Generación de 3D piel organoide de cable derivadas de sangre inducida por las células de vástago Pluripotent

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Proponemos un protocolo que muestra cómo distinguir keratinocytes derivados de células madre pluripotentes inducidas y fibroblastos y generar un organoide de piel 3D, usando estos queratinocitos y fibroblastos. Este protocolo contiene un paso adicional de generar un modelo de ratones humanizados. La técnica presentada aquí mejorará la investigación dermatológica.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Kim, Y., Ju, J. H. Generation of 3D Skin Organoid from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (146), e59297, doi:10.3791/59297 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La piel es el órgano más grande del cuerpo y tiene muchas funciones. La piel actúa como barrera física y protector del cuerpo y regula las funciones corporales. Biomimética es la imitación de los modelos, sistemas y elementos de la naturaleza con el fin de resolver problemas humanos complejos1. Biomimética de la piel es una herramienta útil para la medicina regenerativa in vivo y in vitro investigación. Las células madre humanas pluripotentes inducidas (iPSCs) tienen la característica de la proliferación ilimitada y la capacidad de diferenciación de tres capas germinales. IPSCs humanos se generan de varias células primarias, como las células sanguíneas, queratinocitos, fibroblastos y más. Entre ellos, células mononucleares de sangre de cordón (CBMCs) han emergido como una fuente alternativa de la célula desde la perspectiva de la medicina regenerativa allogeneic. CBMCs son útiles en medicina regenerativa porque leucocito humano antígeno (HLA) escribir es esencial para la célula del sistema bancario. Nos proporcionan un método para la diferenciación de CBMC-iPSCs en queratinocitos y los fibroblastos y para la generación de un organoide de piel 3D. Fibroblastos y queratinocitos derivados de iPSC CBMC tienen características similares a una línea celular primaria. Los organoides de la piel 3D se generan superponiendo una capa epidérmica en una capa dérmica. Mediante el trasplante de este organoide 3D de la piel, se genera un modelo de ratones humanizados. Este estudio demuestra que un organoide de piel derivado de iPSC humana 3D puede ser una herramienta novedosa, la alternativa para la investigación dermatológica in vitro e in vivo.

Introduction

La piel cubre la superficie exterior del cuerpo y protege órganos internos. La piel tiene varias funciones, incluyendo la protección contra patógenos, absorber y almacenar agua, regular la temperatura del cuerpo y excretar el cuerpo de residuos2. Injertos de piel se pueden clasificar dependiendo de la fuente de la piel; injertos con piel de otro donante se denominan aloinjertos e injertos utilizando la piel del propio paciente son autoinjertos. Aunque un autoinjerto es el tratamiento preferido debido a su riesgo de rechazo baja, biopsias de la piel son difíciles de realizar en pacientes con lesiones severas o un número insuficiente de células de la piel. En pacientes con quemaduras graves, tres veces el número de células de la piel es necesario para cubrir áreas grandes. La disponibilidad limitada de las células de la piel del cuerpo del paciente los resultados en situaciones donde es necesario allogenous trasplante. Un aloinjerto se utiliza temporalmente hasta que el trasplante autólogo puede realizarse ya que generalmente es rechazado por el sistema de inmune después de aproximadamente 1 semana3. Para superar el rechazo por el sistema inmune del paciente, injertos deben venir de una fuente con la misma identidad inmunológica del paciente4.

IPSCs humanas son una fuente emergente de células para la terapia de la célula de vástago5. IPSCs humanas se generan en las células somáticas, utilizando factores de reprogramación como OCT4, SOX2, Klf4 y c-Myc6. Utilizando iPSCs humana supera los problemas éticos e inmunológicos de las células madre embrionarias (ESCs)7,8. Humanos iPSCs con pluripotencia y puede diferenciarse en tres capas germinales9. La presencia de HLA, un factor crítico en medicina regenerativa, determina la respuesta inmune y la posibilidad de rechazo10. El uso de derivados del paciente iPSCs resuelve los problemas de rechazo de la limitación y el sistema inmune celular-fuente. CBMCs también han surgido como una fuente alternativa de la célula para medicina regenerativa11. Obligatorio HLA mecanografía, que ocurre durante la banca CBMC, se puede utilizar fácilmente para la investigación y trasplante. Además, homocigótica tipo HLA iPSCs puede aplicar ampliamente a varios pacientes12. Un banco de CBMC-iPSC es un novedoso y eficaz estrategia para terapia celular y medicina regenerativa alógeno12,13,14. En este estudio, utilizamos CBMC-iPSCs, diferenciado en queratinocitos y fibroblastos y generar capas 3D estratificado de la piel. Los resultados de este estudio sugieren que un organoide 3D CBMC-iPSC-derivados de la piel es una novedosa herramienta para la investigación dermatológica in vitro e in vivo.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Todos los procedimientos que involucran animales fueron realizados conforme a la ley de bienestar de animales de laboratorio, la guía para el cuidado y uso de animales de laboratorio, y las directrices y políticas para la experimentación de roedor proporcionan por el cuidado institucional de Animal y Uso (IACUC) Comité de la escuela de medicina de la Universidad Católica de Corea. El protocolo de estudio fue aprobado por la Junta de revisión institucional de la Universidad Católica de Corea (CUMC-2018-0191-01). La IACUC y el Departamento de animales laboratorio (DOLA) de la Universidad Católica de Corea, Songeui Campus acreditado la instalación de laboratorio de Corea excelencia Animal de la Korea Food and Drug Administration en 2017 y adquirida la Asociación para la evaluación y Acreditación de la acreditación internacional de completo internacional de cuidado de animales de laboratorio (AAALAC), en el 2018.

1. diferenciación celular de células madre pluripotentes inducidas de la piel

  1. Preparación de medio
    Nota: Guarde todo medio a 4 ° C en un ambiente oscuro durante 3 meses. Todos medio utilizando un sistema de filtro de 0.22 μm polyethersulfone antes de su uso para la esterilización del filtro. Medio de todos estaba disponible en un volumen total de 500 mL.
    1. Preparar KDM1 (medio de la diferenciación del keratinocyte 1). Medium (DMEM modificado Eagle de mezcla Dulbecco) / medio de F12 (3:1) con 2% de suero bovino fetal (FBS), 0,3 mmol/L de ácido L-ascórbico, 5 μg/mL insulina y 24 adenina μg/mL.
    2. Preparar KDM2 (medio de la diferenciación del keratinocyte 2). Mezcla define keratinocyte medio libre de suero (véase la Tabla de materiales) con 0,3 mmol/l de ácido L-ascórbico, 5 de μg/mL insulina y adenina 10 μg/mL.
      Nota: Medio de keratinocyte definido libre de suero está optimizado para apoyar el crecimiento y la expansión de queratinocitos.
    3. Preparar KDM3 (medio de la diferenciación del keratinocyte 3). Mezcla define keratinocyte medio sin suero y queratinocitos medio sin suero (1:1) vea la Tabla de materiales para más detalles.
      Nota: Medio libre de suero de queratinocitos está optimizado para el crecimiento y mantenimiento de los queratinocitos.
    4. Preparar FDM1 (medio de diferenciación de fibroblastos 1). Medio DMEM/F12 Mix (3:1) con 5% FBS, 5 μg/mL insulina, adenina de 0.18 m m y 10 ng/mL factor de crecimiento epidérmico (EGF).
    5. Preparar FDM2 (medio de diferenciación de fibroblastos 2). Medio DMEM/F12 de mezcla (1:1) con 5% FBS y 1% aminoácidos no esenciales.
    6. Preparar EP1 (epitelial medio 1). Mezcla de DMEM/F12 (3:1) con 4 mM L-glutamina, adenina μM 40, transferrina μg/mL, insulina de 10 μg/mL y 10 0,1% FBS.
    7. Preparar EP2 (epitelial medio 2). Mezclar el EP1 y 1,8 mM cloruro de calcio.
    8. Preparar EP3 (medio epitelial 3, medio cornification). Medio de F12 de mezcla con 4 mM L-glutamina, adenina μM 40 10 transferrina μg/mL, insulina de 10 μg/mL, 2% FBS y 1,8 mM cloruro de calcio.
  2. Generación del cuerpo embrionario
    1. Generar CBMC-iPSCs usando el protocolo mostrado en un anterior estudio12.
    2. Platos de cultura de la capa, usando vitronectina. Prepare 5 mL a un plato de 100 mm de la capa.
      1. Descongelar y resuspender en 50 μL de vitronectina de 0.5 mg/mL (concentración final: 5 μg/mL) con 5 mL de solución salina estéril tamponada con fosfato (PBS). Añadir la solución a los platos e incubar a temperatura ambiente (RT) durante 1 h. aspirar el material de recubrimiento antes de su uso (no seca).
    3. Mantener las iPSCs CBMC-deriva a la vitronectina cubrió 100 mm plato y cambiar el medio de iPSC (E8) todos los días a 37 ° C con 10% CO2.
    4. Generar cuerpos embrionarios (EBs) utilizando el protocolo mostrado en un anterior estudio15 (descritas brevemente a continuación). Ampliar iPSCs cambiando el medio hasta que las células hayan alcanzado el 80% de confluencia. En el 80% de confluencia, quitarlo del medio y lavar con PBS.
    5. Tratar las células con 1 mL de ácido de 1 mM etilendiaminotetracético (EDTA). Incubar a 37 ° C con 5% CO2 durante 2 min y cosechar las células usando 3 mL de medio de E8. Centrifugar las células a 250 x g durante 2 minutos.
    6. Aspirar el sobrenadante y aplicar 5 mL de medio de E8 a las células. Contar las células usando un hemocitómetro y 1 x 106 células de transferencia a un nuevo tubo cónico de 15 mL. Centrifugar las células a 250 x g durante 2 minutos.
    7. Resuspender las células transferidas con 2,5 mL de medio de formación de EB con inhibidor de la Rho-associated kinase (roca) de 10 μM. 1 x 104 células (25 μl/gota) en la tapa de la placa de cultura noncoated usando una pipeta multicanal de 10 – 100 μL de la gota. Formulario 100 EBs de las células 1 x 106 (1 x 104 células/1 EB). Voltee el plato y colgar en la gota a la tapa.
      Nota: Inhibidor de la roca es necesaria durante la etapa de fijación en el proceso de mantenimiento y diferenciación. Añadir el inhibidor de la roca en la fase de agregación de EB.
    8. Incubar las gotitas a 37 ° C con 5% CO2 para 1 día.
    9. Al día siguiente, la cosecha del 100 EBs y utilizarlos para la diferenciación. Lave la tapa de la placa con medio de iPSC (mediana de E8) o PBS y cosecha su contenido a un tubo cónico de 50 mL. Mantener el EBs en RT para 1 minuto para colocar abajo. Aspirar el sobrenadante, Resuspender el EBs con medio E8 y mantenerlas en una caja de Petri de 90 mm hasta la diferenciación.
  3. Diferenciación de CBMC-iPSCs en queratinocitos
    Nota: Para un esquema de la diferenciación del keratinocyte de CBMC-iPSCs, ver figura 1A.
    1. EBs de cosecha el 100 a un tubo cónico de 50 mL con medio de iPSC o PBS. Mantener a temperatura ambiente durante 1 minuto a la EBs. Asegúrese de que se instalan en la parte inferior del tubo cónico. Aspirar el sobrenadante y resuspender el EBs con medio E8 con 1 ng/mL la proteína morfógena ósea 4 (BMP4). Transferencia de la EBs a un plato de Petri de 90 mm y mantener a 37 ° C con 5% CO2 para 1 día.
    2. Capa de platos de la cultura, con colágeno tipo IV. Preparar 5 mL de tipo colágeno de IV a un plato de 100 mm de la capa.
      1. Descongelar y volver a suspender el tipo solución de colágeno IV (concentración final: 50 μg/mL) con 0,05 N HCl. Añadir la solución a los platos e incube a temperatura ambiente durante 1 h. aspirar el material de recubrimiento antes de su uso (no seca).
        Nota: Antes de usar las planchas, lavar los platos de 3 x con PBS para eliminar cualquier ácido.
    3. El EBs (paso 1.3.1) a un tubo cónico de 50 mL de la cosecha y mantener a temperatura ambiente durante 1 minuto para colocar abajo. Asegúrese de colocar en la parte inferior del tubo cónico, aspirar el sobrenadante y resuspender el EBs en 6 mL de KDM1 con inhibidor de roca de 10 μm. Transferencia de la EBs al plato tipo IV colágeno cubierto de 100 mm.
      Nota: Añadir el inhibidor de la roca sólo en la etapa de fijación de EB.
    4. Entre los días 0 y 8, cambiar el medio día a KDM1 con retinoico de 3 μm (RA) y 25 ng/mL de cada una de BMP4 y EGF. Mantener el EBs a 37 ° C con 5% CO2.
    5. Entre los días 9 – 12, cambiar el medio día a KDM2 con 3 μm RA, 25 ng/mL BMP4 y EGF de 20 ng/mL.
    6. Entre los días 13 y 30, cambiar el medio día a KDM3 con 10 ng/mL BMP4 y EGF de 20 ng/mL.
  4. Diferenciación de CBMC-iPSC en fibroblastos
    Nota: Para un esquema de la diferenciación de fibroblastos de CBMC-iPSCs, ver figura 2A.
    1. Platos de la cultura, utilizando la matriz de la membrana basal de la capa. Prepare 5 mL a un plato de 100 mm de la capa.
      1. Descongele la matriz de la membrana del sótano (concentración final: 600 ng/mL) y diluir con medio DMEM/F12. Añadir la solución a los platos e incubar a 37 ° C por 30 min aspirar el material de recubrimiento antes de su uso (no seca).
    2. EBs de cosecha el 100 a un tubo cónico de 50 mL con una pipeta con medio de iPSC o PBS. Mantener a temperatura ambiente durante 1 minuto a la EBs. Asegúrese de que se instalan en la parte inferior del tubo cónico. Eliminar el sobrenadante.
    3. Resuspender el EBs utilizando una pipeta μL 1.000 en 6 mL de FDM1 con el inhibidor de roca de 10 μm. Transferir el EBs (con medio) a un plato de matriz recubierta 100 mm membrana del sótano e incubar a 37 ° C con 5% CO2. Actualizar el FDM1 diariamente por 3 días.
      Nota: Sólo añadir el inhibidor de la roca en la etapa de fijación de EB.
    4. Añadir 0,5 nM la proteína morfógena ósea 4 (BMP 4) a la FDM1 entre los días 4 y 6.
    5. En el día 7, cambiar el medio para FDM2 cada tercer día durante 1 semana.
    6. En el día 14, añadir 1 mL de 1 mM EDTA e incubar a 37 ° C con 5% CO2 para 2 minutos cosechar las células con 3 mL de FDM2 y centrifugue a 250 x g por 2 minutos quite el sobrenadante y resuspender las células en 5 mL de FDM1.
    7. Contar las células usando un hemocitómetro, suspender 2 x 106 células con medio de FDM1 y transferir las células al noncoated plato. Mantener las células a 37 ° C con 5% CO2 y cambiar el medio cada día.
    8. Platos de cultura de capa, con colágeno tipo I. Prepare 5 mL a un plato de 100 mm de la capa. Diluir la solución de colágeno de tipo I (concentración final: 50 μg/mL) en 0.02 N de ácido acético. Añadir la solución a los platos e incube a temperatura ambiente durante 1 h. aspirar el material de recubrimiento antes de su uso (no seca).
      Nota: Antes de usar las planchas, lavar los platos de 3 x con PBS para eliminar el ácido.
    9. El día 21, añadir 1 mL de 1 mM EDTA e incubar a 37 ° C con 5% CO2 para 2 minutos cosechar las células con 3 mL de FDM1 y centrifugue a 250 x g por 2 minutos quite el sobrenadante y resuspender las células en 5 mL de FDM1. Recuento de las células usando un hemocitómetro y transferencia 2 x 106 células al tipo plato cubierto de colágeno 100 mm con medio FDM1. Mantener las células a 37 ° C con 5% CO2 y cambiar el medio cada día.
    10. En el día 28, añadir 1 mL de 1 mM EDTA e incubar a 37 ° C con 5% CO2 para 2 minutos cosechar las células con 3 mL de FDM1 y centrifugue a 250 x g por 2 minutos quite el sobrenadante y resuspender las células en 5 mL de FDM1. Contar las células usando un hemocitómetro y 2 x 106 células de transferencia a un plato de noncoated con FDM1 medio. Mantener las células a 37 ° C con 5% CO2 y cambiar el medio día.
      Nota: proliferan los fibroblastos derivados de iPSC como una línea de células de fibroblastos primarios y paso hasta 10 pasajes. En este estudio, utilizamos fibroblastos derivados de iPSC de dos a cinco pasos para su posterior análisis.

2. uso de células diferenciadas derivadas de hiPSC

  1. Generación de 3D piel organoide
    1. Preparar neutralizado tipo I colágeno en el hielo, siguiendo las recomendaciones del fabricante. Como concentración final, uso de 3 mg/mL de colágeno de tipo I (concentración stock de tipo I colágeno es 3,47 mg/mL) y asegúrese de que el volumen final de la mezcla es de 5 mL. Calcular el volumen de PBS x 10 (volumen final/10 = 0.5 mL). Calcular el volumen de colágeno para ser utilizado tipo I (volumen final x concentración final colágeno / concentración de colágeno madre = 5 mL x 3 mg / mL / 3,47 mg / mL = 4,32 mL). Calcular el volumen de 1 N NaOH (volumen de colágeno para utilizar x 0,023 mL = 0,1 mL). Calcular el volumen de dH2O (volumen final - volumen de colágeno - volumen de PBS 10 x - volumen de 1 N NaOH = 5 mL - 4,32 mL-0.5 mL 0.1 mL = 0,08 mL). Mezclar el contenido del tubo y mantenerlo en hielo hasta que esté listo para usar.
    2. Añadir 1 mL de EDTA a los fibroblastos derivados de iPSC de paso 1.4.10 e incubar a 37 ° C con 5% CO2 para 2 minutos las células separadas de la cosecha, contar las células usando un hemocitómetro y 2 x 105 células de transferencia a un nuevo tubo cónico de 15 mL. Centrifugue a 250 x g durante 2 minutos y eliminar el sobrenadante. Resuspender las células de los fibroblastos derivados de iPSC en 1,5 mL de FDM1 y neutralizado el tipo solución de colágeno (1:1).
      Nota: Mezcle la solución suavemente para evitar burbujas.
    3. Coloque la membrana sobre un pozo de 6 microplacas, transferir la mezcla a la inserción e incube a TA por 30 min.
      Nota: No mueva las placas.
    4. Después de confirmar la gelificación, agregar 2 mL del medio a la parte superior de la inserción y 3 mL en el fondo del pozo. Incubar la matriz de fibroblastos y colágeno a 37 ° C con 5% CO2 para 5-7 días, hasta que la gelificación se complete y no contratos.
    5. Después de la gelificación completa, separar los queratinocitos derivados de iPSC (del paso 1.3.6) utilizando EDTA. Añadir 1 mL de EDTA e incubar a 37 ° C con 5% CO2 para 2 minutos las células separadas, contarlos usando un hemocitómetro y cosecha 1 x 106 células de transferencia a un nuevo tubo cónico de 15 mL. Centrifugar a 250 x g durante 2 minutos.
    6. Quite el sobrenadante y resuspender 1 x 106 células en 50-100 μl de medio epitelial de bajo calcio 1 (EP1).
    7. Aspirar todo medio en la matriz (ver paso 2.1.5) y 1 x 106 células de los queratinocitos derivados de iPSC en cada capa de fibroblastos de la semilla. Incubar la placa a 37 ° C con 5% CO2 durante 30 minutos.
      Nota: No mueva la placa y no agregue ningún medio para la fijación del keratinocyte.
    8. Añadir 2 mL de EP1 a la parte superior de la pieza de inserción y 3 mL de EP1 hasta el fondo del pozo.
    9. Después de 2 días, aspirar todo medio en la placa de inserción de la membrana y cambiar el medio normal calcio EP2 por 2 días.
    10. Después de 2 días, Aspire todos mediano y agregar 3 mL del medio cornification sólo a la parte inferior para generar una interfaz de aire líquido.
    11. Mantener el organoide de piel 3D hasta 14 días a 37 ° C con 5% CO2 y cambiar el medio cada día. El organoide de piel 3D por el borde del inserto de corte y cosecha usar un estudio adicional de la coloración y el injerto de piel.
  2. Injerto de piel
    1. Realizar la anestesia de inhalación en ratones NOD/scid (hombres, 6 semanas de edad), usando un método estándar, institucionalmente aprobado. Para injerto de piel, afeitarse el pelo de la piel dorsal de cada ratón.
    2. Eliminar una sección de 1 cm x 2 cm de piel de ratón, usando tijeras curvas con fórceps.
    3. Lugar el organoide 3D CBMC-iPSC-derivados de la piel en el sitio de defecto y usando un método de preparación tie-over con suturas de seda de sutura.
    4. Observar los ratones durante 2 semanas y sacrificarlos para análisis histológico. El protocolo de tinción fue verificado en estudios previos16.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Piel se compone, en su mayor parte, de la epidermis y la dermis. Queratinocitos son el tipo principal de célula de la epidermis, y los fibroblastos son el tipo principal de célula de la dermis. En figura 1se muestra el esquema de la diferenciación del keratinocyte. CBMC-iPCSc se mantuvieron en un plato cubierto de vitronectina (figura 1B). En este estudio, hemos diferenciado CBMC-iPSCs en queratinocitos y fibroblastos con formación de EB. Hemos generado EBs con el colgante gota método para asegurar una uniforme y controlada de la diferenciación de queratinocitos y fibroblastos (figura 1C). EBs se adjuntaron al tipo placas recubiertas de colágeno de IV para la diferenciación del keratinocyte, y el medio fue cambiado cada día. CBMC-iPSCs fueron tratados con RA, BMP4 y EGF. CBMC-iPSCs fueron distinguidos a los keratinocytes. Durante la diferenciación, la morfología de los queratinocitos derivados de iPSC CBMC cambiado con el tiempo (figura 1 complementaria).

Derivados de iPSC CBMC queratinocitos tienen morfologías similares a queratinocitos primarios (figura 1D). La expresión de genes del marcador pluripotentes OCT4 fue regulada en keratinocytes CBMC-iPSC-derivados. Secuencias de la cartilla se muestran en la tabla 1. La expresión de marcadores de queratinocitos Np63, KRT5 y KRT14 fue aumentada de queratinocitos derivados de iPSC CBMC (figura 1F). Derivados de iPSC CBMC keratinocytes fueron confirmados por la expresión de Np63 y KRT14 por inmunohistoquímica (figura 1E). Estos resultados confirmaron que queratinocitos CBMC-iPSC-derivados tienen las características de los queratinocitos primarios.

En la figura 2Ase muestra el esquema de la diferenciación de fibroblastos. También mantiene CBMC-iPSCs en un plato cubierto de vitronectina y utilizar formación de EB para la diferenciación de fibroblastos (figura 2B, C). Adjunto el EBs a membrana del sótano revestido de matriz placas y cambió el medio cada día. Consecuencia las células se transfirieron a noncoated y las placas revestidas de colágeno de tipo I. CBMC-iPSCs fueron distinguidos a fibroblastos. Durante la diferenciación, la morfología de los fibroblastos derivados de iPSC CBMC cambiado con el tiempo (suplementario Figura 2).

Los fibroblastos derivados de iPSC CBMC tienen morfologías similares a fibroblastos primarios (figura 2D). La expresión del marcador de la célula de vástago de pluripotent OCT4 fue regulada en los fibroblastos derivados de iPSC CBMC. Los marcadores del fibroblasto de COL1A1, COL1A2, COL3A1 y CD44 eran upregulated en fibroblastos derivados de iPSC CBMC (figura 2F). Secuencias de la cartilla se muestran en la tabla 1. También, los fibroblastos derivados de iPSC CBMC fueron confirmados por la expresión de vimentina y fibronectina por inmunohistoquímica (figura 2E). Estos resultados sugieren que los fibroblastos derivados de iPSC CBMC son similares a los fibroblastos primarios.

Hemos generado un organoide de piel 3D utilizando la CBMC-iPSC-derivado de queratinocitos y fibroblastos. El esquema de formación de la piel 3D organoide se muestra en la figura 3A. Hemos generado un organoide de piel 3D en una placa de inserción de la membrana. Para la cultura 3D, fibroblastos derivados de iPSC CBMC fueron estratificados con tipo I colágeno y superpuestas con queratinocitos CBMC-iPSC-derivados. Después de la siembra los queratinocitos CBMC-iPSC-derivado, el medio fue cambiado a una concentración normal de calcio por 2 días. Después de 2 días, un medio de concentración alta de calcio fue agregado solamente a la cámara baja para la formación de la cultura de la interfaz aire-líquido. La cultura de la interfaz de aire líquido inducido por la maduración y estratificación de los queratinocitos. El espesor de la piel 3D organoide se incrementó durante la cultura 3D. Estos resultados confirmaron que el organoide de piel 3D fue generado de iPSC-derivado de queratinocitos y fibroblastos por hematoxilina y eosina (H & E) manchas (figura 3C).

Usando el organoide 3D CBMC-iPSC-derivados de la piel, hemos generado un modelo de ratones humanizados (figura 3B) por injerto el organoide de piel 3D a los ratones. Fue inducida por un defecto de 1 cm x 2 cm, y se utilizó el método tie-over para el trasplante. Después de 2 semanas, la piel trasplantada se injertó eficientemente a los ratones, y esta habían confirmada por análisis de H & E e immunocytochemical (figura 3D). Maduración de los queratinocitos y los marcadores de diferenciación epidérmica de loricrin y KRT14 se expresaron en los organoides 3D CBMC-iPSC-derivados de la piel (figura 3E). Los organoides derivados de iPSC CBMC 3D piel fueron distinguidas funcionalmente eficiente injertan en ratones y curaron efectivamente defectos de la piel de ratones.

Figure 1
Figura 1 : La diferenciación del Keratinocyte de CBMC-iPSCs. (A) esquema de la diferenciación del keratinocyte de CBMC-iPSCs. (B y C) morfología del CBMC-iPSCs (panel B) y EBs derivados de iPSC (panel C). (D) la morfología de los queratinocitos CBMC-iPSC-derivados. (E) análisis de Immunocytochemical de Np63 (rojo) y KRT14 (verde), junto con DAPI (azul) la coloración. Las barras de escala = 100 μm. (F) expresión de genes del marcador pluripotentes y marcadores de keratinocyte de queratinocitos derivados de iPSC (iPSC-Ks). Los gráficos muestran la media con SEM de cinco muestras independientes. Diferencias entre grupos fueron examinadas para significación estadística uso de Student t-test. T-se aplicó la prueba para analizar conjuntos de datos cuantitativos no paramétricos y la cola de un p-valor fue calculado (*p < 0.05, **p < 0.01, ***p < 0.001 indica significancia estadística). Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2 : Diferenciación de fibroblastos de CBMC-iPSCs. (A) esquema de la diferenciación de fibroblastos de CBMC-iPSCs. (B y C) morfología del CBMC-iPSCs (panel B) y EBs derivados de iPSC (panel C). (D) la morfología de los fibroblastos derivados de iPSC CBMC. (E) análisis de Immunocytochemical de fibronectina (rojo), junto con DAPI (azul) la coloración y el vimentin (rojo). Las barras de escala = 100 μm. (F) expresión de genes del marcador pluripotentes y marcadores del fibroblasto de fibroblastos derivados de iPSC (iPSC-Fs). Los gráficos muestran la media con SEM de cinco muestras independientes. Diferencias entre grupos fueron examinadas para significación estadística uso de Student t-test. T-se aplicó la prueba para analizar conjuntos de datos cuantitativos no paramétricos y la cola de un p-valor fue calculado (*p < 0.05, **p < 0.01, ***p < 0.001 indica significancia estadística). Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3 : Generación de piel derivado de iPSC CBMC organoide y ratones humanizados modelo. (A) diagrama esquemático del proceso de generación de piel derivado de iPSC organoide (iSO). Trasplante (B) proceso de la iSO en ratones. (C) el análisis histológico de la iSO in vitro. (D) el análisis histológico de la iSO trasplantado en vivo. (EH) Análisis de immunocytochemical de loricrin y KRT14. Se burlan de control (panel E), iSO trasplantado (panel F, loricrin), piel de ratones (control negativo, grupo G), iSO trasplantado (panel H, KRT14). Las barras de escala = 200 μm. Haga clic aquí para ver una versión más grande de esta figura.

Supplementary Figure 1
Suplementario Figura 1: morfología de los queratinocitos derivados de iPSC. Haga clic aquí para ver una versión más grande de esta figura.

Supplementary Figure 2
Suplementaria Figura 2: morfología de fibroblastos derivados de iPSC. Haga clic aquí para ver una versión más grande de esta figura.

Nombre del destino Dirección Secuencia primer (5' - 3') Tamaño (pares de bases) Refseq_ID
OCT4 Hacia adelante
Marcha atrás
ACCCCTGGTGCCGTGAA
GGCTGAATACCTTCCCAAATA
190 NM_203289.5
PAX6 Hacia adelante
Marcha atrás
GTCCATCTTTGCTTGGGAAA
TAGCCAGGTTGCGAAGAACT
110 NM_000280.4
SOX1 Hacia adelante
Marcha atrás
CACAACTCGGAGATCAGCAA
GGTACTTGTAATCCGGGTGC
133 NM_005986.2
Np63 Hacia adelante
Marcha atrás
GGAAAACAATGCCCAGACTC
GTGGAATACGTCCAGGTGGC
294 NM_001114982.1
KRT5 Hacia adelante
Marcha atrás
ACCGTTCCTGGGTAACAGAGCCAC
GCGGGAGACAGACGGGGTGATG
198 NM_000424.3
KRT14 Hacia adelante
Marcha atrás
GCAGTCATCCAGAGATGTGACC
GGGATCTTCCAGTGGGATCT
181 NM_000526.4
CD44 Hacia adelante
Marcha atrás
AAGGTGGAGCAAACACAACC
AGCTTTTTCTTCTGCCCACA
151 NM_001202556.1
COL1A1 Hacia adelante
Marcha atrás
CCCCTGGAAAGAATGGAGATG
TCCAAACCACTGAAACCTCTG
148 NM_000088.3
COL1A2 Hacia adelante
Marcha atrás
GGATGAGGAGACTGGCAACC
TGCCCTCAGCAACAAGTTCA
77 NM_000089.3
COL3A1 Hacia adelante
Marcha atrás
CGCCCTCCTAATGGTCAAGG
TTCTGAGGACCAGTAGGGCA
161 NM_000090.3
Vimentina Hacia adelante
Marcha atrás
GAGAACTTTGCCGTTGAAGC
TCCAGCAGCTTCCTGTAGGT
170 NM_003380.5
GAPDH Hacia adelante
Marcha atrás
ACCCACTCCTCCACCTTTGA
CTGTTGCTGTAGCCAAATTCGT
110 NM_002046.5

Tabla 1: Secuencias de los primers utilizados para la reacción en cadena cuantitativa de la polimerasa en tiempo real.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

IPSCs humanas se han sugerido como una nueva alternativa para la medicina regenerativa personalizada17. Derivados del paciente personalizados iPSCs reflejan características de los pacientes que pueden utilizarse para el modelado de enfermedades, detección de drogas y trasplante autólogo18,19. El uso de iPSCs derivados del paciente también puede superar problemas con respecto a células primarias, la falta de un número adecuado de células y reacciones inmunes5,17,19. Sin embargo, la generación de iPSCs personalizada no es económicamente factible debido a restricciones de mano de obra, tiempo y costo. HLA-homocigótico derivado de CBMC iPSCs han surgido como una nueva posibilidad. IPSCs HLA homocigótica puede ser económicamente valiosos y puede ser aplicado a un gran número de pacientes8,11,12,13. Además, el mecanografiar de HLA de CBMCs ocurre durante el almacenamiento de banco de células, lo que fácil de usar para la investigación y trasplante. Protocolos para distinguir CBMC-iPSCs en cardiomiocitos, hepatocitos y condrocitos han sido registrados16,20,21,22,23.

Capas epidérmicas y dérmicas son componentes de la piel. La epidermis consiste en queratinocitos y consiste en la dermis de los fibroblastos. Así, hemos distinguido CBMC-iPSCs en queratinocitos y fibroblastos, respectivamente. Para la diferenciación, EBs uniformados, bien controlados y optimizados fueron generados por el colgante gota método15,24. Tipo IV colágeno es un componente importante de la membrana basal. Para la diferenciación del keratinocyte, EBs unieron tipo platos recubiertas de colágeno IV. Queratinocitos derivados de iPSC CBMC tenían una guijarro-como morfología (figura 1D). Marcadores de queratinocitos Np63 y KRT14 fueron expresados en iPSC-Ks (figura 1E, F). Ese resultado confirmó que RA y BMP4 inducida por el upregulation de los marcadores de queratinocitos. Además, fueron distinguidos CBMC-iPSCs en queratinocitos similares a queratinocitos primarios.

Para la diferenciación de fibroblastos, EBs fueron Unidos a las placas de membrana del sótano revestido de matriz y las células diferenciadas en serie fueron pasados en noncoated y las placas revestidas de colágeno de tipo I. Una subcultura serial fue inducida para especificar la diferenciación de fibroblastos. Los fibroblastos producen una matriz extracelular (ECM) que tenía funciones de migración y adherencia. Los fibroblastos también producen colágeno abundante componentes25. En los fibroblastos derivados de iPSC CBMC, aumentó el marcador de superficie de fibroblasto CD44. La expresión del colágeno era upregulated en iPSC-Fs (figura 2F). La expresión de la fibronectina y el vimentin fue aumentada en iPSC-Fs (figura 2E).

Con el distinguido queratinocitos y fibroblastos, generamos organitas CBMC-iPSC-derivados de la piel (figura 3A). Utilizamos una cultura de la interfaz de aire-líquido con un medio de ricos en calcio que inducida por capas estratificadas de piel derivado de iPSC CBMC organitas. La alta concentración de calcio era necesaria para la maduración del queratinocito in vivo e in vitro, mientras que la interfaz aire-líquido se utilizó para desarrollar varias capas estratos26,27,28. Utilizamos este método a imitar la verdadera piel, análisis e histológico demostrado que la piel se estratificó (figura 3C). Para confirmar la capacidad de cicatrización de heridas, trasplanta la iSO en piel de ratones, utilizando el método de preparación tie-over (figura 3D). Después del trasplante, el organitas piel eficientemente se injertaron y curaron adecuadamente la piel de ratones. KRT14 se expresó en la capa basal de la estratificación del epitelio escamoso y nonsquamous. Loricrin es un componente principal del estrato córneo encontrado en terminal distinguido y queratinizado células epiteliales29,30. El marcador de diferenciación epidérmica de loricrin se expresó en la piel trasplantada. La expresión de KRT14 y loricrin confirmó que fue completamente maduro el organoide de piel, y la diferenciación fue demostrada por inmunohistoquímica tinción (figura 3E).

En este estudio, hemos desarrollado un protocolo para distinguir CBMC-iPSCs en queratinocitos y fibroblastos, los tipos de la célula principal de la piel humana. Confirmamos que la CBMC-iPSC-derivado de queratinocitos y fibroblastos mostraron similares a líneas de células primarias fenotipos. Utilizando estas células diferenciadas, genera un organoide de piel 3D y había injertado en ratones NOD/scid usando el método de preparación tie-over. Esta técnica original primero fue descrita en 1929 por Blair y Brown y se ha utilizado comúnmente para injerto de piel31,32. Este método impide que el injerto en movimiento favoreció una buena adherencia a la herida y así acelera cicatrización de tejido. Análisis histológico confirmó que el organoide de piel 3D mímico un fenotipo de piel humana con éxito estratificado y madurado durante 2 semanas. Injerto de piel generalmente se realiza utilizando células de queratinocitos y fibroblastos por silicio compartimiento de burbuja33,34. Este sistema es fácil de injerto pero necesitábamos más tiempo observadas a la eficacia del trasplante después del injerto. La cámara de plástico o silicona funciona como una barrera contra la piel de los ratones. Las piel 3D organoides derivados del sistema iPSCs no utilice una cámara de plástico o silicona. En este sistema, el trasplante fue eficiente; sin embargo, era difícil bloquear el proceso de curación natural de los ratones. Por lo tanto, la piel de los ratones había cubierto muchas partes de la iSO durante mucho tiempo después del trasplante. Esta es una parte del método aquí presentado que debe mejorarse.

En conclusión, la CBMC-iPSCs son una fuente potencial de la célula para injertos de piel. Con estos protocolos, CBMC-iPSC-derivado de queratinocitos, fibroblastos y un organoide de piel 3D pueden utilizarse en estudios relacionados con la dermatología, drogas y proyección estética y medicina regenerativa.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Este trabajo fue apoyado por una subvención de la Corea salud tecnología R & D proyectos, Ministerio de sanidad, bienestar y familia, República de Corea (H16C2177, H18C1178).

Materials

Name Company Catalog Number Comments
Adenine Sigma A2786 Component of differentiation medium for fibroblast
AggreWell Medium (EB formation medium) STEMCELL 05893 EB formation
Anti-Fibronectin antibody abcam ab23750 Fibroblast marker
Anti-KRT14 antibody abcam ab7800 Keratinocyte marker
Anti-Loricrin antibody abcam ab85679 Stratum corneum marker
Anti-p63 antibody abcam ab124762 Keratinocyte marker
Anti-Vimentin antibody Santa cruz sc-7558 Fibroblast marker
BAND AID FLEXIBLE FABRIC Johnson & Johnson - Bandage
Basement membrane matrix (Matrigel) BD 354277 Component of differentiation medium for fibroblast
BLACK SILK suture AILEEE SK617 Skin graft
CaCl2 Sigma C5670 Component of epithelial medium for 3D skin organoid
Collagen type I BD 354236 3D skin organoid
Collagen type IV Santa-cruz sc-29010 Component of differentiation medium for keratinocyte
Defined keratinocyte-Serum Free Medium Gibco 10744-019 Component of differentiation medium for keratinocyte
DMEM, high glucose Gibco 11995065 Component of differentiation medium
DMEM/F12 Medium Gibco 11330-032 Component of differentiation medium
Essential 8 medium Gibco A1517001 iPSC medium
FBS, Qualified Corning 35-015-CV Component of differentiation medium for fibroblast and keratinocyte
Glutamax Supplement  Gibco 35050061 Component of differentiation medium for fibroblast
Insulin Invtrogen 12585-014 Component of differentiation medium for fibroblast and keratinocyte
Iris standard curved scissor Professional PC-02.10 Surgical instrument
Keratinocyte Serum Free Medium Gibco 17005-042 Component of differentiation medium for keratinocyte
L-ascorbic acid 2-phosphata sesquimagnesium salt hydrate Sigma A8960 Component of differentiation medium for keratinocyte
MEM Non-Essential Amino Acid Gibco 1140050 Component of differentiation medium for fibroblast
Meriam Forceps Thumb 16 cm HIROSE HC 2265-1 Surgical instrument
NOD.CB17-Prkdc SCID/J The Jackson Laboratory 001303 Mice strain for skin graft
Petri dish 90 mm Hyundai Micro H10090 Plastic ware
Recombinant Human BMP-4 R&D 314-BP Component of differentiation medium for keratinocyte
Recombinant human EGF protein R&D 236-EG Component of differentiation medium for keratinocyte
Retinoic acid Sigma R2625 Component of differentiation medium for keratinocyte
T/C Petridish 100 mm, 240/bx TPP 93100 Plastic ware
Transferrin Sigma T3705 Component of epithelial medium for 3D skin organoid
Transwell-COL collagen-coated membrane inserts  Corning CLS3492 Plastic ware for 3D skin organoid 
Vitronectin Life technologies A14700 iPSC culture
Y-27632 Dihydrochloride peprotech 1293823 iPSC culture

DOWNLOAD MATERIALS LIST

References

  1. Vincent, J. F., Bogatyreva, O. A., Bogatyrev, N. R., Bowyer, A., Pahl, A. K. Biomimetics: its practice and theory. Journal of The Royal Society Interface. 3, (9), 471-482 (2006).
  2. Madison, K. C. Barrier function of the skin: "la raison d'etre" of the epidermis. Journal of Investigative Dermatology. 121, (2), 231-241 (2003).
  3. Chen, M., Przyborowski, M., Berthiaume, F. Stem cells for skin tissue engineering and wound healing. Critical Reviews in Biomedical Engineering. 37, (4-5), 399-421 (2009).
  4. Dixit, S., et al. Immunological challenges associated with artificial skin grafts: available solutions and stem cells in future design of synthetic skin. Journal of Biological Engineering. 11, 49 (2017).
  5. Yamanaka, S. Induced pluripotent stem cells: past, present, and future. Cell Stem Cell. 10, (6), 678-684 (2012).
  6. Yamanaka, S. Pluripotency and nuclear reprogramming. Philosophical Transactions of the Royal Society B: Biological Sciences. 363, (1500), 2079-2087 (2008).
  7. Scheiner, Z. S., Talib, S., Feigal, E. G. The potential for immunogenicity of autologous induced pluripotent stem cell-derived therapies. Journal of Biological Chemistry. 289, (8), 4571-4577 (2014).
  8. Zimmermann, A., Preynat-Seauve, O., Tiercy, J. M., Krause, K. H., Villard, J. Haplotype-based banking of human pluripotent stem cells for transplantation: potential and limitations. Stem Cells and Development. 21, (13), 2364-2373 (2012).
  9. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, (4), 663-676 (2006).
  10. Terasaki, P. I. A brief history of HLA. Immunologic Research. 38, (1-3), 139-148 (2007).
  11. Haase, A., et al. Generation of induced pluripotent stem cells from human cord blood. Cell Stem Cell. 5, (4), 434-441 (2009).
  12. Rim, Y. A., et al. Recent progress of national banking project on homozygous HLA-typed induced pluripotent stem cells in South Korea. Journal of Tissue Engineering and Regenerative Medicine. 12, (3), 1531-1536 (2018).
  13. Nakatsuji, N., Nakajima, F., Tokunaga, K. HLA-haplotype banking and iPS cells. Nature Biotechnology. 26, (7), 739-740 (2008).
  14. Pappas, D. J., et al. Proceedings: human leukocyte antigen haplo-homozygous induced pluripotent stem cell haplobank modeled after the california population: evaluating matching in a multiethnic and admixed population. Stem Cells Translational Medicine. 4, (5), 413-418 (2015).
  15. Lin, Y., Chen, G. Embryoid body formation from human pluripotent stem cells in chemically defined E8 media. StemBook. Available from: https://www.stembook.org/node/6632 (2008).
  16. Kim, Y., et al. Establishment of a complex skin structure via layered co-culture of keratinocytes and fibroblasts derived from induced pluripotent stem cells. Stem Cell Research & Therapy. 9, (1), 217 (2018).
  17. Diecke, S., Jung, S. M., Lee, J., Ju, J. H. Recent technological updates and clinical applications of induced pluripotent stem cells. The Korean Journal of Internal Medicine. 29, (5), 547-557 (2014).
  18. Shi, Y., Inoue, H., Wu, J. C., Yamanaka, S. Induced pluripotent stem cell technology: a decade of progress. Nature Reviews Drug Discovery. 16, (2), 115-130 (2017).
  19. Yoshida, Y., Yamanaka, S. Recent stem cell advances: induced pluripotent stem cells for disease modeling and stem cell-based regeneration. Circulation. 122, (1), 80-87 (2010).
  20. Pham, T. L., Nguyen, T. T., Van Bui, A., Nguyen, M. T., Van Pham, P. Fetal heart extract facilitates the differentiation of human umbilical cord blood-derived mesenchymal stem cells into heart muscle precursor cells. Cytotechnology. 68, (4), 645-658 (2016).
  21. Stecklum, M., et al. Cell differentiation mediated by co-culture of human umbilical cord blood stem cells with murine hepatic cells. In Vitro Cellular & Developmental Biology - Animal. 51, (2), 183-191 (2015).
  22. Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. Journal of Visualized Experiments. (124), e55988 (2017).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Application of Cord Blood and Cord Blood-derived Induced Pluripotent Stem Cells for Cartilage Regeneration. Cell Transplantation. (2018).
  24. Shevde, N. K., Mael, A. A. Techniques in embryoid body formation from human pluripotent stem cells. Methods in Molecular Biology. 946, 535-546 (2013).
  25. Shamis, Y., et al. iPSC-derived fibroblasts demonstrate augmented production and assembly of extracellular matrix proteins. In Vitro Cellular & Developmental Biology - Animal. 48, (2), 112-122 (2012).
  26. Bikle, D. D., Xie, Z., Tu, C. L. Calcium regulation of keratinocyte differentiation. Expert Review of Endocrinology & Metabolism. 7, (4), 461-472 (2012).
  27. Bernstam, L. I., Vaughan, F. L., Bernstein, I. A. Keratinocytes grown at the air-liquid interface. In Vitro Cellular & Developmental Biology. 22, (12), 695-705 (1986).
  28. Prunieras, M., Regnier, M., Woodley, D. Methods for cultivation of keratinocytes with an air-liquid interface. Journal of Investigative Dermatology. 81, 1 Suppl 28-33 (1983).
  29. Steven, A. C., Bisher, M. E., Roop, D. R., Steinert, P. M. Biosynthetic pathways of filaggrin and loricrin--two major proteins expressed by terminally differentiated epidermal keratinocytes. Journal of Structural Biology. 104, (1-3), 150-162 (1990).
  30. Hohl, D., et al. Characterization of human loricrin. Structure and function of a new class of epidermal cell envelope proteins. Journal of Biological Chemistry. 266, (10), 6626-6636 (1991).
  31. Bern, R., et al. Original and modified technique of tie-over dressing: Method and application in burn patients. Burns. 44, (5), 1357-1360 (2018).
  32. Joyce, C. W., Joyce, K. M., Kennedy, A. M., Kelly, J. L. The Running Barbed Tie-over Dressing. Plastic and Reconstructive Surgery - Global Open. 2, (4), 137 (2014).
  33. Wang, C. K., Nelson, C. F., Brinkman, A. M., Miller, A. C., Hoeffler, W. K. Spontaneous cell sorting of fibroblasts and keratinocytes creates an organotypic human skin equivalent. Journal of Investigative Dermatology. 114, (4), 674-680 (2000).
  34. Yang, R., et al. Generation of folliculogenic human epithelial stem cells from induced pluripotent stem cells. Nature Communications. 5, 3071 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics