Generazione di pelle 3D Organoid dal cordone emoderivati indotta da cellule staminali pluripotenti indotte

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Vi proponiamo un protocollo che Mostra come differenziare i cheratinociti derivati da cellule staminali pluripotenti indotte e fibroblasti e generare un organoid pelle 3D, utilizzando questi cheratinociti e fibroblasti. Questo protocollo contiene un ulteriore passaggio di generazione di un modello di topi umanizzati. La tecnica presentata qui miglioreranno ricerca dermatologica.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Kim, Y., Ju, J. H. Generation of 3D Skin Organoid from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (146), e59297, doi:10.3791/59297 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La pelle è il più grande organo del corpo e ha molte funzioni. La pelle agisce come una barriera fisica e protettore del corpo e regola le funzioni corporee. Biomimetica è l'imitazione dei modelli, sistemi e gli elementi della natura allo scopo di risolvere complessi problemi umani1. Pelle biomimetica è uno strumento utile per la ricerca di malattia in vitro e in vivo della medicina rigenerativa. Cellule staminali umane pluripotenti indotte (iPSCs) hanno la caratteristica di proliferazione illimitata e la capacità di differenziazione di tre strati di germe. IPSCs umane vengono generati da varie cellule primarie, quali le cellule del sangue, cheratinociti e fibroblasti. Fra loro, cellule mononucleari del sangue ombelicale (CBMC) sono emersi come una fonte alternativa cellulare dal punto di vista della medicina rigenerativa allogenica. CBMC sono utili nella medicina rigenerativa perché umano del leucocita (HLA) l'antigene digitando è essenziale alla cella sistema bancario. Mettiamo a disposizione un metodo per la differenziazione del CBMC-iPSCs in cheratinociti e fibroblasti e per la generazione di un 3D pelle organoid. Fibroblasti e cheratinociti CBMC-iPSC-derivati hanno caratteristiche simili ad una linea cellulare primaria. Il organoids pelle 3D vengono generati mediante la sovrapposizione di uno strato epidermico su uno strato dermico. Trapiantando questo organoid pelle 3D, viene generato un modello di topi umanizzati. Questo studio indica che un organoid 3D pelle umana iPSC-derivato può essere uno strumento di romanzo, alternativo per la ricerca dermatologica in vitro e in vivo.

Introduction

Pelle copre la superficie più esterna del corpo e protegge gli organi interni. La pelle ha diverse funzioni, tra cui la protezione contro gli agenti patogeni, assorbire e immagazzinare l'acqua, regolazione della temperatura corporea ed espellendo corpo rifiuti2. Gli innesti di pelle possono essere classificati a seconda dell'origine della pelle; gli innesti usando la pelle da un altro donatore sono denominati allotrapianti, e gli innesti usando la pelle del paziente sono gli autoinnesti. Anche se un autoinnesto è il trattamento preferito a causa del suo rischio basso rifiuto, le biopsie della pelle sono difficili da eseguire su pazienti con lesioni gravi o di un numero insufficiente di cellule della pelle. In pazienti con gravi ustioni, tre volte il numero delle cellule della pelle è necessario per coprire vaste aree. La disponibilità limitata delle cellule della pelle dal corpo di un paziente si traduce in situazioni dove è necessario il trapianto di allogenous. Un documento non autografo è temporaneamente utilizzato fino a trapianto autologo può essere eseguito poiché è rifiutata solitamente dal sistema immunitario dell'ospite dopo circa 1 settimana3. Per superare il rifiuto dal sistema immunitario del paziente, gli innesti devono provenire da una fonte con la stessa identità immune del paziente4.

IPSCs umane sono un emergenti fonte di cellule staminali terapia5. IPSCs umane vengono generati dalle cellule somatiche, utilizzando fattori di riprogrammazione come OCT4, SOX2, Klf4 e c-Myc6. Utilizzando iPSCs umane supera le questioni etiche e immunologiche delle cellule staminali embrionali (ESCs)7,8. IPSCs umane hanno pluripotenza e possono differenziarsi in tre strati germinativi9. La presenza di HLA, un fattore critico nella medicina rigenerativa, determina la risposta immunitaria e la possibilità di rifiuto10. L'uso di derivati paziente iPSCs risolve i problemi di rigetto di limitazione e sistema immunitario cellulare-fonte. CBMC sono emerse anche come fonte alternativa cellulare per la medicina rigenerativa11. Obbligatorio HLA tipizzazione, che si verifica durante operazioni bancarie CBMC, facilmente utilizzabile per la ricerca e trapianto. Più ulteriormente, omozigoti iPSCs HLA-tipo può ampiamente applichi a vari pazienti12. Una banca CBMC-iPSC è un romanzo e una strategia efficace per la terapia cellulare e trapianto allogenico medicina rigenerativa12,13,14. In questo studio, usiamo CBMC-iPSCs, differenziate in cheratinociti e fibroblasti e generare strati della pelle 3D stratificato. Risultati da questo studio indicano che un organoid CBMC-iPSC-derivati della pelle di 3D è un nuovo strumento per la ricerca dermatologica in vitro e in vivo.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Tutte le procedure che coinvolgono animali sono state eseguite in conformità con il laboratorio animali Welfare Act, la guida per la cura e l'uso di animali da laboratorio, e le linee guida e criteri per la sperimentazione di roditore forniti dalla cura istituzionale degli animali e Utilizzare il Comitato (IACUC) della scuola di medicina dell'Università cattolica della Corea del sud. Il protocollo di studio è stato approvato dal comitato di revisione istituzionale della Università Cattolica di Corea (CUMC-2018-0191-01). Il IACUC e il dipartimento di animali di laboratorio (DOLA) della Università Cattolica di Corea, Songeui Campus accreditato presso il laboratorio di Corea eccellenza animale la Korea Food and Drug Administration nel 2017 e acquisita l'associazione di valutazione e Accreditamento di accreditamento completo internazionale laboratorio Animal Care International (AAALAC) nel 2018.

1. pelle di differenziazione delle cellule da cellule staminali pluripotenti indotte

  1. Preparazione media
    Nota: Conservare tutte le medie a 4 ° C in un ambiente buio per fino a 3 mesi. Filtrare tutte le medie, utilizzando un sistema di filtro di 0,22 μm in polietersulfone prima dell'uso per la sterilizzazione. Tutte le medie erano disponibile in un volume totale di 500 mL.
    1. Preparare KDM1 (mezzo di differenziazione del keratinocyte 1). Medium (DMEM dell'Aquila per volta di mix Dulbecco) / F12 medium (3:1) con 2% siero bovino fetale (FBS), 0,3 mmol/L di acido L-ascorbico, 5 μg/mL insulina e 24 adenina µ g/mL.
    2. Preparare KDM2 (mezzo di differenziazione del keratinocyte 2). Mix definito del keratinocyte privo di siero medio (Vedi la Tabella materiali) con 0,3 mmol/l di acido L-ascorbico, 5 μg/mL insulina e adenina 10 μg/mL.
      Nota: Medium senza siero del keratinocyte definito è ottimizzata per supportare la crescita e l'espansione dei cheratinociti.
    3. Preparare KDM3 (mezzo di differenziazione del keratinocyte 3). Mix definito medium senza siero del keratinocyte e medium senza siero del keratinocyte (1:1) vedere la Tabella materiali particolari.
      Nota: Medium senza siero del Keratinocyte è ottimizzata per la crescita e il mantenimento dei cheratinociti.
    4. Preparare FDM1 (mezzo di differenziazione dei fibroblasti 1). Media mix DMEM/F12 (3:1) con 5% FBS, 5 μg/mL insulina, adenina 0.18 mM e 10 ng/mL il fattore di crescita epidermico (EGF).
    5. Preparare FDM2 (mezzo di differenziazione del fibroblasto 2). Mix DMEM/F12 medium (1:1) con 5% FBS e 1% aminoacidi non essenziali.
    6. Preparare EP1 (epiteliali medie 1). Mix DMEM/F12 (3:1) con 4 mM L-Glutammina, 40 μM adenina, 10 della transferrina μg/mL, insulina 10 μg/mL e 0,1% FBS.
    7. Preparare EP2 (epiteliale medio 2). Mescolare EP1 e cloruro di calcio di 1,8 mM.
    8. Preparare EP3 (epiteliale medio 3, corneificazione medio). Media mix F12 con 4 mM L-Glutammina, 40 μM adenina, transferrina di 10 μg/mL, insulina 10 μg/mL, 2% FBS e cloruro di calcio di 1,8 mM.
  2. Generazione del corpo embrionale
    1. Generare il CBMC-iPSCs utilizzando il protocollo indicato in un precedente studio12.
    2. Cappotto piastre di coltura, utilizzando vitronectina. Preparare 5 mL per rivestire un piatto di 100 mm.
      1. Scongelare e risospendere 50 μL di vitronectin 0,5 mg/mL (concentrazione finale: 5 µ g/mL) con 5 mL di soluzione fisiologica sterile di tampone fosfato (PBS). Aggiungere la soluzione ai piatti e incubare a temperatura ambiente (TA) per 1 h. aspirare il materiale di rivestimento prima dell'uso (non deve seccare).
    3. Mantenere il CBMC-derivato iPSCs al 100 mm rivestite con vitronectina piastra e cambiare il mezzo di iPSC (E8) tutti i giorni a 37 ° C con 10% CO2.
    4. Generare corpi embrionali (EBs) utilizzando il protocollo indicato in un precedente studio15 (descritti brevemente di seguito). Espandere iPSCs modificando il mezzo fino a quando le cellule hanno raggiunto la confluenza di 80%. 80% confluenza, rimuovere il supporto e lavare con PBS.
    5. Trattare le cellule con 1 mL di 1 millimetro di acido etilendiamminotetraacetico (EDTA). Incubare a 37 ° C con 5% CO2 per 2 min e raccogliere le celle utilizzando 3 mL di terreno E8. Centrifugare le cellule a 250 x g per 2 min.
    6. Aspirare il supernatante e applicare 5 mL di terreno E8 alle celle. Contare le celle utilizzando un emocitometro e trasferimento di 1 x 106 cellule in una nuova provetta conica da 15 mL. Centrifugare le cellule a 250 x g per 2 min.
    7. Risospendere le cellule trasferite con 2,5 mL di mezzo di formazione di EB con inibitore di chinasi Rho-collegata (ROCK) 10 μM. Goccia 1 x 104 celle (25 µ l/goccia) su un coperchio di cultura noncoated usando una pipetta multicanale di 10 – 100 μL. Modulo 100 EBs da 1 x 106 celle (1 x 104 cellule/1 EB). Girare il piatto e aspetta la goccia al coperchio.
      Nota: Inibitore di roccia è necessaria durante la fase di attaccamento nel processo di differenziazione e di manutenzione. Aggiungere l'inibitore di roccia soltanto in fase di aggregazione EB.
    8. Incubare le goccioline a 37 ° C con 5% CO2 per 1 giorni.
    9. Il giorno successivo, raccolto il 100 EBs e utilizzarli per la differenziazione. Lavare il coperchio della piastra con iPSC medio (medio E8) o PBS e raccolta del contenuto in una provetta conica da 50 mL. Mantenere l'EBs presso RT per 1 min di stabilirsi li. Aspirare il supernatante e risospendere il EBs con il mezzo di E8 mantenerle in una capsula di Petri di 90 mm fino la differenziazione.
  3. Differenziazione del CBMC-iPSCs in cheratinociti
    Nota: Per un regime della differenziazione del keratinocyte dal CBMC-iPSCs, Vedi Figura 1A.
    1. Raccolto il 100 EBs in una provetta conica 50 mL con iPSC medium o PBS. Mantenere a temperatura ambiente per 1 min per sistemarsi la EBs. Assicurarsi che si depositano nella parte inferiore del tubo conico. Aspirare il supernatante e risospendere il EBs con E8 medio con 1 proteina morfogenetica dell'osso ng/mL 4 (BMP4). Trasferire l'EBs a una capsula di Petri di 90 mm e mantenerli a 37 ° C con 5% CO2 per 1 giorni.
    2. Cappotto in piastre di coltura, utilizzando il tipo collageno di IV. Preparare 5 mL di collagene di tipo IV per rivestire un piatto di 100 mm.
      1. Scongelare e risospendere il tipo di soluzione di collagene IV (concentrazione finale: 50 µ g/mL) con 0,05 N HCl. aggiungere la soluzione ai piatti e incubare a temperatura ambiente per 1 h. aspirare il materiale di rivestimento prima dell'uso (non deve seccare).
        Nota: Prima di utilizzare le piastre, lavare i piatti 3 x con PBS per rimuovere qualsiasi acido.
    3. Raccogliere l'EBs (punto 1.3.1) in una provetta conica da 50 mL e mantenerle a temperatura ambiente per 1 min di loro stabilirsi. Assicurarsi che si depositano sul fondo del tubo conico, aspirare il supernatante e risospendere il EBs in 6 mL di KDM1 con inibitore ROCK 10 µM. Trasferire l'EBs per il piatto di 100mm rivestite con collagene di tipo IV.
      Nota: Aggiungere l'inibitore di roccia soltanto in fase di attacco di EB.
    4. Tra 0 – 8 giorni, cambiare il mezzo ogni altro giorno per KDM1 con acido di 3 µM retinoico (RA) e 25 ng/mL ciascuno di BMP4 ed EGF. Mantenere l'EBs a 37 ° C con 5% CO2.
    5. Tra i giorni 9 – 12, modificare il mezzo ogni altro giorno KDM2 con 3 µM RA, BMP4 25 ng/mL e 20 ng/mL EGF.
    6. Tra i giorni 13 – 30, cambiare il mezzo ogni altro giorno a KDM3 con 10 ng/mL BMP4 e 20 ng/mL EGF.
  4. Differenziazione del CBMC-iPSC in fibroblasti
    Nota: Per un regime della differenziazione dei fibroblasti dal CBMC-iPSCs, vedere Figura 2A.
    1. Cappotto piastre di coltura, utilizzando la matrice della membrana basale. Preparare 5 mL per rivestire un piatto di 100 mm.
      1. Scongelare la matrice della membrana basale (concentrazione finale: 600 ng/mL) e diluirla con DMEM/F12 medio. Aggiungere la soluzione ai piatti e incubare a 37 ° C per 30 min. aspirare il materiale di rivestimento prima dell'uso (non deve seccare).
    2. Raccolto il 100 EBs in una provetta conica 50 mL utilizzando una pipetta con iPSC medium o PBS. Mantenere a temperatura ambiente per 1 min per sistemarsi la EBs. Assicurarsi che si depositano nella parte inferiore del tubo conico. Eliminare il surnatante.
    3. Risospendere il EBs utilizzando una pipetta di 1.000 µ l in 6 mL di FDM1 con inibitore ROCK 10 µM. Trasferire l'EBs (con medie) per un piatto di 100mm rivestite con matrice della membrana dello scantinato e incubare a 37 ° C con 5% CO2. Aggiorna il FDM1 ogni altro giorno per 3 giorni.
      Nota: Aggiungere solo l'inibitore di roccia presso la fase di collegamento di EB.
    4. Aggiungere 0,5 nM ossea morfogenetica (BMP 4) 4 FDM1 tra 4 e 6 giorni.
    5. Al giorno 7, cambiare il mezzo di FDM2 ogni altro giorno per 1 settimana.
    6. Al giorno 14, aggiungere 1 mL di 1 mM EDTA e incubare a 37 ° C con 5% CO2 per 2 min. raccogliere le cellule con 3 mL di FDM2 e centrifugare a 250 x g per 2 minuti rimuovere il surnatante e risospendere le cellule in 5 mL di FDM1.
    7. Contare le celle utilizzando un emocitometro, risospendere le 2 x 106 cellule con il mezzo di FDM1 e trasferire le cellule al piatto noncoated. Mantenere le cellule a 37 ° C con 5% CO2 e modificare il mezzo ogni altro giorno.
    8. Cappotto di piastre di coltura, utilizzando collagene di tipo I. Preparare 5 mL per rivestire un piatto di 100 mm. Diluire la soluzione di collagene di tipo I (concentrazione finale: 50 µ g/mL) in 0.02 N di acido acetico. Aggiungere la soluzione ai piatti e incubare per 1 h. aspirare il materiale di rivestimento prima dell'uso (non deve asciugarsi) a RT.
      Nota: Prima di utilizzare le piastre, lavare i piatti 3 x con PBS per rimuovere l'acido.
    9. Il giorno 21, aggiungere 1 mL di 1 mM EDTA e incubare a 37 ° C con 5% CO2 per 2 min. raccogliere le cellule con 3 mL di FDM1 e centrifugare a 250 x g per 2 minuti rimuovere il surnatante e risospendere le cellule in 5 mL di FDM1. Conteggio celle utilizzando un emocitometro e trasferimento 2 x 106 celle al tipo ho piatto rivestite con collagene 100 mm con FDM1 medio. Mantenere le cellule a 37 ° C con 5% CO2 e modificare il mezzo ogni altro giorno.
    10. Il giorno 28, aggiungere 1 mL di 1 mM EDTA e incubare a 37 ° C con 5% CO2 per 2 min. raccogliere le cellule con 3 mL di FDM1 e centrifugare a 250 x g per 2 minuti rimuovere il surnatante e risospendere le cellule in 5 mL di FDM1. Contare le celle utilizzando un emocitometro e trasferire 2 x 106 cellule per un piatto di noncoated con FDM1 medio. Mantenere la cella a 37 ° C con 5% CO2 e modificare il mezzo ogni altro giorno.
      Nota: iPSC-derivato fibroblasti proliferano come una cellula primaria del fibroblasto e passaggio fino a 10 passaggi. In questo studio, abbiamo utilizzato fibroblasti iPSC-derivato di due a cinque passaggi per ulteriori analisi.

2. applicazione di cellule differenziate derivate hiPSC

  1. Generazione di pelle 3D organoid
    1. Preparare tipo neutralizzato ho collagene sul ghiaccio, seguendo le raccomandazioni del produttore. Come concentrazione finale, utilizzare 3 mg/mL di collagene di tipo I (concentrazione stock di tipo I collagene è 3,47 mg/mL) e assicurarsi che il volume finale della miscela è di 5 mL. Calcolare il volume di 10 x PBS (volume finale/10 = 0,5 mL). Calcolare il volume di collagene da utilizzare tipo I (volume finale x concentrazione finale collagene / stock concentrazione di collagene = 5 mL x 3 mg / mL / 3,47 mg / mL = 4,32 mL). Calcolare il volume di 1 N NaOH (volume di collagene per essere utilizzato x 0,023 mL = 0,1 mL). Calcolare il volume di dH2O (finale volume - volume di collagene - il volume di PBS 10X - volume di 1 N NaOH = 4,32 5 mL mL-mL 0,5 mL-0,1 mL = 0,08). Mescolare il contenuto del tubo e tenerlo sul ghiaccio fino all'uso.
    2. Aggiungere 1 mL di EDTA per i fibroblasti iPSC-derivato dal passaggio 1.4.10 e incubare a 37 ° C con 5% CO2 per 2 min. raccogliere le cellule indipendente, contare le celle utilizzando un emocitometro e trasferire 2 x 105 cellule ad un nuovo tubo conico da 15 mL. Centrifugare a 250 x g per 2 minuti e rimuovere il surnatante. Risospendere le cellule dei fibroblasti derivati iPSC in 1,5 mL di FDM1 e neutralizzato il tipo ho soluzione di collagene (1:1).
      Nota: Mescolare la soluzione delicatamente per evitare bolle.
    3. Collocare l'inserto di membrana su una micropiastra 6-pozzetti, trasferire la miscela all'inserto e incubare a temperatura ambiente per 30 min.
      Nota: Non spostare le piastre.
    4. Dopo aver confermato la gelificazione, aggiungere 2 mL di terreno nella parte superiore dell'inserto e 3 mL per il fondo del pozzo. Incubare la matrice di fibroblasti e collagene a 37 ° C con 5% CO2 per 5-7 giorni, fino a quando la gelificazione è completa e non più contratti.
    5. Dopo la gelificazione completa, staccare i keratinocytes iPSC-derivato (dal punto 1.3.6) con EDTA. Aggiungere 1 mL di EDTA e incubare a 37 ° C con 5% CO2 per 2 min. raccogliere le cellule indipendente, contarli utilizzando un emocitometro e 1 x 106 cellule di trasferimento ad un nuovo tubo conico da 15 mL. Centrifuga a 250 x g per 2 min.
    6. Rimuovere il supernatante e risospendere le cellule di 1 x 106 a 50-100 µ l di calcio basso epiteliali terreno 1 (EP. 1).
    7. Aspirare la matrice di tutte le medie (Vedi punto 2.1.5) e 1 x 106 cellule dei keratinocytes iPSC-derivati su ogni strato di fibroblasti di seme. Incubare la piastra a 37 ° C con 5% CO2 per 30 min.
      Nota: Non spostare la piastra e non aggiungere qualsiasi supporto per il fissaggio del keratinocyte.
    8. Aggiungere 2 mL di EP1 alla parte superiore dell'inserto e 3 mL di EP1 sul fondo del pozzo.
    9. Dopo 2 giorni, aspirare tutto il mezzo della piastra di inserimento della membrana e modificare il mezzo normale del calcio EP2 per 2 giorni.
    10. Dopo 2 giorni, aspirare tutto il mezzo e aggiungere 3 mL di terreno corneificazione solo verso il basso per generare un'interfaccia aria-liquido.
    11. Mantenere la pelle 3D organoid fino a 14 giorni a 37 ° C con 5% CO2 e modificare il mezzo ogni altro giorno. Raccogliere la pelle 3D organoid tagliando il bordo dell'inserto e utilizzarlo per un ulteriore studio di colorazione e di innesto di pelle.
  2. Innesto di pelle
    1. Eseguire l'anestesia per inalazione in topi NOD/scid (maschile, vecchio 6 settimane), utilizzando un metodo standard, approvato dall'istituzione. Per innesto di pelle, radere il pelo della pelle dorsale di ogni mouse.
    2. Rimuovere una sezione di 1 cm x 2 cm di pelle del mouse, utilizzando forbici curve con il forcipe.
    3. Posto il CBMC-iPSC-derivati 3D pelle organoid sul sito difetto e sutura utilizzando un metodo di medicazione tie-over con i suturare di seta.
    4. Osservare i topi per 2 settimane e sacrificarli per l'analisi istologica. Il protocollo di colorazione è stato verificato in precedenti studi16.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Pelle è composta, per la maggior parte, dell'epidermide e del derma. Cheratinociti sono il tipo principale delle cellule dell'epidermide, e fibroblasti sono il tipo principale delle cellule del derma. Lo schema di differenziazione del keratinocyte è riportato in Figura 1A. CBMC-iPCSc sono state mantenute in un piatto di vitronectin-rivestito (Figura 1B). In questo studio, abbiamo differenziato CBMC-iPSCs in cheratinociti e fibroblasti con formazione di EB. Abbiamo generato utilizzando l'impiccagione di EBs metodo per garantire un'uniforme e controllata la differenziazione dei cheratinociti e fibroblasti (Figura 1C) drop. EBs sono stati fissati per tipo IV piastre rivestite con collagene per differenziazione dei cheratinociti, e il medium è stato cambiato ogni giorno. CBMC-iPSCs sono stati trattati con RA, BMP4 ed EGF. CBMC-iPSCs sono stati differenziati ai cheratinociti. Durante il differenziamento, la morfologia dei keratinocytes CBMC-iPSC-derivati ha cambiato nel corso del tempo (complementare figura 1).

Cheratinociti CBMC-iPSC-derivati hanno morfologie simili a keratinocytes primari (Figura 1D). L'espressione genica del marcatore pluripotenti OCT4 downregulated nei keratinocytes CBMC-iPSC-derivati. Sequenze dell'iniettore sono riportati nella tabella 1. L'espressione di marcatori dei cheratinociti Np63, KRT5 e KRT14 aumentava nei keratinocytes CBMC-iPSC-derivati (Figura 1,F). Cheratinociti CBMC-iPSC-derivati sono stati confermati tramite l'espressione di Np63 e KRT14 da immunohistochemistry (Figura 1E). Questi risultati hanno confermato che i keratinocytes CBMC-iPSC-derivati hanno le caratteristiche di keratinocytes primari.

Lo schema di differenziazione dei fibroblasti è illustrato nella Figura 2A. Abbiamo anche mantenuto CBMC-iPSCs in un piatto rivestito vitronectina e usato formazione EB per la differenziazione dei fibroblasti (Figura 2B, C). Abbiamo attaccato la EBs a piastre rivestite con matrice della membrana dello scantinato e cambiati il mezzo ogni giorno. Conseguenza le cellule sono state trasferite a noncoated e piastre rivestite con collagene di tipo I. CBMC-iPSCs sono stati differenziati ai fibroblasti. Durante il differenziamento, la morfologia dei fibroblasti CBMC-iPSC-derivati ha cambiato nel corso del tempo (complementare figura 2).

Fibroblasti CBMC-iPSC-derivati hanno morfologie simili ai fibroblasti primari (Figura 2D). L'espressione del marcatore di cellule staminali pluripotenti OCT4 downregulated nei fibroblasti CBMC-iPSC-derivati. Gli indicatori del fibroblasto di COL1A1, COL1A2, COL3A1 e CD44 erano sovraregolati nei fibroblasti CBMC-iPSC-derivati (Figura 2F). Sequenze dell'iniettore sono riportati nella tabella 1. Inoltre, fibroblasti CBMC-iPSC-derivati sono stati confermati dall'espressione di vimentina e fibronectina da immunohistochemistry (Figura 2E). Questi risultati indicano che i fibroblasti CBMC-iPSC-derivati sono simili ai fibroblasti primari.

Abbiamo generato un organoid pelle 3D utilizzando il CBMC-iPSC-derivati di cheratinociti e fibroblasti. Lo schema di formazione di organoid la pelle 3D è riportato in Figura 3A. Abbiamo generato un organoid pelle 3D su una piastra di inserimento della membrana. Per la cultura 3D, fibroblasti CBMC-iPSC-derivati sono stati stratificati con tipo I collagene e sovrapposti con cheratinociti CBMC-iPSC-derivati. Dopo la semina i keratinocytes CBMC-iPSC-derivato, il medium è stato cambiato ad una concentrazione di calcio normale per 2 giorni. Dopo 2 giorni, un mezzo di concentrazione elevata di calcio è stato aggiunto solo per la camera inferiore per la formazione della cultura di interfaccia aria-liquido. La lingua dell'interfaccia aria-liquido ha indotto la maturazione e la stratificazione dei keratinocytes. Lo spessore di organoid la pelle 3D è stato aumentato durante la coltura di 3D. Questi risultati hanno confermato che il organoid pelle 3D è stato generato da iPSC-derivato di cheratinociti e fibroblasti da ematossilina ed eosina (H & E) (Figura 3C).

Utilizzando il CBMC-iPSC-derivati 3D pelle organoid, abbiamo generato un modello di topi umanizzati (Figura 3B) innestando il organoid pelle 3D per i topi. Un difetto di 1 cm x 2 cm è stata indotta, e il metodo di tie-over è stato utilizzato per il trapianto. Dopo 2 settimane, la pelle trapiantata è stata innestata in modo efficiente ai topi, e abbiamo confermato che si tratta di H & E e immunocytochemical analisi (Figura 3D). Maturazione dei cheratinociti e i marcatori di differenziazione epidermica della loricrina e KRT14 sono stati espressi nel CBMC-iPSC-derivati 3D pelle organoids (Figura 3E). Il organoids pelle 3D CBMC-iPSC-derivati sono stati funzionalmente differenziati, efficientemente innestate su topi e guarito efficacemente i difetti della pelle di topi.

Figure 1
Figura 1 : Differenziazione dei cheratinociti del CBMC-iPSCs. (A) schema di differenziazione del keratinocyte dal CBMC-iPSCs. (B e C) morfologia del CBMC-iPSCs (pannello B) ed EBs iPSC-derivato (pannello C). (D) morfologia dei keratinocytes CBMC-iPSC-derivati. (E) analisi Immunocytochemical di Np63 (rosso) e KRT14 (verde), insieme con DAPI colorazione (blu). Le barre di scala = 100 μm. (F) l'espressione genica del marcatore pluripotenti e marcatori del keratinocyte dei cheratinociti iPSC-derivato (iPSC-Ks). I grafici mostrano la media con SEM di cinque campioni indipendenti. Differenze fra i gruppi sono state esaminate per significatività statistica utilizzando di Student t-test. Il t-test è stato applicato per analizzare set di dati quantitativi non parametrici e una coda p-value è stato calcolato (*p < 0,05, * *p < 0.01, * * *p < 0,001 indicato significatività statistica). Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2 : Differenziazione dei fibroblasti del CBMC-iPSCs. (A) schema di differenziazione dei fibroblasti dal CBMC-iPSCs. (B e C) morfologia del CBMC-iPSCs (pannello B) ed EBs iPSC-derivato (pannello C). (D) morfologia dei fibroblasti CBMC-iPSC-derivati. (E) analisi Immunocytochemical del vimentin (rosso) e fibronectina (rossa), insieme con DAPI colorazione (blu). Le barre di scala = 100 μm. (F) l'espressione genica del marcatore pluripotenti e marcatori del fibroblasto di iPSC-derivato del fibroblasto (iPSC-Fs). I grafici mostrano la media con SEM di cinque campioni indipendenti. Differenze fra i gruppi sono state esaminate per significatività statistica utilizzando di Student t-test. Il t-test è stato applicato per analizzare set di dati quantitativi non parametrici e una coda p-value è stato calcolato (*p < 0,05, * *p < 0.01, * * *p < 0,001 indicato significatività statistica). Clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3 : Generazione del modello di topi umanizzati e pelle CBMC-iPSC-derivati organoid. (A) diagramma schematico del processo di generazione di pelle iPSC-derivato organoid (iSO). (B) trapianto processo della iSO in topi. (C) l'analisi istologica della iSO in vitro. (D) l'analisi istologica della iSO trapiantato in vivo. (EH) Analisi di immunocytochemical della loricrina e KRT14. MOCK trapiantato iSO (pannello F, loricrina), pelle di topi (controllo negativo, pannello G), controllo (pannello E), trapiantato iSO (pannello H, KRT14). Le barre di scala = 200 μm. Clicca qui per visualizzare una versione più grande di questa figura.

Supplementary Figure 1
Complementare figura 1: morfologia dei cheratinociti derivati iPSC. Clicca qui per visualizzare una versione più grande di questa figura.

Supplementary Figure 2
Complementare figura 2: morfologia dei fibroblasti derivati iPSC. Clicca qui per visualizzare una versione più grande di questa figura.

Nome di destinazione Direzione Sequenza di primer (5' - 3') Dimensioni (coppie di basi) Refseq_ID
OCT4 Avanti
Invertire
ACCCCTGGTGCCGTGAA
GGCTGAATACCTTCCCAAATA
190 NM_203289.5
PAX6 Avanti
Invertire
GTCCATCTTTGCTTGGGAAA
TAGCCAGGTTGCGAAGAACT
110 NM_000280.4
SOX1 Avanti
Invertire
CACAACTCGGAGATCAGCAA
GGTACTTGTAATCCGGGTGC
133 NM_005986.2
Np63 Avanti
Invertire
GGAAAACAATGCCCAGACTC
GTGGAATACGTCCAGGTGGC
294 NM_001114982.1
KRT5 Avanti
Invertire
ACCGTTCCTGGGTAACAGAGCCAC
GCGGGAGACAGACGGGGTGATG
198 NM_000424.3
KRT14 Avanti
Invertire
GCAGTCATCCAGAGATGTGACC
GGGATCTTCCAGTGGGATCT
181 NM_000526.4
CD44 Avanti
Invertire
AAGGTGGAGCAAACACAACC
AGCTTTTTCTTCTGCCCACA
151 NM_001202556.1
COL1A1 Avanti
Invertire
CCCCTGGAAAGAATGGAGATG
TCCAAACCACTGAAACCTCTG
148 NM_000088.3
COL1A2 Avanti
Invertire
GGATGAGGAGACTGGCAACC
TGCCCTCAGCAACAAGTTCA
77 NM_000089.3
COL3A1 Avanti
Invertire
CGCCCTCCTAATGGTCAAGG
TTCTGAGGACCAGTAGGGCA
161 NM_000090.3
Vimentin Avanti
Invertire
GAGAACTTTGCCGTTGAAGC
TCCAGCAGCTTCCTGTAGGT
170 NM_003380.5
GAPDH Avanti
Invertire
ACCCACTCCTCCACCTTTGA
CTGTTGCTGTAGCCAAATTCGT
110 NM_002046.5

Tabella 1: Sequenze dei primer utilizzati per reazione a catena della polimerasi quantitativa in tempo reale.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

IPSCs umane sono stati suggeriti come una nuova alternativa per la medicina rigenerativa personalizzata17. Paziente-derivato personalizzato iPSCs riflettono le caratteristiche dei pazienti che possono essere utilizzate per la modellazione di malattia, lo screening di stupefacenti e di trapianto autologo18,19. L'uso di derivati paziente iPSCs può anche superare problemi per quanto riguarda le cellule primarie, una mancanza di numeri di cellulare adeguata e le reazioni immuni5,17,19. Tuttavia, la generazione di iPSCs personalizzato non è economicamente fattibile a causa di tempi, costi e restrizioni di manodopera. HLA-omozigoti iPSCs CBMC-derivati sono emersi come una nuova possibilità. HLA-omozigoti iPSCs può essere economicamente importanti e può essere applicato a un gran numero di pazienti8,11,12,13. Inoltre, tipizzazione HLA del CBMC si verifica durante la conservazione di banca delle cellule, rendendoli più facili da usare per la ricerca e trapianto. Protocolli di differenziarsi CBMC-iPSCs in cardiomiociti, epatociti e condrociti sono stati segnalati16,20,21,22,23.

Strati epidermici e cutanei sono componenti della pelle. L'epidermide è costituito da cheratinociti e il derma è costituito da fibroblasti. Così, abbiamo differenziato il CBMC-iPSCs nei cheratinociti e fibroblasti, rispettivamente. Per la differenziazione, in uniforme, ben controllato e ottimizzato EBs sono stati generati da appendere goccia metodo15,24. Collagene di tipo IV sono una componente importante della membrana dello scantinato. Per la differenziazione dei cheratinociti, EBs sono stati fissati per digitare piatti rivestite con collagene IV. Cheratinociti CBMC-iPSC-derivati avevano una sanpietrino-come la morfologia (Figura 1D). Marcatori del keratinocyte Np63 e KRT14 sono stati espressi in iPSC-Ks (Figura 1E, F). Tale risultato ha confermato che il RA e BMP4 ha indotto il upregulation dei marcatori dei cheratinociti. Inoltre, CBMC-iPSCs sono stati differenziati in cheratinociti simili ai keratinocytes primari.

Per la differenziazione dei fibroblasti, EBs furono attaccati alla membrana basale rivestite con matrice piastre, e le cellule differenziate in serie sono state attraversate sul noncoated e piastre rivestite con collagene di tipo I. Una sottocultura seriale è stata indotta per specificare la differenziazione dei fibroblasti. Fibroblasti prodotta una matrice extracellulare (ECM) che aveva funzioni di migrazione e l'adesione. Fibroblasti producono anche collagene abbondanti componenti25. In fibroblasti CBMC-iPSC-derivato, il marcatore di superficie del fibroblasto CD44 è stato aumentato. L'espressione del collagene era upregulated in iPSC-Fs (Figura 2F). L'espressione della fibronectina e il vimentin è stata aumentata di iPSC-Fs (Figura 2E).

Utilizzando il differenziato cheratinociti e fibroblasti, abbiamo generato pelle CBMC-iPSC-derivati organoids (Figura 3A). Abbiamo usato una lingua dell'interfaccia aria-liquido con un mezzo del alto-calcio che indotto stratificati strati di pelle CBMC-iPSC-derivati organoids. L'alta concentrazione di calcio era necessaria per la maturazione dei cheratinociti in vivo e in vitro, mentre l'interfaccia aria-liquido è stato utilizzato per sviluppare gli strati multistrato26,27,28. Abbiamo usato questo metodo per imitare la vera pelle e istologico analisi ha mostrato che la pelle è stata stratificata (Figura 3C). Per confermare la capacità di guarigione, abbiamo trapiantato la iSO nella pelle di topi, utilizzando il metodo di medicazione tie-over (Figura 3D). Dopo il trapianto, il organoids di pelle sono stati innestati in modo efficiente e guarito adeguatamente la pelle di topi. KRT14 è stata espressa nello strato basale della stratificazione epithelia squamous e squamosa. Loricrin è un componente principale dello strato corneo trovato terminalmente differenziate e cheratinizzato cellule epiteliali29,30. L'indicatore di differenziazione epidermica della loricrina è stato espresso in pelle trapiantata. L'espressione di KRT14 e loricrina confermata organoid la pelle era completamente maturo, che la differenziazione è stata dimostrata tramite immunoistochimica (Figura 3E).

In questo studio, abbiamo sviluppato un protocollo per differenziarsi CBMC-iPSCs in cheratinociti e fibroblasti, i tipi delle cellule principali della pelle umana. Abbiamo confermato che il CBMC-iPSC-derivati cheratinociti e fibroblasti hanno mostrato i fenotipi simili alle linee cellulari primarie. Utilizzando queste cellule differenziate, abbiamo generato un organoid 3D pelle ed esso innestati in topi NOD/scid utilizzando il metodo di medicazione tie-over. Questa tecnica originale in primo luogo è stato descritto nel 1929 da Blair e Brown ed è stato comunemente usata per l'innesto di pelle31,32. Questo metodo ha impedito l'innesto di movimento, ha favorito una buona adesione alla ferita e così accelerato la guarigione dei tessuti. L'analisi istologica ha confermato che il 3D pelle organoid hanno imitato un fenotipo di pelle umana che con successo stratificate e maturato più di 2 settimane. L'innesto di pelle viene generalmente eseguita utilizzando singole cellule di cheratinociti e fibroblasti di silicio alloggiamento di bolla33,34. Questo sistema è facile da innesto, ma avevamo bisogno di più tempo per osservato all'efficienza di trapianto dopo trapianto. La camera di plastica o silicone funziona come una barriera contro la pelle del topo. La pelle 3D organoid sistema-derivato iPSCs non utilizzare un alloggiamento di plastica o silicone. In questo sistema, il trapianto è stato efficiente; Tuttavia, era difficile bloccare il naturale processo di guarigione dei topi. Quindi, pelle di topi coperto molte parti della iSO per lungo tempo dopo il trapianto. Questa è una parte del metodo presentato qui che deve essere migliorato.

In conclusione, il CBMC-iPSCs sono una potenziale fonte di cellule per gli innesti di pelle. Utilizzando questi protocolli, CBMC-iPSC-derivati cheratinociti, fibroblasti e una pelle 3D organoid utilizzabile in studi relazionati alla dermatologia, droga e screening cosmetico e medicina rigenerativa.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla a rivelare.

Acknowledgments

Quest'opera è stata sostenuta da una sovvenzione la Corea Healthcare Technology R & D Project, Ministero della sanità, Welfare e famiglia, Repubblica di Corea (H16C2177, H18C1178).

Materials

Name Company Catalog Number Comments
Adenine Sigma A2786 Component of differentiation medium for fibroblast
AggreWell Medium (EB formation medium) STEMCELL 05893 EB formation
Anti-Fibronectin antibody abcam ab23750 Fibroblast marker
Anti-KRT14 antibody abcam ab7800 Keratinocyte marker
Anti-Loricrin antibody abcam ab85679 Stratum corneum marker
Anti-p63 antibody abcam ab124762 Keratinocyte marker
Anti-Vimentin antibody Santa cruz sc-7558 Fibroblast marker
BAND AID FLEXIBLE FABRIC Johnson & Johnson - Bandage
Basement membrane matrix (Matrigel) BD 354277 Component of differentiation medium for fibroblast
BLACK SILK suture AILEEE SK617 Skin graft
CaCl2 Sigma C5670 Component of epithelial medium for 3D skin organoid
Collagen type I BD 354236 3D skin organoid
Collagen type IV Santa-cruz sc-29010 Component of differentiation medium for keratinocyte
Defined keratinocyte-Serum Free Medium Gibco 10744-019 Component of differentiation medium for keratinocyte
DMEM, high glucose Gibco 11995065 Component of differentiation medium
DMEM/F12 Medium Gibco 11330-032 Component of differentiation medium
Essential 8 medium Gibco A1517001 iPSC medium
FBS, Qualified Corning 35-015-CV Component of differentiation medium for fibroblast and keratinocyte
Glutamax Supplement  Gibco 35050061 Component of differentiation medium for fibroblast
Insulin Invtrogen 12585-014 Component of differentiation medium for fibroblast and keratinocyte
Iris standard curved scissor Professional PC-02.10 Surgical instrument
Keratinocyte Serum Free Medium Gibco 17005-042 Component of differentiation medium for keratinocyte
L-ascorbic acid 2-phosphata sesquimagnesium salt hydrate Sigma A8960 Component of differentiation medium for keratinocyte
MEM Non-Essential Amino Acid Gibco 1140050 Component of differentiation medium for fibroblast
Meriam Forceps Thumb 16 cm HIROSE HC 2265-1 Surgical instrument
NOD.CB17-Prkdc SCID/J The Jackson Laboratory 001303 Mice strain for skin graft
Petri dish 90 mm Hyundai Micro H10090 Plastic ware
Recombinant Human BMP-4 R&D 314-BP Component of differentiation medium for keratinocyte
Recombinant human EGF protein R&D 236-EG Component of differentiation medium for keratinocyte
Retinoic acid Sigma R2625 Component of differentiation medium for keratinocyte
T/C Petridish 100 mm, 240/bx TPP 93100 Plastic ware
Transferrin Sigma T3705 Component of epithelial medium for 3D skin organoid
Transwell-COL collagen-coated membrane inserts  Corning CLS3492 Plastic ware for 3D skin organoid 
Vitronectin Life technologies A14700 iPSC culture
Y-27632 Dihydrochloride peprotech 1293823 iPSC culture

DOWNLOAD MATERIALS LIST

References

  1. Vincent, J. F., Bogatyreva, O. A., Bogatyrev, N. R., Bowyer, A., Pahl, A. K. Biomimetics: its practice and theory. Journal of The Royal Society Interface. 3, (9), 471-482 (2006).
  2. Madison, K. C. Barrier function of the skin: "la raison d'etre" of the epidermis. Journal of Investigative Dermatology. 121, (2), 231-241 (2003).
  3. Chen, M., Przyborowski, M., Berthiaume, F. Stem cells for skin tissue engineering and wound healing. Critical Reviews in Biomedical Engineering. 37, (4-5), 399-421 (2009).
  4. Dixit, S., et al. Immunological challenges associated with artificial skin grafts: available solutions and stem cells in future design of synthetic skin. Journal of Biological Engineering. 11, 49 (2017).
  5. Yamanaka, S. Induced pluripotent stem cells: past, present, and future. Cell Stem Cell. 10, (6), 678-684 (2012).
  6. Yamanaka, S. Pluripotency and nuclear reprogramming. Philosophical Transactions of the Royal Society B: Biological Sciences. 363, (1500), 2079-2087 (2008).
  7. Scheiner, Z. S., Talib, S., Feigal, E. G. The potential for immunogenicity of autologous induced pluripotent stem cell-derived therapies. Journal of Biological Chemistry. 289, (8), 4571-4577 (2014).
  8. Zimmermann, A., Preynat-Seauve, O., Tiercy, J. M., Krause, K. H., Villard, J. Haplotype-based banking of human pluripotent stem cells for transplantation: potential and limitations. Stem Cells and Development. 21, (13), 2364-2373 (2012).
  9. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, (4), 663-676 (2006).
  10. Terasaki, P. I. A brief history of HLA. Immunologic Research. 38, (1-3), 139-148 (2007).
  11. Haase, A., et al. Generation of induced pluripotent stem cells from human cord blood. Cell Stem Cell. 5, (4), 434-441 (2009).
  12. Rim, Y. A., et al. Recent progress of national banking project on homozygous HLA-typed induced pluripotent stem cells in South Korea. Journal of Tissue Engineering and Regenerative Medicine. 12, (3), 1531-1536 (2018).
  13. Nakatsuji, N., Nakajima, F., Tokunaga, K. HLA-haplotype banking and iPS cells. Nature Biotechnology. 26, (7), 739-740 (2008).
  14. Pappas, D. J., et al. Proceedings: human leukocyte antigen haplo-homozygous induced pluripotent stem cell haplobank modeled after the california population: evaluating matching in a multiethnic and admixed population. Stem Cells Translational Medicine. 4, (5), 413-418 (2015).
  15. Lin, Y., Chen, G. Embryoid body formation from human pluripotent stem cells in chemically defined E8 media. StemBook. Available from: https://www.stembook.org/node/6632 (2008).
  16. Kim, Y., et al. Establishment of a complex skin structure via layered co-culture of keratinocytes and fibroblasts derived from induced pluripotent stem cells. Stem Cell Research & Therapy. 9, (1), 217 (2018).
  17. Diecke, S., Jung, S. M., Lee, J., Ju, J. H. Recent technological updates and clinical applications of induced pluripotent stem cells. The Korean Journal of Internal Medicine. 29, (5), 547-557 (2014).
  18. Shi, Y., Inoue, H., Wu, J. C., Yamanaka, S. Induced pluripotent stem cell technology: a decade of progress. Nature Reviews Drug Discovery. 16, (2), 115-130 (2017).
  19. Yoshida, Y., Yamanaka, S. Recent stem cell advances: induced pluripotent stem cells for disease modeling and stem cell-based regeneration. Circulation. 122, (1), 80-87 (2010).
  20. Pham, T. L., Nguyen, T. T., Van Bui, A., Nguyen, M. T., Van Pham, P. Fetal heart extract facilitates the differentiation of human umbilical cord blood-derived mesenchymal stem cells into heart muscle precursor cells. Cytotechnology. 68, (4), 645-658 (2016).
  21. Stecklum, M., et al. Cell differentiation mediated by co-culture of human umbilical cord blood stem cells with murine hepatic cells. In Vitro Cellular & Developmental Biology - Animal. 51, (2), 183-191 (2015).
  22. Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. Journal of Visualized Experiments. (124), e55988 (2017).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Application of Cord Blood and Cord Blood-derived Induced Pluripotent Stem Cells for Cartilage Regeneration. Cell Transplantation. (2018).
  24. Shevde, N. K., Mael, A. A. Techniques in embryoid body formation from human pluripotent stem cells. Methods in Molecular Biology. 946, 535-546 (2013).
  25. Shamis, Y., et al. iPSC-derived fibroblasts demonstrate augmented production and assembly of extracellular matrix proteins. In Vitro Cellular & Developmental Biology - Animal. 48, (2), 112-122 (2012).
  26. Bikle, D. D., Xie, Z., Tu, C. L. Calcium regulation of keratinocyte differentiation. Expert Review of Endocrinology & Metabolism. 7, (4), 461-472 (2012).
  27. Bernstam, L. I., Vaughan, F. L., Bernstein, I. A. Keratinocytes grown at the air-liquid interface. In Vitro Cellular & Developmental Biology. 22, (12), 695-705 (1986).
  28. Prunieras, M., Regnier, M., Woodley, D. Methods for cultivation of keratinocytes with an air-liquid interface. Journal of Investigative Dermatology. 81, 1 Suppl 28-33 (1983).
  29. Steven, A. C., Bisher, M. E., Roop, D. R., Steinert, P. M. Biosynthetic pathways of filaggrin and loricrin--two major proteins expressed by terminally differentiated epidermal keratinocytes. Journal of Structural Biology. 104, (1-3), 150-162 (1990).
  30. Hohl, D., et al. Characterization of human loricrin. Structure and function of a new class of epidermal cell envelope proteins. Journal of Biological Chemistry. 266, (10), 6626-6636 (1991).
  31. Bern, R., et al. Original and modified technique of tie-over dressing: Method and application in burn patients. Burns. 44, (5), 1357-1360 (2018).
  32. Joyce, C. W., Joyce, K. M., Kennedy, A. M., Kelly, J. L. The Running Barbed Tie-over Dressing. Plastic and Reconstructive Surgery - Global Open. 2, (4), 137 (2014).
  33. Wang, C. K., Nelson, C. F., Brinkman, A. M., Miller, A. C., Hoeffler, W. K. Spontaneous cell sorting of fibroblasts and keratinocytes creates an organotypic human skin equivalent. Journal of Investigative Dermatology. 114, (4), 674-680 (2000).
  34. Yang, R., et al. Generation of folliculogenic human epithelial stem cells from induced pluripotent stem cells. Nature Communications. 5, 3071 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics