استراتيجية متقاربة لتوليد مكتبة cDNA التسلسل تقريبا من المحار المحيط الهادئ غير المشار إليها

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

ونحن نصف استراتيجية لكيفية استخدام عينات الحمض النووي الريبي من عينات المحار المحيط الهادئ غير المشار إليها، وتقييم المواد الوراثية بالمقارنة مع بيانات الجينوم المتاحة للجمهور لتوليد مكتبة cDNA تسلسل تقريبا.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Lyu, Y. M., Li, Y. Q., Song, H. B., Guo, J., Wang, T., Liu, L., Yedid, G., Voglmeir, J. A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters. J. Vis. Exp. (148), e59462, doi:10.3791/59462 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

غالباً ما يكون من الصعب توفير المزيد من الدراسات أو الأطراف الثالثة بسبب تطوير خطوط الخلايا الجديدة أو مشاريع تسلسل الجينوم، والتي كانت تستخدم في السابق في التجارب الرئيسية مثل تطوير خطوط الخلايا الجديدة أو مشاريع تسلسل الجينوم. الطبيعة الاستهلاكية للعينات. وعلى الرغم من أن عينات المحار الفردية في المحيط الهادئ موزعة الآن على نطاق واسع على سواحل المحيط الهادئ في آسيا وأستراليا وأمريكا الشمالية، فإنها متنوعة جينيا ً جداً وبالتالي فهي غير مناسبة مباشرة كمادة بداية لمكتبات الجينات. في هذه المقالة، نبين استخدام عينات المحار المحيط الهادئ غير المشار إليها التي تم الحصول عليها من أسواق المأكولات البحرية الإقليمية لتوليد مكتبات cDNA. ثم تمت مقارنة هذه المكتبات بجينوم المحار المتاح للجمهور، وتم اختيار أقرب مكتبة ذات صلة باستخدام الجينات المرجعية الميتوكوندريا Cytochrome C Oxidase subunit I (COX1) وNADH Dehydrogenase (ND). وتتجلى ملاءمة مكتبة cDNA التي تم إنشاؤها أيضا عن طريق استنساخ والتعبير عن اثنين من الجينات ترميز الإنزيمات UDP-glucuronic حمض dehydrogenase (UGD) وUDP-xylose synthase (UXS)، والتي هي المسؤولة عن التركيب البيولوجي من UDP-xylose من UDP-الجلوكوز.

Introduction

وقد يكون الحصول على المواد البيولوجية الحية المشار إليها تحديا ً بسبب طول فترات التسليم، أو منطق تنظيم المشاريع، أو الأنظمة الجمركية الخاصة بكل بلد. وكبديل لذلك، يمكن أيضا جمع المواد البيولوجية المطلوبة من عينات متطابقة فيفيوالعادة. ومع ذلك، قد تختلف هذه العينات بشكل كبير على مستوى النمط الجيني، وبالتالي فإن المقارنات مع الجينومات المرجعية المخزنة رقمياً من نفس الأنواع غالباً ما تصبح صعبة أو حتى عديمة الجدوى بسبب عدم توافق المواد المصدرة حديثاً مع طرق تضخيم الحمض النووي الموجودة. تسلسل الجينات المحفوظة للغاية من العينات الفردية هو أداةتستخدم على نطاق واسع وقوية لتحديد الأنواع 1، مثل الجينات الميتوكوندريا المحفوظة التي تستخدم في كثير من الأحيان كجينات مرجعية لتقييم جودة مكتبات cDNA2 ،3،4،5،6. الأساس المنطقي للطريقة المعروضة هنا هو أن الحفظ العالي لتسلسلات الجينات الميتوكوندريا في عينات المحار الفردية المجهولة مقارنة بالتسلسلات المقابلة للجينوم المرجعي يشير إلى أن الجينات الأخرى قد تظهر أيضًا انخفاض مستوى الاختلاف، نظرا لمعدل أسرع عموما من تطور الحمض النووي الميتوكوندريا بالنسبة للحمض النوويالنووي7، مما يسمح تضخيم وعزل مجموعة واسعة من الجينات ذات الصلة علميا وصناعيا ببساطة باستخدام علنا بيانات التسلسل المتوفرة كمرجع.

الهدف العام للطريقة الموصوفة هنا هو تقديم سير عمل محسن لتوليد مكتبة cDNA المحار تسلسل تقريبا التي يمكن استخدامها كقالب الحمض النووي لاستنساخ جينات المحار. في التسلسل الظاهري، يتم التحايل على تسلسل الجينوم دي نوفو؛ بدلاً من ذلك، يتم استخدام تسلسل مرجعي معروف ومخزن رقمياً مباشرة لاستخدام أو تصميم التمهيديات لإنتاج cDNAs التي ستضم في نهاية المطاف مكتبة (أو تضاف إلى مكتبة موجودة من قبل). والهدف من ذلك هو إنتاج مكتبة cDNA متقاربة، مما يعني أن أوجه التشابه بين تسلسلات cDNA المتولدة والتسلسل المرجعي يمكن ترتيبها من الاختلاف المنخفض إلى العالي. ميزة رئيسية لاستخدام السيتوكروم C Oxidase الوحدة الفرعية 1 (COX1) وNADH Dehydrogenase (ND) كجينات مرجعية هو أنه حتى عينات المحار المفككة جغرافيا للغاية يمكن أن تكون شخصية بسبب الحفاظ على عالية من هذه الجينات الميتوكوندريا. بعد أن أثبتت النهج مع هذه العلامات الراسخة، ثم نثبت تطبيقه على اثنين من المرشحين الإنزيم التي تشارك في التركيب الحيوي النيوكليوتيد السكر، ويمكن أن تكون ذات صلة صناعية8،9، 10- ولا تزال الإمكانات التكنولوجية الأحيائية لمحار المحيط الهادئ غير مستكشفة. وبالتالي، نعتقد أن هذه الطريقة المتقاربة لإعداد مكتبة cDNA التسلسل تقريبا ستكون مناسبة أيضا للباحثين غير المتخصصين الذين يرغبون في توليد cDNA من هذه المواد البيولوجية ذات الصلة.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

ملاحظة: يتم عرض نظرة عامة تخطيطية في الشكل 1.

1. جمع عينة

  1. الحصول على عينات المحار. إبقاء المحار على الجليد خلال فترة ما بعد الحصاد، والنقل وقبل الاستخدام المختبري وعملية في غضون 4-7 أيام بعد الشراء.
    ملاحظة: لهذا البروتوكول، تم شراء المحار من سوق تشونغ كاي بالجملة في نانجينغ (الناشئة من نينغدي، فوجيان، الصين وLianyungang، جيانغسو، الصين)، Haijie شركة المنتجات المائية في تشينغداو (الناشئة من تشينغداو، شاندونغ، الصين)، Jucheng شركة المنتجات المائية في يانتاى (الناشئة من يانتاي، شاندونغ، الصين) وجينشيو شركة المنتجات المائية في تشينغداو (الناشئة من تشينغداو، شاندونغ، الصين)).

2. الحمض النووي الريبي العزلة عن طريق استخراج ثيوسيانات الفينول غوانيدينيوم

  1. إعداد عينة من أنسجة المحار
    1. قطع ما يقرب من 100 ملغ من الأنسجة الرخوة متجانسة من المركز الهندسي التقريبي لكل عينة المحار مع مشرط معقمة، ونقل العينات إلى النيتروجين السائل.
    2. قتل الجزء المتبقي من المحار عن طريق التجميد عند -80 درجة مئوية لمدة ساعة واحدة والتخلص منها كنفايات بيولوجية.
    3. طحن أنسجة المحار فلاش المجمدة في مسحوق ناعم في هاون (200 مل) مليئة 50 مل من النيتروجين السائل.
    4. وزن 75 ملغ من الأنسجة المجمدة لكل عينة في أنبوب الطرد المركزي معقمة 1.5 مل ومزيج مع 1 مل من الكاشف استخراج ثيوسيانات-فينول guanidinium. الطرد المركزي العينة في 14،000 × ز في 4 درجة مئوية لمدة 15 دقيقة.
  2. نقل supernatant إلى أنبوب الطرد المركزي 1.5 مل جديدة، إضافة 200 درجة مئوية من الكلوروفورم ومزيج جيدا باستخدام خلاط دوامة لمدة 10-15 ثانية حتى يتحول الخليط حليبي أبيض.
  3. الطرد المركزي في 14،000 × ز في 4 درجة مئوية لمدة 15 دقيقة، ونقل الطبقة المائية العليا بعناية مع ماصة 200 درجة مئوية دون إزعاج interphase في أنبوب الطرد المركزي 1.5 مل جديدة.
  4. إضافة 500 درجة مئوية من الكحول isopropyl وخلط العينات بلطف عن طريق الانعكاس، ثم ترك العينات لمدة 20 دقيقة على الجليد. الطرد المركزي في 14،000 × ز في 4 درجة مئوية لمدة 8 دقائق وإزالة supernatant.
  5. إعادة تعليق كل من الكريات في 1 مل من EtOH 75٪، والطرد المركزي في 14،000 × ز في 4 درجة مئوية لمدة 5 دقائق.
  6. كرر الخطوة 2.5 مرة واحدة. تجفيف الكريات لمدة 6 دقائق في درجة حرارة الغرفة. لا تجف لفترة أطول. خلاف ذلك، قد يكون من الصعب حل بيليه RNA في الخطوة التالية.
  7. حل بيليه الحمض النووي الريبي المجفف في 25 ميكرولتر من DEPC (diethylpyrocarbonate) المعالجة بالماء والحفاظ على أنبوب على الجليد. استخدام عينات RNA في غضون 24 ساعة.

3. توليد مكتبة cDNA عن طريق النسخ العكسي

  1. لكل عينة RNA، وإعداد خليط رد فعل باستخدام نظام النسخ العكسي التجاري باستخدام ماصة 10 ميكرولتر: إضافة 4 ميكرولتر من محلول MgCl 2 ميكرولتر من 10X رد الفعل العازلة، 2 ميكرولتر من محلول dNTP، 0.5 ميكرولتر من مثبطات RNase، 0.7 ميكرولتر من AMV عكس النسخ، 0.5 ميكرولتر من Oligo (dT) 15 التمهيدي، 1 ميكرولتر من عينة الحمض النووي الريبي المستخرجة و 9.3 ميكرولتر من H2O في أنبوب PCR 300 ميكرولتر.
  2. يحضن خليط في دراجة حرارية PCR لمدة 60 دقيقة في 42 درجة مئوية، ثم قم بزيادة درجة الحرارة إلى 95 درجة مئوية لمدة 5 دقائق.
  3. تخزين مكتبة cDNA التي تم إنشاؤها لمدة تصل إلى 12 شهرا في -20 درجة مئوية.

4- تضخيم الجينات الميتوكوندريا وتنقيتها

  1. إعداد خليط PCR باستخدام ماصة 10 درجة مئوية. إضافة 0.25 ميكرولتر (1.25 U) من بوليميراز الحمض النووي عالي الدقة، 2 ميكرولتر من محلول dNTP (2.5 مليون متر من كل dNTP)، 0.5 ميكرولتر من التمهيدي الأمامي COX1 أو ND (100 μM)، 0.5 ميكرولتر من COX1 أو ND التمهيدي العكسي (100 درجة مئوية)، 1 ميكرولتر من مكتبة cDNA ، 5 ميكرولتر من محلول المخزن المؤقت 5X و 16 ميكرولتر من H2O المقطر في أنبوب PCR 300 ميكرولتر.
  2. إجراء تضخيم PCR باستخدام المعلمات التالية: بعد خطوة إزالة النقانالأولي عند 95 درجة مئوية (المدة 5 دقائق)، 35 دورة تفاعل PCR تتكون من خطوة صلب عند 55 درجة مئوية (30 درجة مئوية)، وخطوة استطالة عند 72 درجة مئوية (2 دقيقة)، وخطوة إزالة النقان عند 95 درجة مئوية (30 درجة مئوية) ، قم بإجراء خطوة استطالة واحدة في اللمسات الأخيرة لمدة 5 دقائق عند 72 درجة مئوية.
  3. استخدام 5 ميكرولتر من المنتج PCR للتحقق من قبل الأوجاروز جل الكهربائي جودة المنتج PCR التي تم الحصول عليها. مراقبة الجين COX1 أو ND تضخيم كنطاق واحد في أزواج قاعدة إما 759 أو 748، على التوالي.
  4. تنقية بقية المنتج PCR مع مجموعة تنظيف PCR.
    1. إضافة 100 ميكرولتر من محلول 'PCR-A' (الحمض النووي العازلة ملزمة الذي يحتوي على تركيزات عالية من أملاح تشاوتروبيك11) إلى العينة. دوامة لفترة وجيزة لخلط المحتويات.
    2. ضع عمود التنقية في أنبوب طرد مركزي بـ 2 مل. ماصة خليط رد فعل من 4.4.1. في العمود. الطرد المركزي في 14،000 × ز لمدة دقيقة واحدة في درجة حرارة الغرفة.
    3. تخلص من الفيلتر من أنبوب الطرد المركزي. إرجاع العمود إلى أنبوب الطرد المركزي 2 مل، إضافة 700 ميكرولتر من الحل 'W2' في العمود والطرد المركزي في 14،000 × ز لمدة دقيقة في درجة حرارة الغرفة ('W2' هو محلول الغسيل الذي يحتوي على تركيزات عالية من الإيثانول لإزالة التشاوتروبيك المتبقية الأملاح من عمود تنقية).
    4. تخلص من الفيلتر وأعد العمود إلى أنبوب الطرد المركزي 2 مل. أضف 400 لتر من الحل 'W2' إلى العمود والطرد المركزي في 14,000 × ز لمدة دقيقة واحدة في درجة حرارة الغرفة.
    5. ما قبل الحرارة 1 مل من الماء منزوع الأيونات إلى 65 درجة مئوية في سخان كتلة معدنية. نقل العمود إلى أنبوب الطرد المركزي 1.5 مل جديدة. ماصة 25 درجة مئوية من 65 درجة مئوية الساخنة قبل تسخينالمياه منزوعة الأيونات إلى وسط غشاء العمود الأبيض. اسمحوا الغشاء نقع لمدة دقيقة واحدة في درجة حرارة الغرفة.
    6. الطرد المركزي في 14،000 × ز لمدة دقيقة واحدة في درجة حرارة الغرفة وتجاهل العمود.
  5. تخزين المنتج PCR تنقية لمدة تصل إلى 12 شهرا في -20 درجة مئوية.

5- تسلسل الجينات الميتوكوندريا ومقارنتها

  1. إرسال عينات PCR المنقية من الخطوة 4.5 لتسلسل Sanger باستخدام التمهيديات ذات الصلة COX1 أو ND إلى الأمام كتمهيدات التسلسل. واختياريًا، يمكن أيضًا استخدام التمهيديات العكسية COX1 أو ND للتسلسل ثنائي الاتجاه.
  2. بعد استرجاع نتائج التسلسل، قارن التسلسلات مع تسلسل الجينوم للسلالة المرجعية للمحار في المحيط الهادئ (معرف تصنيف البنك الأهلي التجاري: 29159) باستخدام أداة NCBI Nucleotide BLAST على الإنترنت (blast.ncbi.nlm.nih.gov) (الشكل2 والشكل 3) ).

6. تطبيق مكتبة cDNA لاستنساخ الجينات MgUGD وMgUXS

  1. تضخيم وتنقية الجينات MgUGD وMgUXS باستخدام التمهيديات الأمامية والعكسية الخاصة من MgUGD وMgUXS بواسطة PCR بعد الخطوات 4.1. إلى 4.4.
  2. نقل 2 ميكرولتر من المخزن المؤقت للهضم (10X مركزة) و 6 ميكرولتر من المياه منزوعة الأيونات إلى أنبوب الطرد المركزي 1.5 مل. إضافة 10 ميكرولتر من منتجات MgUGD أو MgUXS PCR المنقى جنبا إلى جنب مع تقييد endonucleases Nde I و Xho I (1 μL لكل منهما، 20 U). حضانة عند 37 درجة مئوية لمدة 3 ساعة.
  3. إعداد ناقلات pET-30a المهضومة مسبقًا: نقل 500 نانوغرام من ناقل pET-30a إلى أنبوب طرد مركزي جديد بسعة 1.5 مل وزيادة الحجم إلى 16 ميكرولتر باستخدام المياه منزوعة الأيونات. إضافة 2 ميكرولتر من المخزن المؤقت الهضم (10X مركزة) جنبا إلى جنب مع تقييد endonucleases Nde I وXho I (1 ميكرولتر لكل منهما، 20 U).
    1. بعد احتضان الخليط عند 37 درجة مئوية لمدة 3 ساعات، أضف 1 ميكرولتر من الفوسفاتيز القلوي (1 U) وحضانة عند 37 درجة مئوية لمدة ساعة إضافية. تعطيل الفوسفاتيز القلوية عن طريق التدفئة في 75 درجة مئوية لمدة 10 دقائق في سخان كتلة معدنية ساخنة مسبقا.
  4. نقل 4 ميكرولتر من منتجات الحمض النووي MgUGD أو MgUXS المهضومة إلى أنابيب الطرد المركزي الطازجة 1.5 مل وإضافة 4 ميكرولتر من ناقل pET-30a المهضوم. إضافة 1 μL من الرباط العازلة (10X)، 1 ميكرولتر من T4 ligase (3 U) واحتضان خليط التفاعل في 22 درجة مئوية لمدة 3 ساعة.
  5. تحويل الكهربائية المختصة E. القولونية Mach1 الخلايا المختصة عن طريق الكهربائي باستخدام منتجات الربط. نشر الخلايا المحولة على لوحات أجار LB التي تحتوي على 50 ميكروغرام / مل كانامايسين. حضانة الخلايا عند درجة حرارة 37 درجة مئوية لمدة 16 ساعة.
  6. تحقق من المستعمرات للإدراج المطلوب من قبل تسلسل Sanger باستخدام المروج T7 محددة بلازميد والتمهيديات المنهي. إعداد بلازميدات من استنساخ البكتيرية التحقق من صحتها.

7- اختبارات التعبير والنشاط في MgUGD وMgUXS

  1. تحويل E. القولونية BL21 (DE3) الخلايا المختصة مع بلازميدات تحمل الجينات MgUGD وMgUXS ونشر الخلايا المحولة على لوحات أجار LB تحتوي على 50 ميكروغرام / مل كانامايسين. حضانة الخلايا عند درجة حرارة 37 درجة مئوية لمدة 16 ساعة.
  2. زراعة مستعمرة واحدة في 5 مل LB المتوسطة مع 50 ميكروغرام / مل كانامايسين بين عشية وضحاها. نقل الثقافة إلى 400 مل LB المتوسطة ويهز باستمرار في 200 دورة في الدقيقة في درجة حرارة 37 درجة مئوية حتى الكثافة البصرية في الطول الموجي من 600 نانومتر (OD600)يصل امتصاص حوالي 0.5.
    1. خفض درجة حرارة الحضانة إلى 20 درجة مئوية وإضافة 400 درجة مئوية من إيزوبروبيل β-D-ثيوغالاكتوبيرانوسيد (تركيز 1 M). حث على التعبير عن البروتينات المؤتلف لمدة 3 ح.
  3. خلايا الحصاد حسب الطرد المركزي في 4500 × ز لمدة 15 دقيقة عند 4 درجة مئوية. تعليق الكريات في 10 مل من الليسيس العازلة (100 مل كلوريد الفينيل، 50 MM تريس / حمض الهيدروكلوريك، 1٪ تريتون X-100، 1 م فينيل ميثيل سولفونل- فلوريد (PMSF)، درجة الحموضة 8.0).
  4. تعطيل الخلايا عن طريق سونيكيشن لمدة 20 دقيقة (40 دورات على / قبالة مع 20 ميكرومتر السعة لمدة 15 ثانية في 4 درجة مئوية). الطرد المركزي في 14،000 × ز في 4 درجة مئوية لمدة 20 دقيقة وجمع supernatant لاختبار النشاط.
  5. إجراء اختبار نشاط MgUGD عن طريق احتضان 2 ميكرولتر من الخلية lysate مع 2 ميكرولتر من UDP-الجلوكوز (10 MM)، 4 ميكرولتر من NAD+ (10MM)، 4 μL من MgCl2 (10 MM)، 2 ميكرولتر من Tris /HCl العازلة (500 مل، الرقم الهيدروجيني 7.5)، و 6 ميكرولتر من H2O 2 في 1.5 m جديدة mL أنبوب الطرد المركزي وحضانة في 37 درجة مئوية لمدة 30 دقيقة.
  6. إجراء اختبار النشاط من MgUXS عن طريق احتضان 2 ميكرولتر من الخلية lysate مع 2 μL من حمض UDP-glucuronic (10 MM)، 2 ميكرولتر من تريس / حمض الهيدروكلوريكالعازلة (500 مل، درجة الحموضة 7.5)، و 14 ميكرولتر من D 2 O منزوع ة في أنبوب الطرد المركزي 1.5 مل جديدة وحضانة في 37 درجة مئوية لمدة 30 دقيقة.
  7. تبريد ردود الفعل في الخطوة 7.5 و 7.6 عن طريق إضافة 20 ميكرولتر من الميثانول و 40 ميكرولتر من الكلوروفورم إلى كل خليط. بعد دوامة خليط العينة، الطرد المركزي في 14،000 × ز لمدة 6 دقائق في 4 درجة مئوية وجمع الطبقة المائية العليا من كل أنبوب.
  8. تحليل منتجات التفاعل باستخدام قياس الطيف الكتلي MALDI-TOF في وضع التأين السلبي في نطاق م / ض من 500-700. مزيج 1 ميكرولتر من خليط العينة مع 1 ميكرولتر من 2,5-dihydroxybenzoic مصفوفة عينة حمض (1٪ ث / V في 50٪ أسيتوتريل مائي). مراقبة القيم المتوقعة م / ز في 579 و 535 لحمض UDP-glucuronic وUDP-xylose، على التوالي (الشكل4).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

ويبين الشكل 1 لمحة عامة تخطيطية عن طريقة التحضير الموصوفة لمكتبة الـ cDNA المتقاربة المستمدة من أفراد المحار في المحيط الهادئ. ويبين الشكل 2 تسلسل جينات كوكس1 وND لعينة المحار ذات الصلة البعيدة مع اختلاف كبير عن التسلسلات الجينية لـ COX1 وND للمواد المرجعية. ويبين الشكل 3 تسلسل جينات كوكس1 وND لعينة المحار ذات الصلة الوثيقة مع اختلاف منخفض عن التسلسلات الجينية لـ COX1 وND للمواد المرجعية. ويبين الشكل 4 التطبيق الناجح لمكتبة cDNA لاستنساخ الجينات ذات الصلة صناعيا MgUGD وMgUXS.

Figure 1
الشكل 1 نظرة عامة تخطيطية لأسلوب التحليل الموصوف لـ : تحديد الجزيئية من المحيط الهادئ عينة المحار باستخدام COX1 وND كجينات مرجعية. الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 2
الشكل 2 : محاذاة تسلسل تسلسل تسلسل الجينات COX1 وND من عينة متباينة للغاية مقارنة مع تسلسل الجينات COX1 وND من المرجع المحار المحيط الهادئ سلالة. الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 3
الشكل 3 : محاذاة تسلسل تسلسل الجينات COX1 وND من عينة وثيقة الصلة مقارنة مع تسلسل الجينات COX1 وND من المرجع المحار المحيط الهادئ سلالة. الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 4
الشكل 4 نظرة عامة تخطيطية من: الاستنساخ الجزيئي، والتعبير المؤتلف والكشف عن منتجات رد فعل MgUGD وMgUXS. الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

ويسمح البروتوكول المعروض بالتعرف الجيني على عينات المحار غير المشار إليها ذات النمط الظاهري المماثل من أسواق المأكولات البحرية الإقليمية بالمقارنة مع جينات كوكس1 وND مع قاعدة بيانات جينوم الحمض النووي للالمحار المتاحة للجمهور. تكمن أهمية هذه الطريقة في بساطتها، حيث لا يلزم سوى رد فعل PCR واحد لتقييم مكتبة cDNA الافتراضية. تم تضخيم اثنين من الجينات الميتوكوندريا COX1 وND المحفوظة من مكتبة cDNA التي تم إنشاؤها عن طريق النسخ العكسي لمقتطفات الحمض النووي الريبي من كل المحار. تم تبسيط طريقة عزل الحمض النووي الريبي (الخطوة 2.1) عن طريق طحن أنسجة المحار مباشرة في النيتروجين السائل. بعد تسلسل جينات COX1 وND لكل عينة، كشفت محاذاة التسلسل أن بعض العينات تظهر تشابهًا كبيرًا مع السلالة المرجعية. أظهر أقرب الأقارب هوية كاملة لكل من تسلسل جين COX1 وND.

الخطوات الأكثر أهمية من هذا الإجراء هي خطوة استخراج الحمض النووي الريبي; من أجل تقليل تدهور الحمض النووي الريبي، فمن الضروري تقليل الوقت بين حصاد أنسجة المحار واستخراج الحمض النووي الريبي.

وقد تجسد الاستنساخ الناجح في الآونة الأخيرة من خلال استنساخ المحار UGE الجينات12 وهنا عن طريق استنساخ MgUGD وMgUXS الجينات13، والتي تحققت من الناحية العملية لمكتبة cDNA ولدت ، مما يسمح استنساخ أي عدد من الجينات ذات الأهمية دون الحاجة إلى استراتيجيات الاستنساخ مرهقة باستخدام التمهيديات المتدهورة. ويمكن أيضاً استخدام هذه الطريقة في التحديد الجزيئي عن طريق تضخيم جينات كوكس1 وND لتوليد مكتبات الحمض النووي الريبي المتسلسلة تقريباً في التطبيقات المستقبلية للمواد البيولوجية الأخرى التي لا تحتوي على عينات مادية من الجينومات المشار إليها. متاح.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

وليس لدى أصحاب البلاغ ما يكشفون عنه.

Acknowledgments

وقد دعمت هذا العمل جزئيا مؤسسة العلوم الطبيعية في الصين (أرقام المنح 31471703 و A0201300537 و 31671854 إلى J.V. و L.L.، والمنحة رقم 31470435 إلى G.Y.)، وخطة المواهب الأجنبية 100 (رقم المنحة JSB2014012 إلى J.V.).

Materials

Name Company Catalog Number Comments
Chemicals:
1% Triton X-100 Solarbio 9002-93-1 *Alternative distributors possible
2,5-Dihydroxybenzoic acid Alfa Aesar 490-79-9 *Alternative distributors possible
Acetonitrile Merck 75-05-8 *Alternative distributors possible
Agarose for molecular biology Biowest Chemicals 111860 *Alternative distributors possible
Ampicilin Solarbio 69-52-3 *Alternative distributors possible
Chloroform Lingfeng, Shanghai 67-66-3 *Alternative distributors possible
DEPC water Thermo Scientific R0601
Ethanol Jinhuada, Guangzhou 64-17-5 *Alternative distributors possible
Guanidinium thiocyanate-phenol reagent Invitrogen 15596018 TRIzol reagent
Imidazole Energy Chemical 288-32-4 *Alternative distributors possible
Isopropyl alcohol Nanjing Chemical Reagent 67-63-0 *Alternative distributors possible
Isopropyl β-D-thiogalactopyranoside Solarbio 367-93-1 *Alternative distributors possible
Kanamycin Solarbio 25389-94-0 *Alternative distributors possible
LB Agar Thermo Fisher 22700025 *Alternative distributors possible
LB Broth Thermo Fisher 10855021 *Alternative distributors possible
Methanol Jinhuada, Guangzhou 67-56-1 *Alternative distributors possible
MgCl2 hexahydrate Xilong Huagong 7791-18-6 *Alternative distributors possible
NaCl Xilong Huagong 7647-14-5 *Alternative distributors possible
NAD+ Duly Biotech 53-84-9 *Alternative distributors possible
Phenyl-methylsulfonyl fluoride Macklin 329-98-6 *Alternative distributors possible
Tris Solarbio 77-86-1 *Alternative distributors possible
UDP-glucose Wuhu Nuowei Chemicals 28053-08-9 *Alternative distributors possible
UDP-glucuronic acid SIGMA 63700-19-6 *Alternative distributors possible
Tools/Instruments:
MALDI-TOF mass spectrometer Bruker Autoflex *Alternative distributors possible
Metal block heater Long Yang Scientific Instruments Thermoshaker HB20 *Alternative distributors possible
PCR thermocycler Hema 9600 *Alternative distributors possible
Enzyme and Kits:
10×Ligation buffer Thermo Scientific B69 *Alternative distributors possible
5×PrimeSTAR buffer Takara 9158A
Alkaline phosphatase ThermoFisher FastAP EF0654 *Alternative distributors possible
COX forward primer Genscript ATGTCAACAAATCATTTAGACATTG
COX reverse primer Genscript ACTTGACCAAAAACATAAGACATG
Cutsmart Buffer NEB B7204S *Alternative distributors possible
dNTP mix Invitrogen 18427088
MgUGD forward primer Genscript ACATATGACCCTGTCCAAGATCTGTTGT
MgUGD reverse primer Genscript ACTCGAGACTCTGTGAGGCGGTGGAG
MgUXS forward primer Genscript CCATATGGCAGAATCCTCACAATCAC
MgUXS reverse primer Genscript ACTCGAGCACATTTTTGAATTTGCAGACGT
ND forward primer Genscript ATGAGATGGCAATTATTTTTTAAT
ND reverse primer Genscript ATGTATTTTGGAAAAATCTCCAC
PCR Cleanup Kit AxyGen AP-PCR-250 *Alternative distributors possible
pET-30a(+) vector Merck Millipore 69909

DOWNLOAD MATERIALS LIST

References

  1. Blaxter, M. L. The promise of a DNA taxonomy. Philosophical transactions of the Royal Society of London. Series B, Biological. 359, (1444), 669-679 (2004).
  2. Wen, J., et al. Species identification of dried shellfish (oyster, clam and mussel) products sold on the Chinese market. Food Control. 90, 199-204 (2018).
  3. Zhang, H., et al. Mitochondrial cob and cox1 genes and editing of the corresponding mRNAs in Dinophysis acuminata from Narragansett Bay, with special reference to the phylogenetic position of the genus Dinophysis. Applied and Environmental Microbiology. 74, (5), 1546-1554 (2007).
  4. Sell, J., Spirkovski, Z. Mitochondrial DNA differentiation between two forms of trout Salmo letnica, endemic to the Balkan Lake Ohrid, reflects their reproductive isolation. Molecular Ecology. 13, 3633-3644 (2004).
  5. Karadjian, G., et al. Highly rearranged mitochondrial genome in Nycteria parasites (Haemosporidia) from bats. Proceedings of the National Academy of Sciences of the United States of America. 113, (35), 9834-9839 (2018).
  6. Morga, B., et al. Identification of genes from flat oyster Ostrea edulis as suitable housekeeping genes for quantitative real time PCR. Fish and Shellfish Immunology. 29, (6), 937-945 (2010).
  7. Delsuc, F., et al. Molecular systematics of armadillos (Xenarthra, Dasypodidae): contribution of maximum likelihood and Bayesian analyses of mitochondrial and nuclear genes. Molecular Phylogenetics and Evolution. 28, (2), 261-265 (2005).
  8. Wei, S., et al. Discovery and Biochemical Characterization of UDP-Glucose Dehydrogenase from Akkermansia muciniphila. Protein & Peptide Letters. 24, (8), 735-741 (2017).
  9. Gu, B., et al. Discovery and Biochemical Characterization of the UDP-Xylose Biosynthesis Pathway in Sphaerobacter thermophilus. Protein & Peptide Letters. 23, (12), 1103-1110 (2016).
  10. Duan, X. C., et al. Functional characterization of the UDP-xylose biosynthesis pathway in Rhodothermus marinus. Applied Microbiology and Biotechnology. 99, (22), 9463-9472 (2015).
  11. Vogelstein, B., Gillespie, D. Preparative and analytical purification of DNA from agarose. Proceedings of the National Academy of Sciences of the United States of America. 76, (2), 615-619 (1979).
  12. Song, H. B., et al. UDP-glucose 4-epimerase and β-1,4-galactosyltransferase from the oyster Magallana gigas as valuable biocatalysts for the production of galactosylated products. International Journal of Molecular Sciences. 19, (6), 1600 (2018).
  13. Gainey, P. A., Phelps, C. F. Uridine diphosphate glucuronic acid production and utilization in various tissues actively synthesizing glycosaminoglycans. Biochemical Journal. 128, (2), 215-227 (1972).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics