Phloem Sap prøveudtagning fra Brassica napus for 3D-side af Protein og Ribonucleoprotein komplekser

Biology
 

Summary

Her præsenterer vi en protokol til at analysere store nativt protein: protein og protein protein sammensætning: nukleinsyre komplekser fra raps (B. napus) phloem ekssudat ved hjælp af en 3D polyacrylamid gel elektroforese (side) tilgang ved at kombinere blå Native (BN) med to denaturering sider efterfulgt af massespektrometriske identifikation.

Cite this Article

Copy Citation | Download Citations

Pahlow, S., Ostendorp, A., Krüßel, L., Kehr, J. Phloem Sap Sampling from Brassica napus for 3D-PAGE of Protein and Ribonucleoprotein Complexes. J. Vis. Exp. (131), e57097, doi:10.3791/57097 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Prøveudtagning phloem af højere planter er ofte besværlig og betydeligt afhængig af plantearter. Dog kan proteomet studier under denatureringen betingelser opnås i forskellige plantearter. Nativt protein: protein og protein: nukleinsyre komplekser fra phloem prøver har endnu næppe blevet analyseret, selv om de kunne spille en vigtig rolle i opretholdelsen af denne specialiserede rum eller i langdistance signalering. Store Molekylær forsamlinger kan isoleres ved hjælp af en blå indfødte gelelektroforese (BN-side). Deres proteinkomponenter kan være adskilt af en efterfølgende dodecyl natriumsulfat (SDS-side). Dog overføre proteiner med lignende molekylære vægte Co, hvad kan hindre protein identifikation af massespektrometri. Kombinere BN-side med to forskellige denaturering gel elektroforese trin, nemlig Tris-Tricine-urea og SDS-PAGE, giver mulighed for en yderligere adskillelse af proteiner efter deres hydrofiliciteten/hydrophobicity og dermed øger opløsning og succes af protein identifikation. Det tillader selv adskille proteiner, der kun afviger i deres posttranslationelle modifikationer. Derudover kan blå indfødte nordlige blotting anvendes til at identificere RNA komponenterne i makromolekylære komplekser. Vi viser at vores protokol er egnet til at optrævle proteiner og RNA komponenter af nativt protein: protein og ribonucleoprotein (RNP) komplekser forekommer i phloem prøver. Kombinere en blå indfødte side med to forskellige denaturering side trin kan bidrage til at adskille forskellige slags store proteinkomplekser, og også giver mulighed for en øget identifikation sats af deres komponenter af massespektrometri. Derudover er protokollen robust nok til samtidig registrerer potentielt bundne nukleinsyrer inden for enkelt proteinkomplekser.

Introduction

De lange afstande ledningsanlæg af phloem er afgørende for tildelingen af organiske næringsstoffer i højere planter, men er også involveret i reguleringen af mange forskellige processer vigtigt for vækst og udvikling, patogen forsvar og tilpasning til den negative miljøforhold. Udover lille effektorer som ioner, Phytohormoner eller metabolitter, selv, er makromolekyler såsom proteiner og RNA'er for nylig dukket op som potentielle signaler.

Undersøgelser har vist at phloem lastning af proteiner er størrelse afhængige og kontrolleret af den udelukkelse størrelsesgrænsen (SEL) af de pore-plasmodesmal enheder, der forbinder følgesvend celler (CC) og sigten elementer (SE), som er typisk i rækken af 10 til > 67 kDa1 , 2 , 3. dog trods disse størrelse begrænsninger større proteiner og protein komplekser er blevet fundet i phloem systemet udfordrende idé om størrelse udstødelse4, og selv uspecifik tab af proteiner fra CC til SE har været foreslået5 .

Multiprotein samt store ribonucleoprotein komplekser spille centrale roller i biosyntese og opretholde den strukturelle integritet af celle6. Der er beviser for at phloem-mobile protein-protein og ribonucleoprotein komplekser eksisterer4,7, men hidtil vides lidt om deres funktion. I phloem si elementer har været impliceret protein: protein og RNP komplekser med transport over lange afstande og / eller signaling8,9. Der kræves for at optrævle de omplantede komplekser, at studere sammensætning under forskellige miljømæssige funktioner eller stress betingelser. For at opnå dette, indfødte komplekser skal isoleres, og deres komponenter skal være adskilt med tilstrækkelig opløsning.

For at isolere høj molekylvægt komplekser fra i phloem, er det nødvendigt først at få sap prøver i tilstrækkelig kvalitet og mængde. Den teknik, der kan bruges til phloem prøveudtagning afhænger af plantearter af interesse. Tre vigtigste metoder til at opnå phloem sap findes 10: insekt stylectomy11, EDTA-faciliteret udsondring12og spontane udsondring13.

Phloem prøver fra Arabidopsis thaliana (A. thaliana), den store model plante i laboratorier verden over, kan kun opnås af EDTA-faciliteret udsondring eller bladlus stylectomy14,15. Begge metoder fører til enten stærkt fortyndede phloem sap eller meget lav prøve beløb. EDTA-faciliteret udsondring er også udsat for forurening og kan ikke repræsentere virkelige phloem sammensætning16. Spontan phloem udsondring er begrænset til at plante arter som Cucurbitæ, Lupin eller yucca, hvor afskære plantedele fører til en spontan emission af phloem sap, der kan være let indsamlet13,17,18, 19. Vi for nylig har etableret raps (Brassica napus) som en passende modelsystem for phloem analyse, da det er en nær slægtning af A. thaliana og flere microliters af phloem sap kan fås fra små indsnit, der har vist sig at være af høj renhed4,8,20. Derudover blev B. napus genomet sekvens udgivet i 201421.

Bortset fra bladlus stylectomy, alle phloem samling metoder beskrevet omfatter skader på omkringliggende væv i stedet for prøveudtagning og sammensætningen af phloem sap kan ændre som reaktion på skade. Derfor er det absolut nødvendigt at kontrollere kvaliteten af phloem prøver, uanset den prøveudtagningsmetode anvendes. Der findes forskellige metoder til kontrol med kvaliteten af indsamlede phloem sap, f.eks. ved bestemmelse af RNase aktivitet22,23, RT-PCR med primere mod Rubisco8,24eller analyse af sukker sammensætning8.

Forskellige metoder til at isolere og adskille proteinkomplekser kan anvendes, herunder størrelse udstødelse kromatografi, saccharose tæthed ultracentrifugering eller prøve filtrering gennem membraner med særskilte molekylvægt cut offs. Men disse metoder ikke tillader høj opløsning. Teknik kaldet blå indfødte side (BN-side), første gang beskrevet af Schägger al.. 25, er overlegen i forhold til opløsning. Det blev med held bruges til at bestemme Molekylær vægten af store nativt proteinkomplekser fra forskellige organeller eller cellulære lysates og deres relative mængder26,27.

Du kan yderligere belyse den komplekse sammensætning af proteinkomplekser, er det nødvendigt at adskille de enkelte komponenter under denatureringen betingelser, fører til komplet demontering af de komplekse komponenter. Dette kan opnås ved en anden dimension af SDS-PAGE 28,29 , eller for at opnå højere opløsning, af en anden dimension af isoelektrisk fokusering (IEF) efterfulgt af en third dimension af SDS-PAGE30 og efterfølgende identifikation af proteiner ved hjælp af massespektrometri.

I denne protokol beskriver vi prøveudtagning af ren phloem sap fra B. napus planter og analyse af proteinkomplekser fra sådanne phloem prøver ved hjælp af en 3D elektroforese tilgang kombinerer BN-side med Tris-Tricine-urea-side og SDS-PAGE. Adskilte protein komplekse komponenter er efterfølgende identificeret ved hjælp af massespektrometri. Derudover indføre vi blå indfødte nordlige blotting som metode giver mulighed for påvisning af RNA'er i store RNP komplekser4, udvide anvendeligheden af tilgangen.

Protocol

1. prøveudtagning og forberedelse af phloem sap fra B. napus planter 4,8,20

  1. For phloem sap prøvetagning, bruge godt vandes 8-uge-forhenværende B. napus planter at Vis kun første blomstring for at forhindre pollen forureninger.
  2. Bruge en kanyle (Ø 0,8 mm) og punktformet Blomsterstanden stamceller flere gange. Gentag på flere andre blomsterstand stængler og på andre planter at få nok phloem sap (figur 2a).
    Bemærk: For kompleks analyse, det anbefales at starte med mindst 600 µL af phloem sap. 4-5 planter vil give mellem 200 og 700 µL af phloem sap.
  3. Aftørre den første dråbe fra de skadede websteder med filtrerpapir. Disse dråber hovedsagelig indeholder stærkt forurenet materiale fra de omkringliggende tilskadekomne væv og skal kasseres.
  4. Indsamle de følgende dråber af pipettering og gemme de indsamlede ekssudat i pre kølet konisk 1,5 mL reaktion rør ved-20 ° C ved hjælp af en isfri kølesystem.
  5. Fortsat indsamle indtil ingen yderligere drop dannelse er observerbare, men ikke længere end 1 time. Denne procedure kan gentages efter to dage uden betydelige tab af indsamlede phloem sap.
    Bemærk: Indsamlede phloem sap kan anvendes straks eller opbevares ved-80 ° C for fremtidige analyser. Til opbevaring af-80 ° C, chok-freeze reaktion røret i flydende kvælstof.
  6. Koncentrere phloem prøven til ca 1/6th af den oprindelige mængde ved hjælp af centrifugal koncentratorer med en molekylevægt på cut off (MWCO) på 10.000 dalton (Da). Der centrifugeres koncentreret prøven ved 4 ° C og 20.000 x g i mindst 15 min. til at fjerne støvpartikler.
    Bemærk: Phloem sap koncentration ikke fører til betydelige tab af proteiner.
  7. For efterfølgende kompleks analyse, gå videre med trin 3.1.

2. phloem sap renhed kontrol bruge reverse transkriptase PCR (RT-PCR) 4,8,20

  1. Isolere total RNA fra phloem sap ved hjælp af en standard RNA ekstraktion metode for flydende materiale (f.eks. TRIzol eller phenol-chloroform ekstraktion efterfulgt af isopropanol nedbør fra vandfasen og ethanol vaske trin i henhold til den producentens protocol).
    Forsigtig: Phenol-chloroform er giftigt. Arbejde under en hætte med passende personlige værnemidler. Den udpakkede RNA kan opbevares i ethanol ved-80 ° C i op til seks måneder.
  2. Fjerne forurening af DNA med fordøjelsen med DNase jeg (1 u/µg) for 45 min ved 37 ° C og inaktiverer enzymet ved at tilføje EDTA til en endelig koncentration på 5 mM og inkuberes stikprøve på 75 ° C i 10 min.
  3. For at få ren RNA, rense og koncentrere stikprøven af en anden rensning trin (f.eks. ved hjælp af RNA oprydning Kits, ifølge fabrikantens anvisninger).
  4. Udføre en reverse transkriptase PCR (RT-PCR) for syntese af cDNA med en cDNA syntese kit bruger 150 ng af ren RNA som beskrevet af fabrikanten 's protokol.
    Bemærk: CDNA kan opbevares ved-20 ° C indtil videre anvendelse.
  5. Brug 5 µL cDNA som en skabelon for en standard PCR reaktion som angivet af fabrikanten, at forstærke rum-specifikke udskrifter og kontrollere ved agarosegelelektroforese gelelektroforese. Bekræfte renheden af phloem prøver af fx ved hjælp af primere for rubisco lille underenhed, thioredoxin h og pollen frakke protein (figur 1b, tabel 1).

3. blå indfødte side 4,25,26,31

  1. Brug enten selvstændige hældte indfødte gradient geler som beskrevet andetsteds27 eller kommercielle Bis-Tris gradient geler.
  2. Belastning 20-30 µg i eksemplet koncentreret protein pr. brønd på gel i mindst triplicates.
  3. Kør gelen ved 4 ° C og 150 V ved hjælp af mørk blå katode buffer B og anode buffer (tabel 2) indtil prøven bestået 1/3rd gel (ca. 20-30 min, figur 3a).
    Bemærk: For nordlige blotting, en enkelt gel lane er tilstrækkelig, mens til analyse af protein sammensætning 3D side og massespektrometri anbefales det at kombinere den samme band fra op til ti gel baner til at koncentrere sig mindre rigelige proteiner.
  4. Pause flugt og exchange mørke blå katode buffer B med lys blå katode buffer B/10 (tabel 2) og fortsætte med at køre. Finish gel køre når de blå front begynder at eluere ud af gel (ca. 120 til 180 min., figur 3a).
    Bemærk: Den færdige blå indfødte gel kan opbevares ved 4 ° C i mindst en uge. Længere tids opbevaring kan føre til diffuse bands og bør undgås. Mørk blå buffer B kan genbruges.

4. valgfri: Påvisning af RNA ved hjælp af blå indfødte nordlige blotting 4

  1. Skåret ud forskellige bands eller bruge hele gel lane fra den blå indfødte gel og overføre dem til en nylon membran af semi-tør blotting på 3,5 mA/cm2 for 60 min. og markerer grænsen mellem øvre og nedre gel med en blyant på membran (figur 4a).
  2. Efter blotting, vaske membran med DEPC-behandlet vand og tørre mellem to papirfiltre.
  3. Udføre UV crosslinking af duppes membranen med 120.000 µJ/cm2 (85 s hvis ved hjælp af Crosslinker i Tabel af materialer).
  4. Pre krydse membran med 6 mL af hybridisering buffer (kommercielle eller Self-Made) for 60 min. ved 68 ° C i en hybridisering ovn (figur 4a).
  5. Tilføje en yderligere 1 mL af hybridisering buffer indeholdende 4 µL af 3'-biotinylated sonder (100 nM).
  6. Inkuber membranen med sonden natten, mens køling ovn fra 68 ° C til 37 ° C.
  7. Vask membranen med buffer, som indeholder 2 x SSC og 0,1% SDS, i 5 min ved stuetemperatur til at fjerne sonder bundet unspecifically.
    Forsigtig: SDS kan forårsage irritationer. Bære handsker og laboratoriekittel, når du arbejder med SDS og SDS som indeholder løsninger.
  8. Udføre påvisning af 3'-biotinylated sonder på membran fx med en Streptavidin-HRP-konjugerede og luminol som peberrod peberrodsperoxidase (HRP) substrat, hvilket resulterer i en følsom kemiluminescens reaktion (figur 4a).

5. for det andet dimension: Tris-Tricine-urea side 4,28

  1. Punktafgifter enkelt bands fra de blå indfødte gel. Kombinere bands fra prøver køre i parallelle baner til at opnå en yderligere koncentration af komplekse proteiner (figur 5).
    Bemærk: Skåret bands kan gemmes i enkelt reaktion rør indtil videre anvendelse ved 4 ° C.
  2. Hæld en 12% Tris-Tricine-urea gel (tykkelse på 1 mm, 6,8 cm x 8,6 cm (bredde x længde)). Forberede den adskillende gel (tabel 2), 10 mL af gelopløsning A hældes mellem to glasplader og overlay med isopropanol. Fjerne isopropanol efter polymerisering er færdig og overføre 4 mL af gelopløsning B (tabel 2) til stabling gel gel og Indsæt en 10 godt kam.
    Forsigtig: Upolymeriseret acrylamid kan være neurotoksiske og TEMED er skadelige indånding. Altid bære personlige værnemidler og arbejde under en hætte.
  3. Overføre skåret gel bands til en 1,5 mL reaktion tube og tilsættes 1 mL af 2 x SDS prøvebuffer for ækvilibrering gel stykker (figur 5, tabel 2).
    1. Inkuber prøver i 10 min. ved stuetemperatur, før kogning i en varme blok (95 ° C) eller i en mikrobølgeovn og inkuberes prøver igen ved stuetemperatur i en yderligere 15 min.
    2. Stable flere afbalancerede gel stykker der repræsenterer den samme kompleks i ét enkelt gel lomme.
    3. Udføre elektroforese med anode og katode kører buffere på 150 V i 45-60 min og punktafgifter hele gel lane.
  4. Inkuber den cut lane i 20 min. i sure buffer (100 mM Tris, 100 mM eddikesyre), og Blandingen henstår i 125 mM Tris-HCl, pH 6,8 til en anden 20 min (figur 5).

6. tredje dimension: SDS-PAGE 4,32

  1. Hæld en 15% SDS adskille gel ifølge Laemmli32 (tykkelse: 1.5 mm, 6,8 cm x 8,6 cm (bredde x længde)) (tabel 2) og tilføje et tyndt lag af en 4% stabling gel ovenfor.
    Forsigtig: SDS, acrylamid og TEMED er giftigt og skadeligt. Arbejde under en hætte og bære personlige værnemidler.
  2. Overføre de afbalancerede gel lane på SDS gel og dække gel med 0,5% (w/w) Agarosen i 1 x SDS kører buffer suppleret med et spor af bromophenol blå (figur 5).
  3. Kog SDS kører buffer med Agarosen i mikrobølgeovnen forudgående indlæsning på gelen.
  4. Kører en protein markør for at anslå de molekylvægte, inden for de enkelte komponenter, indsætte et stykke filtrerpapir den ene ende af gelen, indtil Agarosen solidificeret eller bruge en speciel kam bruges typisk til IPG geler.
  5. Kør gelen på 150 V for 60 min. og pletten farvning gel med enten kolloid Coomassie, sølv plet eller andre metode egnet til efterfølgende massespektrometrisk analyse.
  6. Analysere de synlige protein steder ved hjælp af massespektrometriske metoder som matrix assisted laser desorption/Ionisation time of flight (MALDI-TOF) eller LC-MS/MS massespektrometri.
    Bemærk: Vi anbefaler for at bruge den kolloid Coomassie farvning som allerede beskrevet33. I vores hænder, endnu mindre rigelige proteiner kan være tilstrækkeligt farves og giver mulighed for en massespektrometrisk analyse med rimelig datakvalitet.

Representative Results

Her præsenterer vi en protokol, der giver mulighed for analyse af protein: protein og protein: RNA komplekser i phloem prøver fra Brassica napus. Arbejdsprocessen er illustreret i figur 1. En væsentlig fordel ved B. napus over andre modelorganismer er muligheden for relativt let phloem prøvetagning fra små punkteringer i Blomsterstanden stamceller. Dette giver mulighed for at få ren phloem prøver i forholdsvis store mængder. Når prøveudtagning phloem, er det altid tilrådeligt at kontrollere for forureninger, for eksempel af RT-PCR8. En repræsentativ resultatet fra en ren phloem prøve er afbildet i figur 2. Ikke-forurenet phloem prøver skal vise en synlig band for thioredoxin h, der henviser til, at intet signal for rubisco og pollen frakke protein skal vises. Rubisco lille underenhed kan tjene som et kontrolelement i prøver fra blade, blomsterstand stængler eller pollen. Thioredoxin h bør kunne påvises i alle prøver, da dens mRNA er blevet fundet i phloem af forskellige arter, mens pollen frakke protein udskrift bør kun være synlige i blomsterknop prøver. Forureninger kan forekomme når phloem prøveudtagning udføres på fuldt blomstrende planter (pollen frakke protein), eller når de første dråber fra phloem prøveudtagning punkteringer ikke bortskaffes korrekt (rubisco).

Før BN-side er det obligatorisk at koncentrere phloem sap. Ved hjælp af 20-30 µg af protein pr. brønd, mindst fire store protein komplekse bånd bliver synlige efter BN-side af B. napus phloem sap, for lave eller for høje koncentrationer tillader ikke en klar adskillelse af komplekser (figur 3). Det er anbefalet at indl├ªse flere gel bands der repræsenterer den samme kompleks i ét enkelt lomme af den anden-dimension gel til yderligere koncentrere proteiner fra hver enkelt kompleks for downstream behandling og efterfølgende massespektrometriske identifikation.

For at identificere de enkelte komponenter i phloem makromolekylære komplekser, vi kombineret den indledende BN-side med en anden dimension Tris-Tricine-urea og en tredje dimension SDS-PAGE for at opnå en adskillelse af enkelt proteiner. Her, kan en adskillelse med høj opløsning overholdes på grund af de forskellige protein migration adfærd i urea og SDS-PAGE geler. Typisk, proteiner tilhører en enkelt kompleks vil være synlig som en diagonal linje på tværs af gelen. Proteiner over denne linje har en øget hydrophobicity, mens proteiner under linjen repræsenterer mere hydrofile dem28 (figur 5, figur 6).

For karakterisering af RNP komplekser brugte vi en del af en BN-side gel til at udføre BN nordlige blotting. Efter blotting af en hel vognbane på en nylon membran og crosslinking af UV-stråling, kan at RNA visualiseres ved hjælp af RNA-specifikke sonder, som illustreret i figur 4. Her er det vist at en specifik tRNA findes kun i én bestemt kompleks. Proteinkomponenter af denne tRNA-bindende kompleks kan undersøges yderligere ved hjælp af 3D gel metode beskrevet ovenfor. Massespektrometrisk analyser viste, at dette kompleks indeholder hovedsageligt tRNA-ligases hvad bekræfter tRNA bindende aktivitet fundet af BN nordlige blotting.

Figure 1
Figur 1: arbejde flow af analysen af ribonucleoprotein komplekser i phloem sap af raps. Efter prøveudtagningen og forberedelsen af phloem prøver udføres BN-side for at adskille indfødte komplekser. Sådanne BN-side geler tillade den parallelle analyse af nukleinsyrer ved BN nordlige blotting og identifikation af proteinkomponenter af komplekser af massespektrometri. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: prøvetagning og renhed kontrol af phloem sap af B. napus. Efter punktering blomsterstand stilken af 8-10 uge gamle oliefrø voldtægt planter med en steril kanyle, er ekssudat indsamlet med en pipette og overført til en iskold reaktion tube (a) at bekræfte renheden af phloem prøver RT-PCR er udført, forstærke udskrifter af thioredoxin h, rubisco lille underenhed og pollen frakke protein i væv-specifikke prøver (b) RT-PCR uden reverse transkriptase blev udført som kontrol (-). Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3: BN-side. Skematisk fremstilling af blå indfødte side med koncentreret phloem prøver af B. napus. (a) efter lastning gradient protein gel med 15-20 µL af koncentreret phloem sap, er BN-side udført med 1 x mørk blå katode buffer B på 150 V for 20-30 min i et koldt rum. Derefter bufferen udveksles mod 1 x lys blå katode buffer B/10 og siden er færdige på 150 V for 120-180 min. indtil den mørke blå kører front løber ud af gelen. BN-side geler viser fire forskellige bands der repræsenterer fire forskellige høj molekylvægt komplekser. (b) indlæsning af for lidt (c) eller for meget (d) phloem proteiner reducerer synligheden af enkelte komplekser. Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4: BN nordlige blotting. Skematisk fremstilling af BN nordlige blotting metode. a en vognbane af BN-siden er overføres til en nylon membran af halvtør blotting. Efter UV-crosslinking og pre hybridisering, er membranen inkuberes med RNA specifikke sonder (her en methionin tRNA-specifikke sonde), som er biotinylated i 3'-slutningen i en hybridisering ovnen natten over. Gratis sonder er fjernet ved at vaske trin og påvisning af RNA er udført af en streptavidin-HRP konjugat og luminol. Brug denne fremgangsmåde, vi observerede, komplekse IV fra BN-siden indeholder methionin tRNA. b Coomassie farvede gel og tRNA skamplet ligne to forskellige gel baner sideløbende at undgå migration forskelle. Venligst klik her for at se en større version af dette tal.

Figure 5
Figur 5: 3D-SIDERS. Skematisk fremstilling af 3D-SIDERS tilgang. Flere bands fra samme kompleks er skåret ud fra en BN-side gel, inkuberes i loading bufferen og overført til et godt af den anden dimension Tris-Tricine-urea-side. Efter elektroforese, er hele gel baner skåret ud, vasket i sure syre buffer, ekvilibreres og placeret på en 15% SDS-PAGE gel. Efter den tredje dimension side er de adskilte proteiner Coomassie farvede og analyseret af massespektrometri. Venligst klik her for at se en større version af dette tal.

Figure 6
Figur 6: repræsentant resultater efter 3D-SIDERS. Inden for den første dimension BN-side dukkede flere komplekser. Deres proteinkomponenter kunne yderligere adskilt af to efterfølgende denaturering sider, hvilket resulterer i en diagonal spot mønster. Venligst klik her for at se en større version af dette tal.

Sonden Sekvens
Thioredoxin h
frem: CTCAAGGCAGCCAAAGAATC
omvendt: ATGGCCTGAACATCGAACTC
RuBisCO lille kæde
frem: TTCACCGGCTTGAAGTCATC
omvendt: CCGGGTACTCCTTCTTGCAT
Pollen frakke protein BRU77666
frem: TCAGAACTGGAGCTTCAACG
omvendt: TTCCTTAATGGCCTCAGTGG

Tabel 1: primere anvendes til phloem prøve renhed kontrol. For at bekræfte phloem prøve renhed kan primere specifikke for rubisco lille kæde, thioredoxin h og pollen frakke protein bruges til cDNA forstærkning.

Buffere og løsninger Indhold Kommentar
mørk blå katode buffer B 15 mM Bis-Tris pH 7,0
50 mM Tricine
0,02% (w/v) Coomassie blå G250
opskriften er tilpasset fra Fiala et al. 17
pH skal justeres til 7,0
Bufferen kan laves som en 10 x bestand
lys blå katode buffer B/10 15 mM Bis-Tris pH 7,0
50 mM Tricine
0,002% (w/v) Coomassie blå G250
Bufferen kan tilberedes ved fortynding katode buffer B med katode buffer uden Coomassie
anode buffer
50 mM Bis-Tris pH 7,0
Bufferen kan udarbejdes som en 10 x stamopløsning
2 x SDS prøvebuffer
125 mM Tris-HCl pH 6,8
4% SDS
20% glycerol
0,2 M DTT
0,02% (w/v) bromophenol blå
Overføre buffer 1 x TBE buffer
89 mM Tris pH 7,6
89 mM borsyre
2 mM EDTA
TBE buffer kan foretaget og gemt som lagre af 5 x eller 10 x. Det er vigtigt at bruge RNase-fri deioniseret vand.
2 x SSC buffer
300 mM NaCl
30 mM Na3citrat pH 7,0
3 x gel buffer
3 M Tris
1 M HCl
0,3% SDS

pH 8.45
opskrift fra Schägger 19
Tris-Tricine gel løsning A
Til 10 mL:
30% acrylamid-bisacrylamide (29: 1) 3.34 mL
6 M urinstof
3 x gel buffer 3.34 mL
70% glycerol 1,4 mL
tilføje ddH2O til 10 mL
10% APS 40 ΜL
TEMED 4 ΜL
Vægt 6 M urinstof og tilføje 3 x gel buffer, acrylamid-bisacrylamide løsning og 70% gycerol. Opvarmes til 60 ° C i et vandbad til solubilize urinstof. Tilføje ddH2O til 10 mL, 10% APS og endelig TEMED for polymerisering.
Tris-Tricine gelopløsning B
For 6 mL:
30% acrylamid-bisacrylamide (29: 1) 0,8 mL
6 M urinstof
3 x gel buffer 1,5 mL
tilføje ddH2O til 6 mL
10% APS 45 ΜL
TEMED 4.5 ΜL
Vægt 6 M urinstof og tilføje 3 x gel buffer og acrylamid-bisacrylamide løsning. Opvarmes til 60 ° C i et vandbad til solubilize urinstof. Tilføje ddH2O til 10 mL, 10% APS og endelig TEMED for polymerisering.
1 x Tris-Tricine kører buffer (anode)
100 mM Tris
22,5 mM HCl

pH 8,9
opskrift fra Schägger 19
1 x Tris-Tricine kører buffer (katoden)
100 mM Tris
100 mM Tricine
1% SDS


pH 8.25
opskrift fra Schägger 19
Sure buffer
100 mM Tris
100 mM eddikesyre
4% SDS stabling gel
Til 2 mL:
Hedeselskabet2O 1,4 mL
30% acrylamid-bisacrylamide (37.5:1) 0,33 mL
1 M Tris pH 6,8 0,25 mL
10% SDS 20 ΜL
10% APS 20 ΜL
TEMED 2 ΜL
15% SDS adskille gel
Til 10 mL:
Hedeselskabet2O 2.3 mL
30% acrylamid-bisacrylamide (37.5:1) 5 mL
1.5 M Tris pH 8,8 2,5 mL
10% SDS 100 ΜL
10% APS 100 ΜL
TEMED 4 ΜL
1 x SDS kører buffer
25 mM Tris
192 mM glycin
0,1% SDS
Coomassie farvning løsning
5% (w/v) aluminium-sulfat-(14-18)-hydrat
10% (v/v) ethanol (96%)
2% (v/v) orthophosphorsyre (85%)
0,02% (w/v) Coomassie strålende blå G-250
 
ULTRAhyb Ultrasensitive hybridisering Buffer Ambion, Life Technologies

Tabel 2: løsninger og buffer opskrifter. Liste over alle buffere og løsninger nødvendige for 3D-SIDERS analyse.

Spot nr. MW NB. [kDa] Identifikation Organisme Tiltrædelse nr. MW [kDa] MASCOT score
CIV_1 130 Formodede sygdom modstand protein At4g19050 B. napus CDX78917 131.1 110
CIV_2 130 Formodede sygdom modstand protein At4g19050 B. napus CDX78917 131.1 89
CIV_3 100 Heat shock 70 kDa protein 14-lignende B. napus XP_013748865 89,9 113
CIV_4 90 Eukaryote strækningsfaktor 2
Celledeling styre protein 48 homolog A
B. napus
B. napus
CDX90241
CDY41316.1
89,5
89,5
111
197
CIV_5 85 Heat shock protein 90-2-lignende B. rapa XP_009132342 79,8 172
CIV_6 80 Threonin--tRNA ligase
Glycin - tRNA ligase
B. oleracea
B. napus
XP_013599115
CDY43195
81,5
80,8
110
88
CIV_7 70 Heat shock protein 70 kDa
Lysin - tRNA ligase-lignende
B. oleracea
B. napus
XP_013685267
XP_013747530
67,8
69,9
230
150
CIV_8 65 Myrosinase
Aspartat--tRNA ligase 2
Asparagin--tRNA ligase 1
B. napus
B. napus
B. napus
ABQ42337
XP_013670803
XP_013729126
60,6
61,6
63,5
183
141
153
CIV_9 60 Myrosinase B. napus ABQ42337 60,6 164
CIV_10 55 Adenosylhomocysteinase 2-lignende B. rapa XP_009135865 53,1 139
CIV_11 55 Brudforlængelse faktor 1-Alfa 1-lignende B. oleracea XP_013586115 51,9 161
CIV_12 50 Cystin lyase CORI3-lignende B. napus XP_013653143 48.1 237
CIV_13 44 Cystin lyase CORI3-lignende B. rapa XP_009108611 48.3 213
CIV_14 38 Fruktose-bisfosfat aldolase B. rapa XP_009115993 38,4 226
CIV_15 45 Cystin lyase CORI3-lignende B. rapa XP_009108611 48.3 219
CIV_16 45 Cystin lyase CORI3 B. rapa CDY69765 46,9 209
CIV_17 38 Fruktose-bisfosfat aldolase B. rapa XP_009115993 38,4 124
CIV_18 18 Peptidyl-prolyl cis-trans isomerase CYP18-3-lignende B. napus XP_009101932 18.3 128
CIV_19 45 Cystin lyase CORI3-lignende B. rapa XP_009108611 48.3 177

Tabel 3: identificeret proteinkomponenter fra komplekse IV. Flere tRNA ligases og yderligere proteiner er blevet fundet inden for tRNA bindende kompleks ved hjælp af MALDI-TOF masse spektrometrisk analyse efter 3D-side.

Discussion

Phloem er et rum af stor interesse, eftersom det udgør den store transportrute for photoassimilates, og er også afgørende for langdistance signalering mellem forskellige plante dele9,20,34, 35. Ud over små molekyler, har makromolekyler såsom proteiner og RNA'er været impliceret med phloem vedligeholdelse og signalering4,7,8. Analyse af phloem sammensætning er begrænset af begrænset tilgængelighed til phloem prøver i de fleste plantearter. Insekt stylet teknik er almindeligt gældende, men eksperimentelt krævende og resulterer i meget små mængder af phloem prøver11. En nem teknik, der anvendes til phloem prøveudtagning er EDTA-faciliteret udsondring12. EDTA chelaterer divalent ioner som Calcium og dermed forhindrer lukning af sien plader af P-proteiner og callose. Det er let at bruge, men er udsat for forurening af beskadigede celler og prøverne fortyndes. Nedbryder divalent ioner af EDTA kan også føre til en opdeling af eksisterende komplekser. Det giver imidlertid mulighed for prøvetagning fra en bred vifte af arter, herunder model plante A. thaliana15. Spontan udsondring af phloem sap kun opstår i et lille antal plantearter. Det er en invasiv metode, der involverer betydelig skade plante væv10. Vi har for nylig etableret B. napus som en model art for at studere fjerntransport4,8,20. Her, kan phloem sap udtages fra små indsnit, hvilket reducerer såret effekter og kilder til forurening.

Bruger forskellige stikprøver, proteomet phloem prøver fra forskellige plantearter er blevet undersøgt i de seneste år7,8,17,36,37, 38,39. For undersøgelserne proteomet proteiner blev udvundet og udfældet under denatureringen betingelser og derfor ikke tillader konklusioner om protein: protein og protein: nukleinsyre interaktioner præsentere indfødte betingelser. Co-immunoprecipitation (CoIP) og overlay assays er angivet, et stort ribonucleoprotein kompleks kan findes i phloem sap fra græskar40, men det blev ikke påvist, at enhver makromolekylære komplekser eksisterer indfødte betingelser inden for de Phloem system.

Blå indfødte side, indført af Schägger et al. 26, i kombination med efterfølgende høj opløsning gel elektroforese trin aktiverer adskillelse af de enkelte komponenter i store proteinkomplekser. Ved hjælp af 3D-side analyser af indfødte B. napus phloem ekssudat, vi kunne for nylig viser, at flere høj molekylvægt protein: protein og RNP komplekser eksisterer i phloem prøver og er enzymatisk aktive4. Alternative metoder til at isolere proteinkomplekser samt RNPs som størrelse udstødelse kromatografi kan findes, men ikke i form af opløsning i forhold til mia-side. Desuden for en rimelig kvalitet af komplekse adskillelse skulle størrelse udstødelse kolonne matricer tilpasses efter de samlede komplekse Molekylær vægte undersøges. Analysere komplekser af forskellige størrelse vil derfor kræve forskellige typer af kolonner, der er omkostningseffektiv intensiv og tillader ikke som høj fokus magt som en BN-side.

Kritiske trin til at analysere komplekser fra B. napus omfatter det samlede beløb af phloem sap anvendes som materiale. Mindst 600 µL af phloem prøve er nødvendig og kan fås fra fem godt vandes planter. For 3D-side og BN nordlige blotting er det nødvendigt at starte den første mia gel med en tilstrækkelig mængde af phloem prøver. For at opnå dette, er phloem prøver koncentreret indtil 20-30 µg protein kan indlæses i hver godt og mindst tre af samme prøve køres parallelt. For lavt eller for højt koncentrationer reducere afsløring for komplekser (figur 3). Phloem prøver skal indsamles i reaktion rør på is og bør opbevares til senere brug til at undgå protein nedbrydning og omsætning i frossen stand. Proteasehæmmere er blevet fundet i alle phloem proteomes analyseret, men også en fuldt aktiv proteasom blev beskrevet i phloem B. napus4. Desuden, mængde og sammensætning af phloem prøver afhænger indsamlingspunkt tid og miljøforhold10. Derfor skal sikres at samle på det samme tidspunkt på dagen under lignende forhold. Stressbehandlinger (fx tørke) kan reducere mængden af phloem, som kan blive indsamlet. For at identificere enkelt proteiner ved massespektrometri, er det obligatorisk at begrænse mulige keratin forureninger af iført handsker hele tiden. Keratin fører til yderligere signaler under masse spec analyse og hæmmer protein identifikation. Kører BN-side til en højere spænding eller ved stuetemperatur kan føre til opvarmning af gel, som kan resultere i demontering af skrøbelige komplekser.

Protokollen præsenteres her er velegnet til analyse af protein: protein komplekser. Vi viser også, at det kan bruges til at registrere specifikke RNA'er indeholdt i komplekser parallelt. For at opnå dette, indført vi for nylig en protokol for BN nordlige blotting4. RNA'er er udsat for nedbrydning af RNAse forureninger. For at begrænse sådanne nedbrydning DEPC-behandlet, vand skal bruges.

Vigtigste begrænsninger af metoden præsenteres omfatter vurdering af proteinkomplekser adskilt af BN-side, da migration adfærd afhænger af størrelse, form og endda posttranslationelle modifikationer af komplekser31, molekylvægt 41. Størrelse estimering af RNP komplekser er endnu mere kompliceret på grund af påvirkning af nukleinsyrer migration adfærd. Det kan også ikke undgås at komplekser af samme størrelse Co vandrer i én enkelt band. Dette kan føre til fejlagtige forudsigelse af komplekse kompositioner. Derfor kontrollere observerede samspillet med supplerende teknikker, kan fx af funktionelle assays4, være nødvendig. Også kan proteiner kun svagt eller forbigående tilknyttet et makromolekylære kompleks gå tabt i den BN buffer, der bruges. For at undgå dette, prøver kunne være crosslinked, hvad kan også føre til artefakter eller kan forhindre protein identifikation, eller buffer betingelser kan optimeres.

I modsætning til klassisk 2D-side, kombinationen af urinstof - og SDS-PAGE giver mulighed for adskillelse efter hydrophobicity og Molekylær vægt i stedet for isoelektriske punkt (pI) og molekylvægt 28, og begrænser ikke adskillelse til proteiner af en specifikke pI rækkevidde. Svarer til klassisk 2D-PAGE, adskilt proteiner er synlig som indre steder, men på en diagonal linje 4,28 (figur 5, figur 6). Flere hydrofobe proteiner vises i steder over denne diagonal, mens mere hydrofile proteiner findes under linje28. Polyacrylamid koncentrationerne anvendes i denne protokol vil adskille proteiner mellem 25-80 kDa godt. For at tillade en adskillelse af mindre eller større proteiner polyacrylamid koncentration kan varieres eller gradient gel kan bruges i den tredje dimension. Komponenter af komplekse IV (figur 3) adskilt af 3D-side (figur 6) var skåret ud, trypsin fordøjes, og analyseret af massespektrometri. Dette resulterede i identifikation af flere tRNA ligases. Komponenterne i de andre komplekser er blevet offentliggjort for nylig 4. Vores 3D-side aktiveret adskillelse af forskellige ligases, nemlig aspartat, asparagin, threonin, lysin og glycin ligases, med lignende molekylære vægte (tabel 3). Bruger en methionin tRNA-specifikke sonde, vi var i stand til at opdage potentielt bundne tRNA inden for komplekse IV, men hvis fuld længde tRNA eller tRNA fragmenter er i komplekset kan ikke blive diskrimineret med sonder anvendes. For at kontrollere, hvis nukleinsyrer er virkelig bundet i komplekset og ikke Co migrerer, protease fordøjet phloem sap kan prøver tjene som passende migration kontrolelementer.

Det er blevet spekuleret tidligere, at protein oversættelse kan forekomme inden for phloem si rør, da næsten de fleste komponenter af hele ribosomet samt brudforlængelse faktorer er blevet fundet i phloem prøver4,7. Vores konklusion af tRNA og tRNA ligases synes at støtte denne idé. Men tRNA fragmenter findes i phloem prøver fra græskar har vist sig at være potente hæmmere af oversættelse42 og funktionelle ribosomer synes at være fraværende4, tyder på, at oversættelsen ikke kan finde sted.

Tilsammen, tillader protokollen præsenteres her magtens nativt protein: protein og endda RNP komplekser fra phloem prøver og adskillelse og identifikation af deres individuelle komponenter med høj opløsning. Anvendelsen af denne metode gør det muligt for opdagelsen af roman protein og RNP komplekser i phloem prøver og kan derfor belyse nye funktioner i denne højt specialiserede anlæg rum.

Disclosures

Forfatterne har ikke noget at oplyse.

Acknowledgments

Vi takker Jennifer Deke og Urszula Zarzenska for deres videnskabelig støtte. Dette arbejde blev støttet økonomisk af en karriere Integration Grant (CIG, PCIG14-GA-2013-63 0734) ved Europa-Kommissionen inden for programmet 7. rammer, grant LFF-GK06 'DELIGRAH' (Landesforschungsförderung Hamborg) og DFG grant (DFG KE 856_6-1) tildeles JK.

Materials

Name Company Catalog Number Comments
1.5 mL reaction tubes Eppendorf 30120086
10 well comb for SDS PAGE, thickness 1 mm BioRad 1653359
2-Propanol AppliChem 131090
30 % Acrylamide-bisacrylamide solution (29:1) solution BioRad 1610156
30 % Acrylamide-bisacrylamide solution (37.5:1) solution BioRad 1610158
96 % Ethanol Carl Roth P075
Acetic acid Carl Roth 6755
Agarose Lonza 50004
Aluminum sulfate-(14-18)-hydrate AppliChem 141101
Ammonium peroxodisulfate (APS) Carl Roth 9592.3
Bis-Tris AppliChem A3992
Boric acid AppliChem A2940
Bromophenol blue AppliChem A2331
Centrifugal concentrators e.g. Vivaspin 500 (Mwco 10 kDa) Sartorius VS0102
Chemiluminescent Nucleic Acid Detection Module Kit Thermo Fisher Scientific 89880
Chromatography papers e.g. 3 mm CHR Whatman 3030-153
CoolBox M30 System Biocision BCS-133
Coomassie brilliant Blue G-250 AppliChem A3480
Diethyl pyrocarbonate (DEPC) AppliChem A0881
Dithiothreitol (DTT) AppliChem A1101
DNase I AppliChem A3778
Ethanol abs. AppliChem A3693
Ethylenediaminetetraacetic acid (EDTA) AppliChem A1103
Gel Imaging system e.g. Chemidoc Touch BioRad 1708370
GeneRuler 1kb plus Thermo Fisher Scientific SM1331
Glycerol AppliChem 141339
Glycine AppliChem 131340
Heating block TS1 Biometra 846-051-500
Hybridization oven e.g. GFL Hybridization Incubator 7601 GFL 7601
Hypodermic needle (0.8 mm) B Braun 4658309
IPG gel comb, thickness 1 mm BioRad 1653367
Labeling of RNA e.g.Biotin 3'end DNA Labeling Kit Thermo Fisher Scientific 89818
Native gradient gel e.g. Novex NativePAGE 4–16% Bis-Tris protein gel Invitrogen BN1002BOX
Nylon membrane e.g. Hybond-N+ Amersham Pharmacia RPN203B
Ortho-phosphoric acid Carl Roth 6366.1
PageRuler prestained protein ladder Thermo Fisher Scientific 26616
Power supply for Gel electrophoresis EPS Amersham Pharmacia 18-1130-01 available from GE Healthcare
RNA Cleanup Kit Qiagen 74204
Semi dry blot e.g. Fastblot 43B semi dry Blot Biometra 846-015-100
Sodium chloride (NaCl) AppliChem A1149
Sodium dodecyl sulfate (SDS) AppliChem 142363
Synthesis of cDNA e.g. RevertAid First Strand cDNA Synthesis Kit Thermo Fisher Scientific K1621
Tetramethylethylenediamine (TEMED) AppliChem A1148
Tricine AppliChem A3954
Tris AppliChem A1086
Tri-sodium citrate dihydrate AppliChem A3901
TRIzol Reagent Thermo Fisher Scientific 15596026
ULTRAhyb Ultrasensitive Hybridization Buffer Thermo Fisher Scientific AM8670
Urea AppliChem A1360
UV Crosslinker e.g. Stratalinker 2400 Agilent NC0477671 from Fisher Scientific
Vertical electrophoresis apparatus e.g.The XCell SureLock Mini-Cell or Mini-Protean III System Thermo Fisher Scientific or BioRad EI0001 or 1658004
Wipers e.g. KIMWIPES Delicate Task Wipers Kimberly-Clark 34120

DOWNLOAD MATERIALS LIST

References

  1. Kempers, R., van Bel, A. J. E. Symplasmic connections between sieve element and companion cell in the stem phloem ofVicia faba L. have a molecular exclusion limit of at least 10 kDa. Planta. 201, (2), 195-201 (1997).
  2. Stadler, R., et al. Expression of GFP-fusions in Arabidopsis companion cells reveals non-specific protein trafficking into sieve elements and identifies a novel post-phloem domain in roots. Plant J. 41, (2), 319-331 (2005).
  3. Imlau, A., Truernit, E., Sauer, N. Cell-to-cell and long-distance trafficking of the green fluorescent protein in the phloem and symplastic unloading of the protein into sink tissues. Plant Cell. 11, (3), 309-322 (1999).
  4. Ostendorp, A., et al. Functional analysis of Brassica napus phloem protein and ribonucleoprotein complexes. New Phytol. 214, (3), 1188-1197 (2017).
  5. Paultre, D. S. G., Gustin, M. -P., Molnar, A., Oparka, K. J. Lost in Transit: Long-Distance Trafficking and Phloem Unloading of Protein Signals in Arabidopsis Homografts. Plant Cell. 28, (9), 2016-2025 (2016).
  6. Sali, A., Glaeser, R., Earnest, T., Baumeister, W. From words to literature in structural proteomics. Nature. 422, (6928), 216-225 (2003).
  7. Lin, M. -K., Lee, Y. -J., Lough, T. J., Phinney, B. S., Lucas, W. J. Analysis of the Pumpkin Phloem Proteome Provides Insights into Angiosperm Sieve Tube Function. Mol. Cell. Proteomics. 8, (2), 343-356 (2008).
  8. Giavalisco, P., Kapitza, K., Kolasa, A., Buhtz, A., Kehr, J. Towards the proteome of Brassica napus phloem sap. Proteomics. 6, (3), 896-909 (2006).
  9. Lucas, W. J., Yoo, B. C., Kragler, F. RNA as a long-distance information macromolecule in plants. Nat. Rev. Mol. Cell. Bio. 2, (11), 849-857 (2001).
  10. Dinant, S., Kehr, J. Sampling and Analysis of Phloem Sap. Plant Mineral Nutrients. 953, 185-194 (2013).
  11. Kennedy, J. S., Mittler, T. E. A Method of obtaining Phloem Sap via the Mouth-parts of Aphids. Nature. 171, (4351), 528 (1953).
  12. King, R. W., Zeevaart, J. A. Enhancement of Phloem exudation from cut petioles by chelating agents. Plant Physiol. 53, (1), 96-103 (1974).
  13. Alosi, M. C., Melroy, D. L., Park, R. B. The regulation of gelation of Phloem exudate from cucurbita fruit by dilution, glutathione, and glutathione reductase. Plant Physiol. 86, (4), 1089-1094 (1988).
  14. Dinant, S., Bonnemain, J. -L., Girousse, C., Kehr, J. Phloem sap intricacy and interplay with aphid feeding. Comptes rendus biologies. 333, (6-7), 504-515 (2010).
  15. Tetyuk, O., Benning, U. F., Hoffmann-Benning, S. Collection and analysis of Arabidopsis phloem exudates using the EDTA-facilitated Method. J Vis Exp. (80), e51111 (2013).
  16. Kovalskaya, N., Owens, R., Baker, C. J., Deahl, K., Hammond, R. W. Application of a modified EDTA-mediated exudation technique and guttation fluid analysis for Potato spindle tuber viroid RNA detection in tomato plants (Solanum lycopersicum). J. Virol. Methods. 198, 75-81 (2014).
  17. Rodriguez-Medina, C., Atkins, C. A., Mann, A. J., Jordan, M. E., Smith, P. M. Macromolecular composition of phloem exudate from white lupin (Lupinus albus L). BMC Plant Biol. 11, (1), 36 (2011).
  18. Taylor, J. S., Thompson, B., Pate, J. S., Atkins, C. A., Pharis, R. P. Cytokinins in the Phloem Sap of White Lupin (Lupinus albus L.). Plant Physiol. 94, (4), 1714-1720 (1990).
  19. Yoo, B., et al. A Systemic Small RNA Signaling System in Plants. Plant Cell. 16, (8), 1979-2000 (2004).
  20. Buhtz, A., Springer, F., Chappell, L., Baulcombe, D. C., Kehr, J. Identification and characterization of small RNAs from the phloem of Brassica napus. Plant J. 53, (5), 739-749 (2008).
  21. Chalhoub, B., et al. Plant genetics. Early allopolyploid evolution in the post-Neolithic Brassica napus oilseed genome. Science. 345, (6199), 950-953 (2014).
  22. Sasaki, T., Chino, M., Hayashi, H., Fujiwara, T. Detection of several mRNA species in rice phloem sap. Plant Cell Phys. 39, (8), 895-897 (1998).
  23. Doering-Saad, C., Newbury, H. J., Bale, J. S., Pritchard, J. Use of aphid stylectomy and RT-PCR for the detection of transporter mRNAs in sieve elements. J Exp. Bot. 53, (369), 631-637 (2002).
  24. Ruiz-Medrano, R., Xoconostle-Cázares, B., Lucas, W. J. Phloem long-distance transport of CmNACP mRNA: implications for supracellular regulation in plants. Dev. 126, (20), 4405-4419 (1999).
  25. Schägger, H., Cramer, W. A., von Jagow, G. Analysis of molecular masses and oligomeric states of protein complexes by blue native electrophoresis and isolation of membrane protein complexes by two-dimensional native electrophoresis. Anal. Biochem. 217, (2), 220-230 (1994).
  26. Schägger, H., von Jagow, G. Blue native electrophoresis for isolation of membrane protein complexes in enzymatically active form. Anal. Biochem. 199, (2), 223-231 (1991).
  27. Fiala, G. J., Schamel, W. W. A., Blumenthal, B. Blue native polyacrylamide gel electrophoresis (BN-PAGE) for analysis of multiprotein complexes from cellular lysates. J Vis Exp. (48), e2164 (2011).
  28. Rais, I., Karas, M., Schägger, H. Two-dimensional electrophoresis for the isolation of integral membrane proteins and mass spectrometric identification. Proteomics. 4, (9), 2567-2571 (2004).
  29. Schägger, H. Tricine-SDS-PAGE. Nature protocols. 1, (1), 16-22 (2006).
  30. Wittig, I., Braun, H. -P., Schägger, H. Blue native PAGE. Nat Protoc. 1, (1), 418-428 (2006).
  31. Eubel, H., Braun, H. -P., Millar, A. H. Blue-native PAGE in plants: a tool in analysis of protein-protein interactions. Plant Methods. 1, (1), 11 (2005).
  32. Laemmli, U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227, (5259), 680-685 (1970).
  33. Dyballa, N., Metzger, S. Fast and sensitive colloidal coomassie G-250 staining for proteins in polyacrylamide gels. J Vis Exp. (30), (2009).
  34. Turnbull, C. G. N., Lopez-Cobollo, R. M. Heavy traffic in the fast lane: long-distance signalling by macromolecules. New Phytol. 198, (1), 33-51 (2013).
  35. Hall, S. M., Baker, D. A. The chemical composition of Ricinus phloem exudate. Planta. 106, (2), 131-140 (1972).
  36. Barnes, A., Bale, J., Constantinidou, C., Ashton, P., Jones, A., Pritchard, J. Determining protein identity from sieve element sap in Ricinus communis L. by quadrupole time of flight (Q-TOF) mass spectrometry. J. Exp. Bot. 55, (402), 1473-1481 (2004).
  37. Walz, C., Giavalisco, P., Schad, M., Juenger, M., Klose, J., Kehr, J. Proteomics of curcurbit phloem exudate reveals a network of defence proteins. Phytochemistry. 65, (12), 1795-1804 (2004).
  38. Walz, C., Juenger, M., Schad, M., Kehr, J. Evidence for the presence and activity of a complete antioxidant defence system in mature sieve tubes. Plant J. 31, (2), 189-197 (2002).
  39. Kehr, J. Phloem sap proteins: their identities and potential roles in the interaction between plants and phloem-feeding insects. J Exp. Bot. 57, (4), 767-774 (2006).
  40. Ham, B. -K., Brandom, J. L., Xoconostle-Cázares, B., Ringgold, V., Lough, T. J., Lucas, W. J. A polypyrimidine tract binding protein, pumpkin RBP50, forms the basis of a phloem-mobile ribonucleoprotein complex. Plant Cell. 21, (1), 197-215 (2009).
  41. Schamel, W. W. Biotinylation of protein complexes may lead to aggregation as well as to loss of subunits as revealed by Blue Native PAGE. J. Immunol. Methods. 252, (1-2), 171-174 (2001).
  42. Zhang, S., Sun, L., Kragler, F. The phloem-delivered RNA pool contains small noncoding RNAs and interferes with translation. Plant Physiol. 150, (1), 378-387 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics