner som endast svagt eller övergående är associerad till ett makromolekylärt komplex kan också förloras i BN bufferten används. För att undvika detta, prover kan vara tvärbunden, vad kan också leda till artefakter eller kan förhindra protein identifiering, eller villkor som buffert kan optimeras.

I motsats till klassisk 2D-sida, kombinationen av urea - och SDS-PAGE gör separationen enligt vattenavvisande egenskaper och molekylvikt istället för isoelektrisk punkt (pI) och molekylär vikt 28, och begränsar inte separation mot proteiner av en specifika pI utbud. Liknar klassisk 2D-sida, separerade proteinerna är synliga som enstaka fläckar, men på en diagonal linje 4,28 (figur 5, figur 6). Mer hydrofoba proteiner visas i fläckar över denna diagonal, medan mer hydrofil proteiner finns nedan i linje28. De polyakrylamid koncentrationer används i detta protokoll kommer att separera proteiner mellan 25 till 80 kDa väl. För att tillåta en separation av mindre eller större proteiner i polyakrylamid koncentration kan varieras eller lutning geler kan användas i den tredje dimensionen. Komponenterna i komplex IV (figur 3) åtskilda av 3D-sidan (figur 6) klipptes ut, trypsin rötas och analyseras med masspektrometri. Detta resulterade i att identifiera flera tRNA ligases. Komponenterna i andra komplexen har nyligen publicerade 4. Vår 3D-sida aktiverat separation av olika ligases, nämligen aspartat, asparagin, treonin, lysin och glycin ligases, med liknande molekylvikter (tabell 3). Använder en metionin tRNA-specifika sond, vi kunde upptäcka potentiellt bundna tRNA inom komplex IV, men om fullängds tRNA eller tRNA fragment i anläggningen inte kan diskrimineras med de sonder som används. För att kontrollera om nukleinsyror är verkligen bundna inom komplexet och inte samtidig migrering, proteas rötas phloem sap kan prover fungera som lämplig migration kontroller.

Det har tidigare spekulerats om att protein översättning kan förekomma inom phloem sieve rör, eftersom nästan de flesta komponenter i den hela Ribosomen samt töjning faktorer har hittats i floem prover4,7. Vår slutsats av tRNA och tRNA ligases tycks stödja denna idé. Dock tRNA fragment finns i floem prover från pumpa har visat sig vara potenta hämmare av översättning42 och funktionella ribosomer verkar vara frånvarande4, vilket tyder på att översättning inte kan ske.

Det protokoll som presenteras här tillsammans, och tillåter separation av infödda protein: protein och även RNP komplex från phloem prover och separation och identifiering av deras enskilda komponenter med hög upplösning. Tillämpningen av denna metod möjliggör upptäckten av romanen protein och RNP komplex i floem prover och kan därför belysa nya funktioner i detta mycket specialiserad anläggning fack.

Disclosures

Författarna har något att avslöja.

Acknowledgments

Vi tackar Jennifer Deke och Urszula Zarzenska för deras vetenskapliga stöd. Detta arbete fick ekonomiskt stöd av en karriär Integration Grant (CIG, PCIG14-GA-2013-63 0734) av Europeiska kommissionen inom det 7: e ramprogrammet, bidraget LFF-GK06 'DELIGRAH' (Landesforschungsförderung Hamburg) och DFG bidraget (DFG KE 856_6-1) delas ut till JK.

Materials

Name Company Catalog Number Comments
1.5 mL reaction tubes Eppendorf 30120086
10 well comb for SDS PAGE, thickness 1 mm BioRad 1653359
2-Propanol AppliChem 131090
30 % Acrylamide-bisacrylamide solution (29:1) solution BioRad 1610156
30 % Acrylamide-bisacrylamide solution (37.5:1) solution BioRad 1610158
96 % Ethanol Carl Roth P075
Acetic acid Carl Roth 6755
Agarose Lonza 50004
Aluminum sulfate-(14-18)-hydrate AppliChem 141101
Ammonium peroxodisulfate (APS) Carl Roth 9592.3
Bis-Tris AppliChem A3992
Boric acid AppliChem A2940
Bromophenol blue AppliChem A2331
Centrifugal concentrators e.g. Vivaspin 500 (Mwco 10 kDa) Sartorius VS0102
Chemiluminescent Nucleic Acid Detection Module Kit Thermo Fisher Scientific 89880
Chromatography papers e.g. 3 mm CHR Whatman 3030-153
CoolBox M30 System Biocision BCS-133
Coomassie brilliant Blue G-250 AppliChem A3480
Diethyl pyrocarbonate (DEPC) AppliChem A0881
Dithiothreitol (DTT) AppliChem A1101
DNase I AppliChem A3778
Ethanol abs. AppliChem A3693
Ethylenediaminetetraacetic acid (EDTA) AppliChem A1103
Gel Imaging system e.g. Chemidoc Touch BioRad 1708370
GeneRuler 1kb plus Thermo Fisher Scientific SM1331
Glycerol AppliChem 141339
Glycine AppliChem 131340
Heating block TS1 Biometra 846-051-500
Hybridization oven e.g. GFL Hybridization Incubator 7601 GFL 7601
Hypodermic needle (0.8 mm) B Braun 4658309
IPG gel comb, thickness 1 mm BioRad 1653367
Labeling of RNA e.g.Biotin 3'end DNA Labeling Kit Thermo Fisher Scientific 89818
Native gradient gel e.g. Novex NativePAGE 4–16% Bis-Tris protein gel Invitrogen BN1002BOX
Nylon membrane e.g. Hybond-N+ Amersham Pharmacia RPN203B
Ortho-phosphoric acid Carl Roth 6366.1
PageRuler prestained protein ladder Thermo Fisher Scientific 26616
Power supply for Gel electrophoresis EPS Amersham Pharmacia 18-1130-01 available from GE Healthcare
RNA Cleanup Kit Qiagen 74204
Semi dry blot e.g. Fastblot 43B semi dry Blot Biometra 846-015-100
Sodium chloride (NaCl) AppliChem A1149
Sodium dodecyl sulfate (SDS) AppliChem 142363
Synthesis of cDNA e.g. RevertAid First Strand cDNA Synthesis Kit Thermo Fisher Scientific K1621
Tetramethylethylenediamine (TEMED) AppliChem A1148
Tricine AppliChem A3954
Tris AppliChem A1086
Tri-sodium citrate dihydrate AppliChem A3901
TRIzol Reagent Thermo Fisher Scientific 15596026
ULTRAhyb Ultrasensitive Hybridization Buffer Thermo Fisher Scientific AM8670
Urea AppliChem A1360
UV Crosslinker e.g. Stratalinker 2400 Agilent NC0477671 from Fisher Scientific
Vertical electrophoresis apparatus e.g.The XCell SureLock Mini-Cell or Mini-Protean III System Thermo Fisher Scientific or BioRad EI0001 or 1658004
Wipers e.g. KIMWIPES Delicate Task Wipers Kimberly-Clark 34120

DOWNLOAD MATERIALS LIST

References

  1. Kempers, R., van Bel, A. J. E. Symplasmic connections between sieve element and companion cell in the stem phloem ofVicia faba L. have a molecular exclusion limit of at least 10 kDa. Planta. 201, (2), 195-201 (1997).
  2. Stadler, R., et al. Expression of GFP-fusions in Arabidopsis companion cells reveals non-specific protein trafficking into sieve elements and identifies a novel post-phloem domain in roots. Plant J. 41, (2), 319-331 (2005).
  3. Imlau, A., Truernit, E., Sauer, N. Cell-to-cell and long-distance trafficking of the green fluorescent protein in the phloem and symplastic unloading of the protein into sink tissues. Plant Cell. 11, (3), 309-322 (1999).
  4. Ostendorp, A., et al. Functional analysis of Brassica napus phloem protein and ribonucleoprotein complexes. New Phytol. 214, (3), 1188-1197 (2017).
  5. Paultre, D. S. G., Gustin, M. -P., Molnar, A., Oparka, K. J. Lost in Transit: Long-Distance Trafficking and Phloem Unloading of Protein Signals in Arabidopsis Homografts. Plant Cell. 28, (9), 2016-2025 (2016).
  6. Sali, A., Glaeser, R., Earnest, T., Baumeister, W. From words to literature in structural proteomics. Nature. 422, (6928), 216-225 (2003).
  7. Lin, M. -K., Lee, Y. -J., Lough, T. J., Phinney, B. S., Lucas, W. J. Analysis of the Pumpkin Phloem Proteome Provides Insights into Angiosperm Sieve Tube Function. Mol. Cell. Proteomics. 8, (2), 343-356 (2008).
  8. Giavalisco, P., Kapitza, K., Kolasa, A., Buhtz, A., Kehr, J. Towards the proteome of Brassica napus phloem sap. Proteomics. 6, (3), 896-909 (2006).
  9. Lucas, W. J., Yoo, B. C., Kragler, F. RNA as a long-distance information macromolecule in plants. Nat. Rev. Mol. Cell. Bio. 2, (11), 849-857 (2001).
  10. Dinant, S., Kehr, J. Sampling and Analysis of Phloem Sap. Plant Mineral Nutrients. 953, 185-194 (2013).
  11. Kennedy, J. S., Mittler, T. E. A Method of obtaining Phloem Sap via the Mouth-parts of Aphids. Nature. 171, (4351), 528 (1953).
  12. King, R. W., Zeevaart, J. A. Enhancement of Phloem exudation from cut petioles by chelating agents. Plant Physiol. 53, (1), 96-103 (1974).
  13. Alosi, M. C., Melroy, D. L., Park, R. B. The regulation of gelation of Phloem exudate from cucurbita fruit by dilution, glutathione, and glutathione reductase. Plant Physiol. 86, (4), 1089-1094 (1988).
  14. Dinant, S., Bonnemain, J. -L., Girousse, C., Kehr, J. Phloem sap intricacy and interplay with aphid feeding. Comptes rendus biologies. 333, (6-7), 504-515 (2010).
  15. Tetyuk, O., Benning, U. F., Hoffmann-Benning, S. Collection and analysis of Arabidopsis phloem exudates using the EDTA-facilitated Method. J Vis Exp. (80), e51111 (2013).
  16. Kovalskaya, N., Owens, R., Baker, C. J., Deahl, K., Hammond, R. W. Application of a modified EDTA-mediated exudation technique and guttation fluid analysis for Potato spindle tuber viroid RNA detection in tomato plants (Solanum lycopersicum). J. Virol. Methods. 198, 75-81 (2014).
  17. Rodriguez-Medina, C., Atkins, C. A., Mann, A. J., Jordan, M. E., Smith, P. M. Macromolecular composition of phloem exudate from white lupin (Lupinus albus L). BMC Plant Biol. 11, (1), 36 (2011).
  18. Taylor, J. S., Thompson, B., Pate, J. S., Atkins, C. A., Pharis, R. P. Cytokinins in the Phloem Sap of White Lupin (Lupinus albus L.). Plant Physiol. 94, (4), 1714-1720 (1990).
  19. Yoo, B., et al. A Systemic Small RNA Signaling System in Plants. Plant Cell. 16, (8), 1979-2000 (2004).
  20. Buhtz, A., Springer, F., Chappell, L., Baulcombe, D. C., Kehr, J. Identification and characterization of small RNAs from the phloem of Brassica napus. Plant J. 53, (5), 739-749 (2008).
  21. Chalhoub, B., et al. Plant genetics. Early allopolyploid evolution in the post-Neolithic Brassica napus oilseed genome. Science. 345, (6199), 950-953 (2014).
  22. Sasaki, T., Chino, M., Hayashi, H., Fujiwara, T. Detection of several mRNA species in rice phloem sap. Plant Cell Phys. 39, (8), 895-897 (1998).
  23. Doering-Saad, C., Newbury, H. J., Bale, J. S., Pritchard, J. Use of aphid stylectomy and RT-PCR for the detection of transporter mRNAs in sieve elements. J Exp. Bot. 53, (369), 631-637 (2002).
  24. Ruiz-Medrano, R., Xoconostle-Cázares, B., Lucas, W. J. Phloem long-distance transport of CmNACP mRNA: implications for supracellular regulation in plants. Dev. 126, (20), 4405-4419 (1999).
  25. Schägger, H., Cramer, W. A., von Jagow, G. Analysis of molecular masses and oligomeric states of protein complexes by blue native electrophoresis and isolation of membrane protein complexes by two-dimensional native electrophoresis. Anal. Biochem. 217, (2), 220-230 (1994).
  26. Schägger, H., von Jagow, G. Blue native electrophoresis for isolation of membrane protein complexes in enzymatically active form. Anal. Biochem. 199, (2), 223-231 (1991).
  27. Fiala, G. J., Schamel, W. W. A., Blumenthal, B. Blue native polyacrylamide gel electrophoresis (BN-PAGE) for analysis of multiprotein complexes from cellular lysates. J Vis Exp. (48), e2164 (2011).
  28. Rais, I., Karas, M., Schägger, H. Two-dimensional electrophoresis for the isolation of integral membrane proteins and mass spectrometric identification. Proteomics. 4, (9), 2567-2571 (2004).
  29. Schägger, H. Tricine-SDS-PAGE. Nature protocols. 1, (1), 16-22 (2006).
  30. Wittig, I., Braun, H. -P., Schägger, H. Blue native PAGE. Nat Protoc. 1, (1), 418-428 (2006).
  31. Eubel, H., Braun, H. -P., Millar, A. H. Blue-native PAGE in plants: a tool in analysis of protein-protein interactions. Plant Methods. 1, (1), 11 (2005).
  32. Laemmli, U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227, (5259), 680-685 (1970).
  33. Dyballa, N., Metzger, S. Fast and sensitive colloidal coomassie G-250 staining for proteins in polyacrylamide gels. J Vis Exp. (30), (2009).
  34. Turnbull, C. G. N., Lopez-Cobollo, R. M. Heavy traffic in the fast lane: long-distance signalling by macromolecules. New Phytol. 198, (1), 33-51 (2013).
  35. Hall, S. M., Baker, D. A. The chemical composition of Ricinus phloem exudate. Planta. 106, (2), 131-140 (1972).
  36. Barnes, A., Bale, J., Constantinidou, C., Ashton, P., Jones, A., Pritchard, J. Determining protein identity from sieve element sap in Ricinus communis L. by quadrupole time of flight (Q-TOF) mass spectrometry. J. Exp. Bot. 55, (402), 1473-1481 (2004).
  37. Walz, C., Giavalisco, P., Schad, M., Juenger, M., Klose, J., Kehr, J. Proteomics of curcurbit phloem exudate reveals a network of defence proteins. Phytochemistry. 65, (12), 1795-1804 (2004).
  38. Walz, C., Juenger, M., Schad, M., Kehr, J. Evidence for the presence and activity of a complete antioxidant defence system in mature sieve tubes. Plant J. 31, (2), 189-197 (2002).
  39. Kehr, J. Phloem sap proteins: their identities and potential roles in the interaction between plants and phloem-feeding insects. J Exp. Bot. 57, (4), 767-774 (2006).
  40. Ham, B. -K., Brandom, J. L., Xoconostle-Cázares, B., Ringgold, V., Lough, T. J., Lucas, W. J. A polypyrimidine tract binding protein, pumpkin RBP50, forms the basis of a phloem-mobile ribonucleoprotein complex. Plant Cell. 21, (1), 197-215 (2009).
  41. Schamel, W. W. Biotinylation of protein complexes may lead to aggregation as well as to loss of subunits as revealed by Blue Native PAGE. J. Immunol. Methods. 252, (1-2), 171-174 (2001).
  42. Zhang, S., Sun, L., Kragler, F. The phloem-delivered RNA pool contains small noncoding RNAs and interferes with translation. Plant Physiol. 150, (1), 378-387 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics