Конвергентная стратегия для поколения практически секвенированных cDNA библиотека от неупомянутых тихоокеанских устриц

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Мы описываем стратегию использования образцов РНК из неупомянутых образцов тихоокеанских устриц и оцениваем генетический материал по сравнению с общедоступными данными генома для создания практически секвенируемой библиотеки кДНК.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Lyu, Y. M., Li, Y. Q., Song, H. B., Guo, J., Wang, T., Liu, L., Yedid, G., Voglmeir, J. A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters. J. Vis. Exp. (148), e59462, doi:10.3791/59462 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Доступ к биологическому материалу эталонных видов, которые ранее использовались в ключевых экспериментах, таких как разработка новых клеточных линий или проектов секвенирования генома, часто трудно предусмотреть для дальнейших исследований или третьих сторон из-за расходный характер образцов. Хотя в настоящее время широко распространены на тихоокеанском побережье Азии, Австралии и Северной Америки, отдельные образцы тихоокеанских устриц генетически довольно разнообразны и поэтому не подходят непосредственно в качестве исходного материала для библиотек генов. В этой статье мы демонстрируем использование неупомянутых тихоокеанских устриц, полученных на региональных рынках морепродуктов для создания библиотек кДНК. Затем эти библиотеки были сравнены с общедоступным геномом устриц, и ближайшая соответствующая библиотека была выбрана с использованием митохондриальных эталонных генов Cytochrome C Oxidase subunit I (COX1) и NADH Dehydrogenase (ND). Пригодность генерируемой библиотеки кДНК также демонстрируется путем клонирования и экспрессии двух генов, кодирующих ферменты UDP-глюкуроновая кислота дегидрогеназы (UGD) и udP-xylose synthase (UXS), которые отвечают за биосинтез UDP-xylose от УДП-глюкоза.

Introduction

Приобретение живого эталонного биологического материала может быть сложным из-за длительного срока поставки, предпринимательских рассуждений или таможенных правил, касающихся конкретных стран. В качестве альтернативы необходимый биологический материал может быть также собран из фенотипически идентичных образцов. Однако эти образцы могут значительно различаться на уровне генотипа, и поэтому сравнения с цифровыми эталонными геномами одного и того же вида часто оказываются трудными или даже бесполезными из-за несовместимости вновь полученного материала с существующих методов усиления ДНК. Секвенирование высоко сохранимых генов отдельных образцов являетсяшироко используемым и мощным инструментом для идентификации видов 1, таких как сохраненные митохондриальные гены, которые часто используются в качестве эталонных генов для оценки качества библиотек кДНК2 ,3,4,5,6. Основное обоснование представленного метода заключается в том, что высокая сохранность последовательностей митохондриальных генов в отдельных анонимных образцах устриц по сравнению с соответствующими последовательностями эталонного генома указывает на то, что другие гены могут также показывать низкий уровень дивергенции, учитывая в целом более высокуюскорость эволюции митохондриальной ДНК по отношению к ядерной ДНК 7, что позволяет усиление и изоляцию широкого спектра научно и промышленно значимых генов, просто используя публично доступные данные последовательности в качестве эталона.

Общая цель описанного в настоящем методе состоит в том, чтобы представить оптимизированный рабочий процесс для создания практически секвенированной библиотеки кДНК устрицы, которая может быть использована в качестве шаблона ДНК для клонирования генов устриц. При виртуальном секвенировании секвенирования генома de novo обходится; вместо этого, известная, цифрово-сохраненная справочная последовательность используется непосредственно для использования или разработки праймеров для производства cDNA, которые в конечном итоге будут состоять из библиотеки (или будут добавлены к уже существующей последовательной). Цель состоит в том, чтобы создать конвергентную библиотеку кДНК, что означает, что сходство между сгенерированными последовательностями кДНК и эталонной последовательностью может ранжироваться от низкого к высокому расхождению. Ключевым преимуществом использования Cytochrome C Oxidase subunit 1 (COX1) и NADH Dehydrogenase (ND) в качестве эталонных генов является то, что даже высоко географически разъединяющие образцы устриц могут быть профилированы из-за высокой консервации этих митохондриальных генов. Доказав подход с этими устоявшимися маркерами, мы затем демонстрируем его применение к двум ферментнымкандидатам, которые участвуют в биосинтезе нуклеотида сахара и могут иметь промышленное значение 8,9, 10. Биотехнологический потенциал тихоокеанской устрицы до сих пор не изучен. Таким образом, мы считаем, что этот сходящийся метод для подготовки практически секвенированных библиотеки кДНК также будет подходящим для неспециалистов исследователей, которые хотят генерировать кДНК из этого соответствующего биологического материала.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

ПРИМЕЧАНИЕ: Схематический обзор показан на рисунке 1.

1. Коллекция образцов

  1. Получить образцы устриц. Держите устриц на льду в послеуборочной период, транспортировки и до лабораторного использования и обработки в течение 4-7 дней после покупки.
    ПРИМЕЧАНИЕ: Для этого протокола, устрицы были приобретены из Чжун Цай оптовый рынок в Нанкине (происходящие из Нинде, Фуцзянь, Китай и Lianyungang, Цзянсу, Китай), Haijie водной продукции компании в Циндао (происходящие из Циндао, Шаньдун, Китай), Цзюйчэн Компания по водным продуктам в Яньтай (из Яньтай, Шаньдун, Китай) и компания Jinxiu Aquatic Product Company в Циндао (из Циндао, Шаньдун, Китай)).

2. Изоляция РНК путем извлечения гиоцианат-фенола

  1. Приготовление образца ткани устрицы
    1. Вырежьте примерно 100 мг однородной мягкой ткани из приблизительного геометрического центра каждого образца устрицы со стерилизовав скальпелем и перенесите образцы в жидкий азот.
    2. Эвтанизировать оставшуюся часть устриц путем замораживания при -80 градусов по Цельсию в течение 1 ч и отбросить в качестве биологических отходов.
    3. Измельчите флэш-замороженную ткань устрицы в мелкий порошок в растворе (200 мл), наполненном 50 мл жидкого азота.
    4. Взвесьте 75 мг замороженной ткани каждого образца в стерильную 1,5 мл центрифуги трубки и смешайте с 1 мл биоциол гиоцинат-фенол экстракционного реагента. Центрифуги образца на 14000 х г при 4 кв кв в течение 15 мин.
  2. Перенесите супернатант в новую центрифугу объемом 1,5 мл, добавьте 200 л хлороформа и тщательно перемешайте с помощью вихревого смесителя на 10-15 с, пока смесь не станет молочно-белой.
  3. Центрифуга при частоте 14 000 х г при 4 кв с в течение 15 минут, и перенесите верхний ваквочный слой тщательно с помощью 200-й пипетки, не нарушая междоусобицу в новую 1,5 мл центрифуги трубки.
  4. Добавьте 500 л изопропилового спирта и аккуратно перемешайте образцы путем инверсии, затем оставьте образцы на 20 мин на льду. Центрифуга при 14000 х г при 4 кв кв в течение 8 мин и удалить супернатант.
  5. Приготовьте каждую из гранул в 1 мл 75% EtOH, и центрифуги на 14000 х г при 4 КК в течение 5 мин. Удалить все супернатанты.
  6. Повторите шаг 2.5 один раз. Высушите гранулы в течение 6 минут при комнатной температуре. Не сушите дольше; в противном случае, это может быть трудно растворить РНК гранулы в следующем шаге.
  7. Растворите сушеные гранулы РНК в 25 Зл DEPC (диэтилпирокарбонат) очищенной воды и держите трубку на льду. Используйте образцы РНК в течение 24 ч.

3. генерация библиотеки cDNA путем обратной транскрипции

  1. Для каждого образца РНК подготовьте реакционную смесь с помощью коммерческой системы обратной транскрипции с помощью 10-й пипетки: Добавить 4 злитромы раствора MgCl2, 2 зл и 10x реакционный буфер, 2 злитроду раствора dNTP, 0,5 л ингибитора RNase, 0,7 л раствора AMV Обратный Транскриптаза, 0,5 л Олиго (дТ) 15 грунтовки, 1 злицу извлеченного образца РНК и 9,3 Л H2O в трубку ПЦР 300 л.
  2. Инкубировать смесь в ПЦР Thermocycler в течение 60 мин при температуре 42 градусов по Цельсию, а затем увеличить температуру до 95 градусов по Цельсию в течение 5 мин.
  3. Храните генерируемую библиотеку кДНК в течение 12 месяцев при -20 градусов по Цельсию.

4. Митохондриальная амплитация и очищение генов

  1. Приготовьте смесь ПЦР с помощью пипетки с топой. Добавьте 0,25 л (1,25 У) полимераза ВЫСОКОй точности ДНК, 2 л раствора dNTP (2,5 мМ каждого dNTP), 0,5 л проецировать COX1 или ND forwardr (100 мкм), 0,5 л соответствующего ND-обратного грунтовки (100 мкм), 1 л библиотеки cDNA (100 мкм), 0,5 л соответствующей COX1 или ND обратной грунтовой версии (100 мкм), 1 л библиотеки cDNA , 5 л 5-х буферного раствора и 16 л дистиллированной H2O в трубку ПЦР мощностью 300 л.
  2. Выполните усиливание ПЦР с использованием следующих параметров: После первоначального шага денатурации при 95 градусах по Цельсию (длительность 5 мин), 35 циклов реакции ПЦР, состоящих из анны ногой при 55 кВ (30 с), шага удлинения при 72 КС (2 мин) и шага денатурации при 95 градусах по Цельсию (30 с) , выполнить один заключительный шаг удлинения в течение 5 мин при 72 градусах По Цельсию.
  3. Используйте 5 ЗЛ продукта ПЦР для проверки с помощью электрофорозного геля агарозного геля качество полученного пЦР-продукта. Наблюдайте за усиленным геном COX1 или ND в качестве одной полосы на 759 или 748 базовых парах, соответственно.
  4. Очистите остальную часть продукта ПЦР с помощью комплекта для очистки ПЦР.
    1. Добавьте в образец 100 кЛ раствора 'PCR-A' (связывающий буфер ДНК, содержащий высокие концентрации чаотропных солей11). Vortex кратко смешать содержимое.
    2. Поместите столбочистку в центрифугу 2 мл. Пипетка реакционная смесь 4.4.1. в колонку. Центрифуга при температуре 14 000 х г в течение 1 мин при комнатной температуре.
    3. Откажитесь от фильтрата из центрифуги трубки. Верните колонку в центрифугу 2 мл, добавьте 700 л раствора 'W2' в колонку и центрифугу при температуре 1 000 х г в течение 1 мин при комнатной температуре ('W2' является стиральным раствором, который содержит высокие концентрации этанола для удаления остаточного паотропного соли из колонки очистки).
    4. Отбросьте фильтрат и верните колонну в центрифугу 2 мл. Добавьте 400 л раствора 'W2' в колонку и центрифугу при 14 000 х г в течение 1 мин при комнатной температуре.
    5. Предварительно разогрейте 1 мл деионированной воды до 65 градусов по Цельсию в металлическом обогревателе блока. Перенесите колонну в новую центрифугу мощностью 1,5 мл. Пипетка 25 л горячей разогретой деионизированной воды в центре мембраны белой колонны. Пусть мембрана замочить в течение 1 мин при комнатной температуре.
    6. Центрифуге при температуре 14 000 х г в течение 1 мин при комнатной температуре и отбросьте столбец.
  5. Храните очищенный продукт ПЦР на срок до 12 месяцев при -20 градусов по Цельсию.

5. Секвенирование и сравнение митохондриальных генов

  1. Отправить очищенные образцы ПЦР со ступени 4.5 для секвенирования Sanger, используя соответствующие грунтовки COX1 или ND в качестве секвенирующих грунтовок. Дополнительно, COX1 или ND обратные грунтовки также могут быть использованы для двунаправленного секвенирования.
  2. После получения результатов секвенирования, сравнить последовательности с геномом последовательности Тихоокеанского штамма устрицы (NCBI Таксономия ID: 29159) с помощью NCBI Нуклеотид BLAST онлайн инструмент (blast.ncbi.nlm.nih.gov) (Рисунок 2 и Рисунок 3 ).

6. Применение библиотеки кДНК для клонирования генов MgUGD и MgUXS

  1. Усиль и очистить гены MgUGD и MgUXS с помощью соответствующих передних и обратных грунтов mgUGD и MgUXS по PCR следующие шаги 4.1. до 4,4.
  2. Передача 2 л буфера пищеварения (10 раз концентрированный) и 6 л деионизированной воды в центрифужную трубку 1,5 мл. Добавьте 10 qL очищенных продуктов MgUGD или MgUXS PCR вместе с ограничением эндонуклеазы Nde I и Xho I (1 Зл каждый, 20 U). Инкубировать при 37 градусах по Цельсию на 3 ч.
  3. Подготовка предварительно переваренных вектора pET-30a: Передача 500 нг вектора pET-30a в новую 1,5 мл центрифуги трубки и пополнить объем до 16 л с использованием деионизированной воды. Добавьте 2 злицита буфера (10x концентрированный) вместе с ограничением эндонуклеазы Nde I и Xho I (1 Л каждый, 20 U).
    1. После инкубации смеси при 37 градусах по Цельсию в течение 3 ч добавьте 1 кЛ щелочной фосфатазы (1 У) и инкубировать при 37 градусах Цельсия в течение дополнительного часа. Инактивируйте щелочным фосфатазой при нагревании при температуре 75 градусов по Цельсию в течение 10 мин в предварительно нагретом металлическом обогревателе.
  4. Перенесите 4 злиц переваренных продуктов ДНК MgUGD или MgUXS в свежие центрифугные трубки 1,5 мл и добавьте 4 л переваренных вектора pET-30a. Добавьте 1 кЛ ligation Buffer (10x), 1 Л лигазы T4 (3 U) и инкубировать реакционную смесь при 22 градусах по Цельсию в течение 3 ч.
  5. Преобразуйте электрокомпетентные e. coli Mach1 Компетентные ячейки с помощью электропорации с помощью перевязочных продуктов. Распространение преобразованных клеток на LB агар пластин, содержащих 50 мкг /мл канамицин. Инкубировать клетки при 37 градусах по Цельсию на 16 ч.
  6. Проверить колоний для желаемого вставки Сэнгер секвенирования с помощью плазмид-специфических T7 промоутер и терминатор грунтовки. Приготовьте плазмиды из проверенных бактериальных клонов.

7. Экспрессия и действия испытаний MgUGD и MgUXS

  1. Преобразуйте E. coli BL21 (DE3) компетентные клетки с плазмидами, несущими гены MgUGD и MgUXS, и распространяйте преобразованные клетки на агарных пластинах LB, содержащих 50 мкг/мл канамицина. Инкубировать клетки при 37 градусах по Цельсию на 16 ч.
  2. Культивировать одну колонию в 5 мл LB среды с 50 мкг /мл канамицин ночь. Перенесите культуру в 400 мл lb среды и непрерывно встряхнуть при температуре 37 градусов по Цельсию, пока оптическая плотность на длине волны 600 нм (OD600) достигает поглощения примерно 0,5.
    1. Снизить температуру инкубации до 20 градусов по Цельсию и добавить 400 л изопропила-D-thiogalactopyranoside (концентрация 1 М). Побудить экспрессию рекомбинантных белков в течение 3 ч.
  3. Урожайные клетки центрифугированием при 4500 х г в течение 15 мин при 4 градусах Цельсия. Приостановить гранулы в 10 мл лисис буфера (100 мм NaCl, 50 мм Tris/HCl, 1% Тритон X-100, 1 мм фенилметилсульфонил-фтор (PMSF), рН 8.0).
  4. Нарушить клетки путем соникации в течение 20 мин (40 циклов в/выкл с амплитудой 20 мкм в течение 15 с при 4 градусах Цельсия). Центрифуга при 14 000 х г при 4 градусах по Цельсию в течение 20 минут и соберите супернатант для теста активности.
  5. Выполните проверку активности MgUGD путем инкубации 2 злител клеточного лизата с 2 зл и УДП-глюкозы (10 мМ), 4 Зл NAD (10 мм), 4 Зл MgCl2 (10 мМ), 2 л буфера Tris/HCl (500 мм, pH 7.5) и 6 л deionized2в новом мЛ центрифуга трубки и инкубировать при 37 кв КС в течение 30 мин.
  6. Выполните деятельность асссы MgUXS путем инкубации 2 злиса клеточного лизата с 2 Зл УДП-глюкуроновой кислоты (10 мМ), 2 qL tris/HCl буфера (500 мм, pH 7.5), и 14 л деионизированного H2O в новой 1,5 мл центрифуги трубки и в
  7. Утолить реакции в шаге 7,5 и 7,6, добавив 20 л метанола и 40 Л хлороформа к каждой смеси. После вихря образца смеси, центрифуга на 14000 х г в течение 6 мин при 4 градусах Цельсия и собирать верхний ваквоковый слой каждой трубки.
  8. Проанализируйте реакционные продукты с помощью масс-спектрометрии MALDI-TOF в режиме отрицательной ионизации в диапазоне м/з от 500-700. Смешайте 1 кВл образца смеси с 1 зл 2,5-dihydroxybenzoic кислоты образца матрицы (1% w/V в 50% aqueous ацетонитрила). Обратите внимание на ожидаемые значения м/з на уровне 579 и 535 для уДП-глюкуроновой кислоты и UDP-ксилозы, соответственно(рисунок 4).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

На рисунке 1 показан ажематический обзор описанного метода подготовки конвергентной библиотеки кДНК, полученной от тихоокеанских устриц. На рисунке 2 показаны последовательности генов COX1 и ND удаленного образца устриц ы с высоким расхождением с генными последовательностями генов COX1 и ND эталонного материала. На рисунке 3 показаны последовательности генов COX1 и ND тесно связанного образца устрицы с низким расхождением с генными последовательностями генов COX1 и ND эталонного материала. На рисунке 4 показано успешное применение библиотеки cDNA для клонирования промышленно значимых генов MgUGD и MgUXS.

Figure 1
Рисунок 1 : Схематический обзор описанного метода анализа для молекулярная идентификация Тихоокеанский образец устрицы использование COX1 и ND в качестве эталонных генов. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 2
Рисунок 2 : Последовательность последовательностей генов COX1 и ND высокодивергентного образца по сравнению с последовательностями генов COX1 и ND из ссылки Тихоокеанская устрица процедить. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 3
Рисунок 3 : Последовательность последовательностей генов COX1 и ND близкородственного образца по сравнению с последовательностями гена COX1 и ND от справки Тихоокеанская устрица процедить. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 4
Рисунок 4 : Схематический обзор молекулярное клонирование, рекомбинантное выражение и обнаружение реакционных продуктов MgUGD и MgUXS. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Представленный протокол позволяет генетическую идентификацию неупомянутых образцов устриц с аналогичным фенотипом региональных рынков морепродуктов путем сравнения генов COX1 и ND с общедоступной базой данных генома ДНК устриц. Значение этого метода заключается в его простоте, так как для оценки виртуальной библиотеки кДН необходима только одна реакция ПЦР. Два сохраненных митохондриальных гена COX1 и ND были усилены из библиотеки кДНК, которая была получена путем обратной транскрипции экстрактов РНК из каждой устрицы. Метод изоляции РНК (шаг 2.1) был упрощен путем непосредственного измельчения ткани устрицы в жидком азоте. После секвенирования генов COX1 и ND каждого образца, выравнивание последовательности показало, что некоторые образцы показывают высокое сходство с эталонной деформацией. Ближайший родственник показал полную идентичность как COX1, так и последовательностей гена ND.

Наиболее важными шагами этой процедуры являются этап извлечения РНК; для того, чтобы свести к минимуму деградацию РНК, важно сократить время между сбором ткани устриц ы и экстракцией РНК.

Успешное клонирование было недавно примером клонирования гена устрицы UGE12 и здесь путем клонирования генов MgUGD и MgUXS13, которые подтвердили практичность генерируемой библиотеки cDNA, что позволило клонировать любое количество генов, представляющих интерес без необходимости громоздких стратегий клонирования с использованием вырожденных грунтовков. Этот метод молекулярной идентификации путем усиления генов COX1 и ND для генерации практически секвенированных библиотек кДНК также может быть использован в будущих приложениях для других биологических материалов, которые не имеют физических образцов эталонных геномов Доступны.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторам нечего раскрывать.

Acknowledgments

Эта работа была частично поддержана Фондом естественных наук Китая (грант ы 31471703, A0201300537 и 31671854 до J.V. и L.L., грант номер 31470435 для G.Y.), и 100 иностранных талантов плана (грант номер JSB2014012 до J.V.).

Materials

Name Company Catalog Number Comments
Chemicals:
1% Triton X-100 Solarbio 9002-93-1 *Alternative distributors possible
2,5-Dihydroxybenzoic acid Alfa Aesar 490-79-9 *Alternative distributors possible
Acetonitrile Merck 75-05-8 *Alternative distributors possible
Agarose for molecular biology Biowest Chemicals 111860 *Alternative distributors possible
Ampicilin Solarbio 69-52-3 *Alternative distributors possible
Chloroform Lingfeng, Shanghai 67-66-3 *Alternative distributors possible
DEPC water Thermo Scientific R0601
Ethanol Jinhuada, Guangzhou 64-17-5 *Alternative distributors possible
Guanidinium thiocyanate-phenol reagent Invitrogen 15596018 TRIzol reagent
Imidazole Energy Chemical 288-32-4 *Alternative distributors possible
Isopropyl alcohol Nanjing Chemical Reagent 67-63-0 *Alternative distributors possible
Isopropyl β-D-thiogalactopyranoside Solarbio 367-93-1 *Alternative distributors possible
Kanamycin Solarbio 25389-94-0 *Alternative distributors possible
LB Agar Thermo Fisher 22700025 *Alternative distributors possible
LB Broth Thermo Fisher 10855021 *Alternative distributors possible
Methanol Jinhuada, Guangzhou 67-56-1 *Alternative distributors possible
MgCl2 hexahydrate Xilong Huagong 7791-18-6 *Alternative distributors possible
NaCl Xilong Huagong 7647-14-5 *Alternative distributors possible
NAD+ Duly Biotech 53-84-9 *Alternative distributors possible
Phenyl-methylsulfonyl fluoride Macklin 329-98-6 *Alternative distributors possible
Tris Solarbio 77-86-1 *Alternative distributors possible
UDP-glucose Wuhu Nuowei Chemicals 28053-08-9 *Alternative distributors possible
UDP-glucuronic acid SIGMA 63700-19-6 *Alternative distributors possible
Tools/Instruments:
MALDI-TOF mass spectrometer Bruker Autoflex *Alternative distributors possible
Metal block heater Long Yang Scientific Instruments Thermoshaker HB20 *Alternative distributors possible
PCR thermocycler Hema 9600 *Alternative distributors possible
Enzyme and Kits:
10×Ligation buffer Thermo Scientific B69 *Alternative distributors possible
5×PrimeSTAR buffer Takara 9158A
Alkaline phosphatase ThermoFisher FastAP EF0654 *Alternative distributors possible
COX forward primer Genscript ATGTCAACAAATCATTTAGACATTG
COX reverse primer Genscript ACTTGACCAAAAACATAAGACATG
Cutsmart Buffer NEB B7204S *Alternative distributors possible
dNTP mix Invitrogen 18427088
MgUGD forward primer Genscript ACATATGACCCTGTCCAAGATCTGTTGT
MgUGD reverse primer Genscript ACTCGAGACTCTGTGAGGCGGTGGAG
MgUXS forward primer Genscript CCATATGGCAGAATCCTCACAATCAC
MgUXS reverse primer Genscript ACTCGAGCACATTTTTGAATTTGCAGACGT
ND forward primer Genscript ATGAGATGGCAATTATTTTTTAAT
ND reverse primer Genscript ATGTATTTTGGAAAAATCTCCAC
PCR Cleanup Kit AxyGen AP-PCR-250 *Alternative distributors possible
pET-30a(+) vector Merck Millipore 69909

DOWNLOAD MATERIALS LIST

References

  1. Blaxter, M. L. The promise of a DNA taxonomy. Philosophical transactions of the Royal Society of London. Series B, Biological. 359, (1444), 669-679 (2004).
  2. Wen, J., et al. Species identification of dried shellfish (oyster, clam and mussel) products sold on the Chinese market. Food Control. 90, 199-204 (2018).
  3. Zhang, H., et al. Mitochondrial cob and cox1 genes and editing of the corresponding mRNAs in Dinophysis acuminata from Narragansett Bay, with special reference to the phylogenetic position of the genus Dinophysis. Applied and Environmental Microbiology. 74, (5), 1546-1554 (2007).
  4. Sell, J., Spirkovski, Z. Mitochondrial DNA differentiation between two forms of trout Salmo letnica, endemic to the Balkan Lake Ohrid, reflects their reproductive isolation. Molecular Ecology. 13, 3633-3644 (2004).
  5. Karadjian, G., et al. Highly rearranged mitochondrial genome in Nycteria parasites (Haemosporidia) from bats. Proceedings of the National Academy of Sciences of the United States of America. 113, (35), 9834-9839 (2018).
  6. Morga, B., et al. Identification of genes from flat oyster Ostrea edulis as suitable housekeeping genes for quantitative real time PCR. Fish and Shellfish Immunology. 29, (6), 937-945 (2010).
  7. Delsuc, F., et al. Molecular systematics of armadillos (Xenarthra, Dasypodidae): contribution of maximum likelihood and Bayesian analyses of mitochondrial and nuclear genes. Molecular Phylogenetics and Evolution. 28, (2), 261-265 (2005).
  8. Wei, S., et al. Discovery and Biochemical Characterization of UDP-Glucose Dehydrogenase from Akkermansia muciniphila. Protein & Peptide Letters. 24, (8), 735-741 (2017).
  9. Gu, B., et al. Discovery and Biochemical Characterization of the UDP-Xylose Biosynthesis Pathway in Sphaerobacter thermophilus. Protein & Peptide Letters. 23, (12), 1103-1110 (2016).
  10. Duan, X. C., et al. Functional characterization of the UDP-xylose biosynthesis pathway in Rhodothermus marinus. Applied Microbiology and Biotechnology. 99, (22), 9463-9472 (2015).
  11. Vogelstein, B., Gillespie, D. Preparative and analytical purification of DNA from agarose. Proceedings of the National Academy of Sciences of the United States of America. 76, (2), 615-619 (1979).
  12. Song, H. B., et al. UDP-glucose 4-epimerase and β-1,4-galactosyltransferase from the oyster Magallana gigas as valuable biocatalysts for the production of galactosylated products. International Journal of Molecular Sciences. 19, (6), 1600 (2018).
  13. Gainey, P. A., Phelps, C. F. Uridine diphosphate glucuronic acid production and utilization in various tissues actively synthesizing glycosaminoglycans. Biochemical Journal. 128, (2), 215-227 (1972).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics